Dorsal-to-Ventral Cortical Expansion Is Physically Primed by Ventral Streaming of Early Embryonic Preplate Neurons

Article

Dorsal-to-Ventral Cortical Expansion Is Physically Primed by Ventral Streaming of Early Embryonic Preplate Neurons Graphical Abstract

Authors Kanako Saito, Mayumi Okamoto, Yuto Watanabe, ..., Tomoyasu Shinoda, Akira Sakakibara, Takaki Miyata

Correspondence [email protected]

In Brief Embryonic radial glial fibers that guide most neocortical neurons are ventrally deflected near their terminal, contributing to further expansion of the neocortical area. Saito et al. demonstrate that this fiber deflection is induced physically by a previously unrecognized ventral stream of the earliest generated preplate neurons.

Highlights d

How the embryonic neocortex expands ventrally has not been understood mechanically

d

Preplate neurons generated in the earliest corticogenic stage stream ventrally

d

Decreasing this stream reduces the normal ventral deflection of radial glial fibers

d

Decreasing this stream dorsally shrinks the postnatal neocortical map

Saito et al., 2019, Cell Reports 29, 1555–1567 November 5, 2019 ª 2019 The Author(s). https://doi.org/10.1016/j.celrep.2019.09.075

Cell Reports

Article Dorsal-to-Ventral Cortical Expansion Is Physically Primed by Ventral Streaming of Early Embryonic Preplate Neurons Kanako Saito,1 Mayumi Okamoto,1 Yuto Watanabe,1 Namiko Noguchi,1 Arata Nagasaka,1 Yuta Nishina,1 Tomoyasu Shinoda,1 Akira Sakakibara,1,2 and Takaki Miyata1,3,* 1Anatomy

and Cell Biology, Nagoya University Graduate School of Medicine, Nagoya, Japan of Life and Health Sciences, Chubu University, Kasugai, Japan 3Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.09.075 2College

SUMMARY

Despite recent studies elucidating the molecular mechanisms underlying cortical patterning and map formation, very little is known about how the embryonic pallium expands ventrally to form the future cortex and the nature of the underlying forcegenerating events. We find that neurons born at embryonic day 10 (E10) in the mouse dorsal pallium ventrally stream until E13, thereby superficially spreading the preplate, and then constitute the subplate from E14. From E11 to E12, the preplate neurons migrate, exerting pulling and pushing forces at the process and the soma, respectively. At E13, they are morphologically heterogeneous, with
40% possessing corticofugal axons, which are found to be in tension. Ablation of these E10born neurons attenuates both deflection of radial glial fibers (by E13) and extension of the cortical plate (by E14), which should occur ventrally, and subsequently shrinks the postnatal neocortical map dorsally. Thus, the preplate stream physically primes neocortical expansion and arealization. INTRODUCTION Mammalian neocortex exhibits a disproportionally ‘‘luxurious’’ representation of somatotopies in its lateral region. The adult lateral neocortex, where the homunculus or mouseunculus is broadly mapped, is superficial to the striatum (Figure 1A). In early embryonic development, by contrast, the pallium (neocortical primordium) is dorsal to the ganglionic eminences (striatal primordia) (Puelles et al., 2000; Pattabiraman et al., 2014), indicating that the pallium, especially its outer (i.e., neuronal) zone, undergoes ventral expansion/growth in order to ‘‘ride on’’ the striatum. Clonal analyses revealed a greater tangential dispersion of neurons in the lateral part of the growing neocortex than in the medial part (Tan et al., 1995; Gao et al., 2014). One explanation for this ventral neocortical expansion is that radial glial fibers, which are used for neuronal guidance (Rakic, 1972), exhibit an extensively curving and divergent alignment

pattern in the lateral part (Misson et al., 1988, 1991) (Figure 1B), which can be coupled with tangential translocations of neurons from one radial fiber (RF) to another (O’Rourke et al., 1992; Tabata and Nakajima, 2003). In addition, the fact that neuron production by progenitors begins and proceeds earlier in the lateral/ventral part than in the dorsomedial parts (Hicks and D’Amato, 1968; Smart and Smart, 1977) allows us to imagine that tissue volume can easily increase laterally or ventrally. There remains, however, an additional model that has not been previously tested, because of technical difficulties: dorsal-to-ventral migration of neurons born very early in the pallium could contribute to the ventral-dominant neocortical expansion, either directly or by causing (rather than resulting from) the curvature of RFs (Figure 1C). Dorsal-to-ventral tangential migration into the dorsal pallium has been observed in Cajal-Retzius (CR) cells derived from the hem region (Takiguchi-Hayashi et al., 2004; Borrell and Marı´n, 2006; Yoshida et al., 2006). The early emergence of CR cells underlies their histogenetic influence on later born neurons (Ogawa et al., 1995; de Frutos et al., 2016), which is enhanced by their tangential dispersion (Bielle et al., 2005; Barber et al., 2015). In contrast, the majority of subplate (SP) neurons, another developmentally influential type of early-born neurons (McConnell et al., 1989; Ghosh et al., 1990; Ohtaka-Maruyama et al., 2018; reviewed in Allendoerfer and Shatz, 1994; Hoerder-Suabedissen and Molna´r, 2015), are thought not to migrate tangentially from their origins in the dorsal pallium (reviewed in Barber and Pierani, 2016). However, recent studies have reported that some SP neurons come from an extracortical origin (rostromedial telencephalic wall [RMTW]) by a medial-to-lateral influx (Pedraza et al., 2014; Garcı´a-Moreno et al., 2018) and that a fraction of neurons born in the ventricular zone (VZ) of the pallium and the palliostriatal interface migrate ventrally to contribute to the lateral olfactory tract (LOT) area, olfactory cortex, amygdala, striatum, or other forebrain structures (Tomioka et al., 2000; Hamasaki et al., 2001; Hirata et al., 2002; Remedios et al., 2007; Garcı´aMoreno et al., 2008; Cocas et al., 2009; Pombero et al., 2011). Together, these observations (Figure 1C) prompted us to carefully investigate whether dorsal pallium-derived SP neurons also migrate ventrally. To that end, in this study, we performed site-directed labeling of the mouse pallium (from the dorsal pallium to the lateral/ ventral pallium) via in utero electroporation (IUE) at embryonic

Cell Reports 29, 1555–1567, November 5, 2019 ª 2019 The Author(s). 1555 This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

Figure 1. Neocortical Expansion and Deflection of RFs, Which Occur Ventrally during the Embryonic Period (A) Adult mouse neocortex (green), with a somatosensory mouseunculus, spread ventral to the palliostriatal angle (PS angle, red spot). D, dorsal; LV, lateral ventricle; S, striatum; V, ventral. (B) Asymmetric ventral-ward deflection of RFs in the lateral (L) region of E18 neocortex (from Misson et al., 1991). CP, cortical plate; ESS, external sagittal stratum; IZ, intermediate zone; M, medical; SP, subplate; VZ, ventricular zone. (C) Schematic diagram summarizing the previously reported dorsal-to-ventral (D-to-V) migration of neurons into or from the pallium or the pallio-subpallial boundary (PSP boundary) and questions asked in this study. (D) 9-4c immunoreactivity in PSP boundary. (E) Superimposed images of anti-Pax6 and antiTbr1 staining, obtained from two adjacent sections. L, lateral; PP, preplate. (F) Anti-Nestin staining. (G) RC2, anti-Laminin, and anti-bIII-tubulin staining. Distal RFs were ventrally deviated (arrow).

RESULTS

day (E) 10, followed by tracking both in vivo and in slice culture. We found that the earliest pallial-born neurons that constitute the preplate (PP) (Rickmann et al., 1977; Valverde et al., 1995) (also known as the primordial plexiform layer; Marin-Padilla, 1971), which contained abundant SP-destined neurons, underwent a massive ventral locomotion during the E11–E12 period. This PP stream continued until E13, when multiple somal behaviors reflecting heterogeneous neuronal morphologies (including nucleokinesis into corticofugal axons) drove a collective, tissuelevel flow. E10 IUE-mediated reduction of these PP neurons attenuated the ventral deflection of RFs at E13 and the ventral extension of the cortical plate (CP) at E14, resulting in a dorsal shift of the neocortical map, including somatosensory barrels, in the early postnatal period. Thus, this ventral PP stream plays a key mechanical role in the expansion of the neocortex, revealing the unexpected reliance of the RF-based protomap mechanism (Rakic, 1988) on early tangential (frontier-advancing) neuronal migration.

1556 Cell Reports 29, 1555–1567, November 5, 2019

Ventral Expansion of the Neocortical Region Begins in the Early Embryo with Ventral Deflection of the Distal RFs To morphometrically analyze the lateral/ ventral expansion of the presumptive neocortical region during the embryonic period, we first used 9-4c, a monoclonal antibody that visualizes the pallio-subpallial (PSP) boundary (Hirata et al., 2002). Although the dorsal border of the 9-4c immunoreactivity was fixed along the ventricular surface, close to the palliostriatal (PS) angle, it progressively shifted ventrally along the pial surface (Figure 1D). External covering of the striatum by a part of the pallium was already evident by E13. Further analysis from E10 to E13, on the basis of antiPax6 and anti-Tbr1 immunohistochemistry (Figure 1E), revealed that the ‘‘riding’’ of the striatum by the pallium (below the level of the PS angle) was accompanied by a disproportional (dorsal < ventral) thickening of an outer superficial zone containing Tbr1+ neurons (i.e., PP) in the pallial wall (i.e., the portion dorsal to the PS angle), which led us to hypothesize that neurons born in the dorsal pallium to constitute PP by E11 might have ventrally migrated superficially within the pallial wall (Figure 1C). During this early (
E13) period, Nestin+ RFs in the pallial wall exhibited an oblique alignment pattern at the distal part (Figure 1F). Careful inspection of the PSP boundary and the dorsally neighboring region covered with Laminin+ basal lamina at E11 revealed that the distal-most part of RC2+ RFs was ventrally deviated in a thin (one- or two-cell-thick) superficial zone

Figure 2. Ventral Shift of E10 Pallial-Born Neurons during In Vivo Development (A) Anti-GFP photomicrograph showing that neurons labeled with IUE at E10 (CAG-EGFP) constituted the subplate (SP) at postnatal day (P) 8. (B) TdTomato and anti-GFP photomicrographs of P8 cortices after IUE of Ai14 mice with EF-cre and CAG-EGFP vectors. GFP+ neurons (arrow) were found more ventrally than in the region most heavily TdTomato+. dor, dorsal; lat, lateral; vent, ventral. (C) Anti-GFP staining of an E15 hemisphere that had been electroporated (dorsally) at E10. Arrow, most heavily labeled SP-like neurons. Thick arrow, ventral limit of clear VZ-cell labeling. (D) Whole-mount photomicrographs showing that neurons heavily labeled with RFP via IUE at E10 using NeuroD-cre were found more ventrally at E12 than the main IUE region (brightly GFP+ because of more continuous and progenitor-directed expression of EF-Lyn-EGFP). A, anterior; d, dorsal; p, posterior; v, ventral. (E) Anti-GFP stained coronal sections of an E12 cerebrum that received IUE at E10. Heavily labeled PP neurons (arrow, E0 ) were Tbr1+ and seen more ventrally than their VZ origin, but negative for Reelin. Some of them had axon-like fibers (asterisk, E00 ).

(Figures 1G and S1A) that contained tangentially oriented PP neurons (bIII-tubulin+ and Tbr1+) (Figures 1G and S1B). This observation was supported by scanning electron microscopy (Figure S1C). Neurons Born in the Dorsal Pallium at E10, Including Presumptive SP Cells, Migrate Ventrally to Stream PP To determine whether PP neurons migrate ventrally, we subjected the dorsal pallium to IUE at E10, which is useful for labeling neurons that contribute to SP (Shimogori and Ogawa, 2008; Ohtaka-Maruyama et al., 2018) (Figures 2A and S2A). To examine the relationship between the distribution of E10 pallial-born neurons and their VZ origin in vivo, we subjected E10 Ai14 mice to IUE with CAG-EGFP together with EF-cre, which allowed us to retrospectively identify the position of

IUE through postnatal detection of TdTomato fluorescence (Figure 2B). GFP+ neurons that formed SP at postnatal day (P) 8 had been labeled by IUE at the dorsomedial, dorsal, and dorsolateral pallium, and their postnatal distribution was more ventral than their VZ origin. This origin-destination relationship was reproduced in SP cells at E15 (Figure 2C) and also applied to other non-SP-like neurons in the lateral or ventrolateral cortex (such as the insula, piriform cortex, and claustrum) (Figure 2B). These data were consistent with a recent fatemapping study using transgenic mouse lines with different (domain-specific) enhancers (Pattabiraman et al., 2014). E10 IUE-labeled neurons observed in SP at E14 and later were immunoreactive for MAP2 (Crandall et al., 1986; Chun and Shatz, 1989) (Figures S2B and S2C) and Nurr1 (Hoerder-Suabedissen and Molna´r, 2013) (Figure S2D). Further in vivo analysis revealed that a ventral shift of neurons from their VZ origin was already detectable at E12, in both flatmount observation (Figure 2D) and coronal section (Figure 2E). Heavily IUE-labeled neurons spread ventrally were sometimes found near LOT (and were identified as lot cells using the lot1 monoclonal antibody [mAb]; Tomioka et al., 2000) (Figure S2E), whereas they were always negative for Reelin and therefore distinct from CR cells derived from the medial-most (hem) region (Figure 2E). Live monitoring (at E11 or E12) of coronal slices (Figures 3A–3C; Videos S1A, S1C, and S1D) and flat-mount cerebral

Cell Reports 29, 1555–1567, November 5, 2019 1557

Figure 3. Ventral Locomotion of E10 PallialBorn Neurons and Their Pulling- and Pushing-like Behaviors Observed in Slices at E11 and E12 (A) An E11 coronal slice cultured in soft collagen gel containing microbeads (Video S1A). Beads embedded in the outer (basal/pial) side of the slice moved toward the slice and dorsally, whereas those in the opposite (apical/ventricular) side did not move. (B) A coronal slice monitored at E12 for 8 h, following IUE at E10 (Video S1C). (C) High-resolution time-lapse monitoring of E10born PP neurons in an E12 coronal slice (Video S1D, cell 2). (D) High-resolution live monitoring of three RFs in an E11 pallium covered with intact meninges/mesenchyme (Video S2B). (E) Simultaneous monitoring of a single RF (EGFPlabeled via IUE) and nuclei of PP neurons (n) in a pallial wall prepared from an E11 H2B-mCherry transgenic mouse (Video S2C).

walls (Figure S3A; Video S1B) prepared following IUE at E10 revealed that heavily labeled cells constituted PP and underwent a massive ventral migration. The averaged total displacement was 139 mm (in 4.0 h) at E11 (n = 20), 64 mm (in 2.8 h) at E12 (n = 18), and 129 mm (in 11.9 h) at late E12 (n = 25), whereas the longest total displacement observed was 393 mm (in 9.5 h) at E11 and 278 mm (in 23 h) at late E12. They exhibited locomotion-like salutatory behaviors, with average velocities of 32.2 mm/h at E11 and 21.1 mm/h at E12 (Figure 3C; Video S1D). This PP flow occurred beyond the level of the ventricular PS angle, expanding the pallial territory in the basal/superficial (neuronal) zone and curving the PSP boundary. These results were consistent with the in vivo growth (i.e., extension and thickening) of the Tbr1+ PP between E11 and E13 (Figure 1E) and the in vivo detected ventral shift of the E10 IUE-labeled neurons (e.g., 500 mm by E12) (Figures 2D and 2E). Introduction of dominant-negative forms demonstrated the dependence of this ventral PP stream on Rac1 and N-cadherin (Figure S2F); average migration velocities of neurons in late E12 slices were reduced (12.0 mm/h [n = 25] in control; 8.4 mm/h [n = 21] upon expression of dominant-negative Rac1 [p = 6.0 3 108]; 4.8 mm/h [n = 26] in dominant-negative N-cadherin [p = 5.8 3 103]; exact Wilcoxon rank-sum test). Our immunohistochemical analysis did not reveal any abnormalities in the ventral extension of PP at E12 in reeler mice (data not shown) or in mice lacking CXCR4 (the receptor of CXCL12, which supports tangential migration of CR cells; Borrell and Marı´n, 2006) (data not shown).

1558 Cell Reports 29, 1555–1567, November 5, 2019

Ventrally Locomoting E10-Born Neurons Exert Pulling and Pushing Forces and Spatially Interact with Distal RFs We next sought to assess how neurons ventrally locomoting in the E11–E12 PP (Figures 2 and 3) behave mechanically and how their behaviors are spatially associated with the ventral deflection of RFs (Figure 1). In various types of collective cell migration, pulling (by cellular processes with growth cone-like anchoring activity, at the front) and pushing (by cell bodies, which follow the pulling processes) collaborate (Bazellie`res et al., 2015; Vassilev et al., 2017). We reasoned that RFs would be ventrally deflected if they were pushed from the dorsal side by the somata of ventrally locomoting PP neurons, which should be mechanically linked with pulling at the front (i.e., processes) of these neurons. Microbeads are useful for assessing pulling by cellular processes (Minegishi et al., 2018; Umeshima et al., 2019). Hence, we used soft collagen gel containing fluorescent microbeads (Figure 3A) to culture coronally sliced E11 pallial walls (freed from meninges), in which PP neurons are expected to superficially migrate ventrally (Figures 1G, S1B, and S1C). Strikingly, ventral-to-dorsal and slice-directed displacement of the beads was observed along the basal, but not apical, surface (Figure 3A; Video S1A), suggesting that PP neurons ventrally migrating along the outer surface of the pallial wall exerted pulling at their gel-facing front. We separately confirmed in explant cultures that microbeads were pulled by cellular processes extended into the gel (Figure S3B; Video S2A). Culturing slices in soft gel, which can be easily deformed, is most suitable for detecting pulling that occurs at the outer surface of slices but is not ideal for observing pushing in that region. The meningeal basal lamina, the major target for pulling by superficially migrating PP neurons (Figures 1G, S1B, and S1C), is likely to resist pulling by PP neurons (at the leading process) and thus counteract it, allowing the PP neurons to elicit a pushing force at

Figure 4. Observation and Mechanical Assessment of PP Neurons, Including Axon-Bearing Neurons, in E13 Pallial Walls (A) A coronal slice monitored at E13 for 10 h (Video S3A). (B) Schematic illustration summarizing deflection of RFs, which is deeper at E13 than at earlier stages. (C) Monitoring of a single E10-born neuron in an E13 coronal slice, with tracking of non-axon processes (small blue arrow) and the nucleus (Video S4A). (D and E) Live observation of PP neurons retrogradely labeled with DiI inserted into the internal capsule (IC) at E13 (Video S4B for D, recorded with shorter [5 min] time intervals than in E). (F) Anti-TAG1 (magenta) and anti-L1 (green) staining at E13. (G) Physical model simulating a possible pulling force by axons extended corticofugally to the subpallium. The elastic property given to the axon by a rubber string causes a warping response of the pallial wall (Video S4C). (H and I) Photomicrographs of coronal cerebral slices (meninges-free) prepared at E13. Merged bright-field and GFP images of a control slice (H) and an axon-cut slice (I) taken at 0 min (green) and 120 min (magenta) are shown. The intact slice (H) exhibited an outward warping of the pallial wall (cyan rightward arrows) (see Video S4E for another example) and shrinkage of the ventral edge of the subpallial part (cyan leftward arrow), with a shortening of the EGFP+ corticofugal axons (asterisk, light blue illustrated below) from the E10-born PP/SP neurons (blue dots). The axon-cut slice (I) almost entirely lost the extensive warping response and instead exhibited bidirectional shrinkage (red arrows) of the cut edges (see also Figure S3I). Narrowing of the apical surface (yellow centripetal arrows) occurred in both slices.

the soma. Indeed, live imaging of an E11 pallial wall covered closely with intact meninges revealed that RFs gradually deviated ventrally, with the endfeet translocating ventrally (Figure 3D; Video S2B). Dual-color monitoring at or near the intact basal/ meningeal surface revealed that when the nuclei and somata of neurons moved ventrally, RF endfeet also translocated ventrally (Figure 3E; Video S2C). At deeper levels within PP, pulling may occur intercellularly between migrating neurons (Figure S3C), and pushing by the soma can clearly be inferred; RFs were displaced ventrally where PP neurons passed through (Figure S3D). Thus, the multicellular dynamics in PP, which orthogonally contains RFs, is consistent with a model in which the PP stream participates in realignment of RFs on and near the basal surface. PP Neurons during the Transition into the CP Stage Are Morphologically and Behaviorally Heterogeneous Ventral nucleosomal translocation of PP neurons in the dorsolateral region continued until E13 (Figure 4A; Video S3A) with a

much smaller velocity (4.2 mm/h; average displacement was 78 mm in 19.3 h, n = 25) but was no longer observed at E14 (Figures S3E and S3F; Video S3B). During this transition from the PP stage to the CP-forming stage, the site of obliqueness that occurred in RFs became farther from the basal surface (Figure 4B). Just before and during this transitional step, corticofugal axons start to grow (Kim et al., 1991; De Carlos and O’Leary, 1992; Erzurumlu and Jhaveri, 1992; Molna´r et al., 1998; Auladell et al., 2000; Espinosa et al., 2009). Hence, we asked whether, and if so how, pioneering axons participate in this late PP stream. Live inspection at E13, following IUE-based labeling at E10, revealed that 61% of the total E10-born neurons observed (n = 44) did not have axon-like long processes and that their nucleosomal movements were preceded by ventral and inward extension of short (20–30 mm) processes (Figure 4C; Video S4A). The remaining population (39% in the same E10 IUEbased counting) had long axons running beyond the PSP boundary (Figure S3G). Such axon-bearing PP neurons were also

Cell Reports 29, 1555–1567, November 5, 2019 1559

visualized by retrograde labeling with DiI from the internal capsule, and the nucleus of each axon-bearing PP neuron moved into the axon (Figures 4D and 4E). These axon-bearing neurons enabled us to detect collective displacement of PP neurons (Figure 4D; Video S4B), in which all neuronal elements together (axon, soma, and dendrite-like outward-extended process) moved exclusively ventrally, independently of the cell-intrinsic, intra-axonal nucleokinesis. RFs live-monitored in E13 slices exhibited an abrupt bending at the level of presumptive SP (interface between PP and the intermediate zone), where axons from more dorsal regions grow ventrally to form the external sagittal stratum (ESS) (Misson et al., 1988) (Figure S3H; Video S4C). These results raised the possibility that corticofugal axons from PP (mostly from SP cells) play a mechanical role in the collective PP streaming. PP-Derived Corticofugal Axons Are in Tension between the Pallium and Subpallium at E13 Axons exhibit traction forces at the growth cone (Bray, 1984; Lamoureux et al., 1989), and corticofugal pioneering axons have larger growth cones than follower axons (Kim et al., 1991). In vivo, Drosophila axons are under a rest tension; consequently, in response to tissue deformation, they behave like elastic springs (Siechen et al., 2009; Rajagopalan et al., 2010). This observation suggests that axons ventrally growing (Figure 4F) participate in the streaming of PP (especially somata of PP neurons) through pulling from the distal/ventral side. Our physical model (Figure 4G; Video S4D) suggested that if pallial walls containing an elastic rubber string (representing axons in tension; Siechen et al., 2009; Rajagopalan et al., 2010) are released from a holding/constriction by the surrounding tissues (i.e., subjected to a residual stress-releasing test; Franze, 2013; Okamoto et al., 2013; Shinoda et al., 2018), it would recoil outward, exhibiting a ‘‘warping’’ response. Indeed, when E13 cerebral walls were isolated from the skull and freed from the meninges and quickly sliced coronally, keeping the pallium and subpallium fully connected, the slices exhibited outward warping of the pallial wall (Figure 4H; Video S4E) (n = 5/5). This warping was quantitatively characterized by a reduction in the distance from the intra-pallial PP to the ventral edge of the subpallium (to 91% ± 3%), between which the corticofugal axons from PP neurons run (Figure 4H), reproducing the results of the physical simulation. When we made surgical incisions crossing the corticofugal axons (Figure 4I), the slices exhibited much weaker warping (n = 5 of 5), with shrinkage of the cut edges in the dorsal and ventral directions, as well as significantly milder shortening (to 96% ± 2%, p = 0.024, exact Wilcoxon rank-sum test) of the distance from the intra-pallial PP to the ventral edge of the subpallium. The responses of both healthy axons (shortening during the slice warping) and cut axons (shortening to both distal and proximal sides) were consistent with the idea that the PP-derived earliest corticofugal axons were under tension, as in the case of axons of in vivo Drosophila neurons in which tension is evidenced biophysically (Siechen et al., 2009; Rajagopalan et al., 2010). Cerebral walls completely separated from GE also exhibited dorsal warping/shortening of the PSP boundary region (Figure S3I). Together, these physical examinations support the

1560 Cell Reports 29, 1555–1567, November 5, 2019

in vivo existence of tension in corticofugal axons derived from PP neurons. Experimental Weakening of PP Stream Decreases RF Deviation by E13 To determine whether the PP stream is necessary for the ventral curving/deflection of RFs, we decreased the number of E10 pallial-born neurons via IUE-mediated expression of the diphtheria toxin A (DTA) chain under the control of the NeuroD promoter (NeuroD-DTA). As early as 12 h after IUE, NeuroD-DTA (1 mg/ml) killed differentiating cells without harming undifferentiated RF-forming progenitors (radial glial cells [RGCs]) (Watanabe et al., 2018) (Figure S4A). At E11, the spatial expression patterns of FGF8, Wnt3a, Emx1, and Pax6 were not affected (Figure S4B), and no excessive cell death was observed in VZ (Figure S4C). Neurons born later than E10 (e.g., Ctip2+ neurons or those labeled with bromodeoxyuridine [BrdU] administered at E12) did not die excessively by E12 or E13 (Figures S4D and S4E). Furthermore, we did not observe over-proliferation of progenitor cells in VZ and SVZ at E12 and E14 (Figures S4F and S4G). At E13, we quantitatively assessed the morphology of RGCs labeled from the outer pallial surface with DiI (Miyata et al., 2001; Saito et al., 2003) (Figures 5A–5C). We compared the PP-ablated cerebral walls (E10 electroporated with NeuroDDTA at two different concentrations, 0.5 and 1 mg/ml [we observed more PP neuron death by 12 h at 1 mg/ml than at 0.5 mg/ml; Figure S4A]) and normal (control GFP-IUE and contralateral [non-IUE]) cerebral walls using two different approaches (‘‘length ratio’’ and ‘‘angle;’’ see STAR Methods). We found that the ventral deflection of RGCs from the shortest ventricle-to-pia line was seen much more clearly in the lateral part (closest to the PS angle), making a crease/angle at the level of presumptive SP (or ESS), than in the dorsal region (far from the PS angle) (R2 = 0.44 [length ratio] and R2 = 0.31 [angle] for contralateral/non-IUE; R2 = 0.46 [length ratio] and R2 = 0.48 [angle] for control GFP-IUE). RGC deflection was much less evident when the PP stream was weakened, with both the length ratio and angle reduced in a NeuroD-DTA dose-dependent manner (R2 = 0.17 [length ratio] and R2 = 0.13 [angle] at 0.5 mg/ml; R2 = 0.05 [length ratio] and R2 = 0.02 [angle] at 1 mg/ml) (p = 0.23 and p = 0.38 at 0.5 mg/ml and p = 0.02 and p = 0.04 at 1 mg/ml, analysis of covariance [ANCOVA]) (Figures 5D, 5E, and S5A). These results suggest that the PP stream contributes to the RF deviation/deflection that occurs by E13. Experimental Weakening of the PP Stream Decreases Ventral Extension of CP To determine whether the aforementioned PP stream contributes to the formation/growth of CP, we electroporated embryos with NeuroD-DTA at E10, administered BrdU at E12, and then performed immunohistochemistry for BrdU, Ctip2, and Satb2 at E14 (Figure 6A). We focused on the lateral (ventralmost) CP region into which neurons originating from the dorsolateral pallial VZ close to the PS angle could migrate (Figures S5B and S5C). The lateral CP was less ventrally extended in the DTA-electroporated walls than in the contralateral walls (Figures 6B–6E); note that CP extension was indistinguishable

Figure 5. Weakening of PP Stream Results in Smaller Deflection of RFs by E13 (A) Experimental design. IUE with EF-Lyn-EGFP with NeuroD-DTA at E10 was followed by DiI labeling of the outer surface of pallial walls at E13. (B) GFP signal detected at E13. (C) Representative DiI-labeled RGCs in a NeuroDDTA-electroporated (also GFP-labeled) hemisphere and those in the contralateral hemisphere. (D) Comparison of the ‘‘length ratio’’ (total length of each RGC divided by the thickness of the wall measured from the apical endfoot). Wall thickness was measured by drawing a line (blue) perpendicular to the surface. RGCs analyzed were 48 (from eight embryos) for contralateral/non-IUE, 25 (from four embryos) for EF-Lyn-GFP-IUE, 27 (from six embryos) for 0.5 mg/ml (1/2) NeuroD-DTA (blue), and 26 (from four embryos) for 1 mg/ml NeuroD-DTA (orange). (E) Comparison of the ‘‘angle’’ of RF deflection (designated as an angle formed by the inner portion of each RGC and the shortest line from the apical endfoot of that RGC).

well as their intra-CP migration, were frequently oblique (ventrally deviated) (Figure S5E; Video S5). At E15, however, new neurons entered and migrated in CP almost perpendicularly toward the pial surface (Figure S5F).

between the GFP-electroporated wall (i.e., the true control) and the contralateral un-electroporated wall (Figure S5D). The less ventrally extended (p < 0.001) CP in the PP-reduced (NeuroDDTA-E10-electroporated) hemispheres was thinner (Figure 6F) (p < 0.001) and contained a higher density of BrdU+ nuclei (Figure 6G) (p < 0.001) than normal CP (exact Wilcoxon rank-sum test). Although the inside-out segregation pattern of earlyborn (Ctip2+, deep) neurons and later born (Satb2+, relatively superficial) neurons was conserved in these abnormal CPs formed under compromised PP streaming, it was vertically compressed (Figures 6H and 6I). These data strongly suggest that PP streaming until E13 assists in the ventral-ward formation of CP. To determine how CP is initiated in the presence of the PP stream, we live-monitored pallial walls in which the nuclei of all cells, including CP-initiating cells, could be visualized using the H2B-mCherry transgene (Abe et al., 2011). We found that the entrance of neurons into a newly emerging CP at E14, as

Experimental Weakening of the PP Stream Dorsally Shifts the Postnatal Neocortical Map, Including Somatosensory Barrels To determine whether the early embryonic PP stream is necessary for the normal and ordered establishment of functional mapping in the postnatal neocortex, we subjected E10 Ai14 mice to IUE with NeuroD-DTA or control CAG-EGFP vectors together with EF-cre (Figures 2B and 7A). TdTomato+ hemispheres at P8 were subjected to in situ hybridization (ISH) for Rorb (in coronal sections) and cytochrome oxidase (CO) in flat-mount sections (Figure 7A). Comparison between the electroporated side and the contralateral side in CAG-EGFP-electroporated hemispheres revealed that the arealization pattern visualized with Rorb ISH was completely symmetrical, irrespective of the site of IUE (TdTomato+ region) (n = 3/3) (Figure 7B). In contrast, the same right-left comparison for NeuroD-DTA-electroporated hemispheres revealed dorsal shifts of Rorb+ domains on the IUE side (Figure 7C). In hemispheres that were electroporated in the lateral region, lateral Rorb+ domains such as Au1 or S2 shifted dorsally (Figures 7C1 and 7C3). When IUE was limited to the lateral region, domains located much more dorsally (such as S1) were not affected (Figure 7C1). In hemispheres that were only dorsomedially electroporated, S1 labeling with Rorb probe (Figure 7C4) or anti-Cux1 (Figure S6A) shifted dorsally. In addition, wider IUE involving both the dorsal

Cell Reports 29, 1555–1567, November 5, 2019 1561

Figure 6. Weakening of PP Stream Reduces Ventral Extension of CP by E14 (A) Experimental design. IUE with EF-lyn-GFP with NeuroD-DTA at E10 was followed by BrdU pulsechase at E12 and analysis at E14. (B) Anti-Ctip2 (magenta) and anti-GFP (green) staining. (C) Anti-BrdU (black) and anti-GFP (purple) staining. CP is orange highlighted. (D) Anti-Satb2 (blue) and anti-GFP (green) staining. (E) Comparison of the length of CP extended ventrally beyond the line drawn from the PS angle (as in B and C) between the DTA-IUE and the control (contralateral) groups. Each graph depicts the ratio, with the value for the control regarded as 1.0 (p = 0.0002 for anti-Ctip2 analysis [n = 8 sections from three embryos]; p = 0.0002 for anti-BrdU analysis [n = 8 sections from three embryos]). (F) Comparison of the thickness of CP extended ventrally beyond the line drawn from the PS angle (as in B) between the DTA-IUE and the control (contralateral) groups. Graph depicts the ratio, with the value for the control defined as 1.0 (p = 1.3 3 108, n = 15 regions in six sections from three embryos). (G) Comparison of the density of BrdU+ nuclei in CP extended ventrally beyond the line drawn from the PS angle (as in C) between the DTA-IUE and the control (contralateral) groups. Graph depicts the ratio, with the value for the control defined as 1.0 (p = 0.0006, n = 7 sections from three embryos). (H) Anti-Ctip2 (magenta) and anti-Satb2 (cyan) staining. (I) Graph depicting the proportions of Ctip2+ or Satb2+ nuclei in each bin (10 mm) of the ventralmost CP in a representative section.

and lateral regions, including the intermediate dorsolateral region, resulted in a dorsal shift of multiple Rorb+ regions (Figures 7C1–7C3). These results can be summarized as a rule (n = 6/6): regions that should have been formed downstream of the IUE position (i.e., ventrally from the VZ origin) shifted dorsally in the NeuroD-DTA group. This apparent rule also applied to CO-stained hemispheres (n = 3/3): compared with CO+ barrels in the contralateral (nonelectroporated) hemispheres, those in NeuroD-DTA-introduced hemispheres shifted dorsally (i.e., toward the TdTomato+ area) (Figures 7D, S6B, and S6C). The dorsal shift of somatosensory areas that we obtained by decreasing the number of E10 pallial-born PP neurons without killing CR neurons was similar, in part, to the results obtained by Barber et al. (2015), who disturbed the normal embryonic tri-territorial distribution of CR cells. Some barrels, as well as the total posteromedial barrel subfield (PMBSF) (Moreno-Juan et al., 2017), were a little larger on the contralateral side (Figures S6B and S6C), consistent with the involvement of SP neurons in barrel formation (Pin˜on et al., 2009; Hoerder-Suabedissen and Molna´r, 2015). In summary, neurons born in the pallium at E10 that contain presumptive SP neurons and comprise the PP ventrally stream until E13 to mechanically support the initiation and growth of CP, thereby contributing to the normal formation of postnatal somatotopic fields in the neocortex.

1562 Cell Reports 29, 1555–1567, November 5, 2019

DISCUSSION We performed IUE of the dorsal pallium at E10, followed by in vivo analyses with various survival/chasing time periods, as well as by live imaging in slice cultures. In vivo data revealed that most of the E10 dorsal pallium-derived neurons were histologically identified as SP neurons and that these cells were more ventrally distributed than their VZ origins. Slice cultures provided an explanation for this ventral shift: these presumptive SP neurons streamed ventrally, with an initial (E11–E12) locomotion-like mode of migration and the subsequent (
E13) somal translocation on the basis of their heterogeneous morphologies, including the corticofugal axon (Figure S7). Our E10 dorsal pallium-directed IUE also labeled ‘‘lot’’ neurons, which ventrally migrate to the LOT area (Tomioka et al., 2000; Hirata et al., 2002; Kawasaki et al., 2006). However, IUE labeling of lot1 cells was only partial, consistent with the idea that most lot cells come from the lateral thalamic eminence (RuizReig et al., 2017). This E10-IUE technique, when applied slightly laterally (near the PSP boundary), seemed to also label non-SP cells, which migrate ventrally to the olfactory cortex, amygdala, striatum, and basal forebrain (Hamasaki et al., 2001; Remedios et al., 2007; Garcı´a-Moreno et al., 2008; Cocas et al., 2009; Pombero et al., 2011). Together with CR cells from the hem and septum (Takiguchi-Hayashi et al., 2004; Bielle et al., 2005; Borrell and Marı´n, 2006; Yoshida et al., 2006; Barber et al., 2015) and

Figure 7. Early Embryonic Depletion of PP Streams Resulted in Dorsal Shifts of the Postnatal Neocortical Maps (A) Experimental design. Ai14 mice were electroporated at E10 with EF-cre and CAG-GFP or NeuroD-DTA, followed by in situ hybridization for Rorb and cytochrome oxidase stain at P8. (B) Left-right comparison of Rorb expression between the CAG-GFP-IUE side (magenta) and the contralateral/non-IUE side (green), showing almost identical/symmetrical patterns, regardless of the position of IUE visualized with TdTomato. Rorb and TdTomato were detected in adjacent sections. hc, hippocampus. lv, lateral ventricle. According to Barber et al. (2015), Au1, primary auditory cortex; AuD, auditory secondary cortex dorsal; S1, primary somatosensory cortex; S1/PtP, primary sensory/ parietal posterior association cortex posterior rostral and dorsal; S2, secondary somatosensory cortex. (C) Left-right comparison of Rorb expression between the NeuroD-DTA-IUE side (magenta) and the contralateral/non-IUE side (green), showing dorsal shifts (arrow) of Rorb+ domains that were to be formed downstream of the origin of the ablated PP neurons (i.e., ventral flow), faithfully reflecting the position of IUE visualized with TdTomato. Rorb and TdTomato were detected in adjacent sections. (D) Comparison of cytochrome oxidase staining between the NeuroD-DTA and contralateral sides.

some SP cells from the RMTW (Pedraza et al., 2014; Garcı´aMoreno et al., 2018), which are both thought to migrate into the dorsal pallium, these E10 IUE-labeled neurons ventrally move in or from the dorsal pallium and stream PP ventrally (Figure S7), thereby disproportionally (dorsal < ventral) thickening it (Figure 1E). Possible Mechanisms for the Ventral PP Streaming As shown by experiments with dominant-negative forms, Rac1 and N-cadherin seem to be important for the motility of PP neurons (Figure S2F), similar to the radial migration of glutamatergic neurons and ventral-to-dorsal migration of GABAergic interneurons (Kawauchi et al., 2003, 2010; Luccardini et al., 2013). One candidate that could explain the dorsal-to-ventral directionality of the PP stream is Netrin-1. We detected a dorsal-to-ventral gradient of anti-Netrin-1 immunoreactivity in the E11 cerebral wall that increases from the pallium to the striatum (K.S., unpublished data). Netrin-1 is implicated in the ventral migration of lot cells from the dorsal pallium (Kawasaki et al., 2006) and is also involved in the formation of corticofugal axons (Me´tin et al., 1997). PP neurons, including nascent SP neurons, express DCC (Kawasaki et al., 2006). Although it is possible that some of the dorsal pallium-derived SP neurons do not actively migrate

ventrally at all, such cells could be passively displaced. The live-observed ventral locomotion of E10 IUE-labeled neurons in E12 slices was not constant and instead consisted of fast (>1 mm/min) and slow (<10 mm/h) phases (Figure 3C), suggesting that the slow phase reflected a passive translocation through interactions between migrating PP neurons in a manner that is shared by several types of collective cell migration (Bazellie`res et al., 2015; Vassilev et al., 2017). Resting-like PP cells may be towed (at their front) or pushed (at their rear) by actively (fast) migrating PP cells, possibly involving N-cadherin. Regarding the axon-mediated somal translocation (
E13), two mechanisms can be considered. First, nuclear migration into the axon (Figure 4E) could be regulated by intracellular machinery, as implicated in the locomoting neurons (reviewed in Kawauchi, 2015). Second, our mechanical assessments on physiological cerebral wall slices (observing their warping coupled with shortening of the E10 IUE–labeled corticofugal axons) and axon-cut slices (loss of slice warping) (Figures 4F– 4I) suggest that ventral-ward pulling by the axons under tension may also be involved. Axonal tension can be generated by (1) traction by the growth cone, as shown in dissociated neurons (Lamoureux et al., 1989); (2) towing by migration of target cells, as shown in the zebrafish lateral line nerves (Gilmour et al., 2004); and (3) growth of a tissue across which the axon of interest runs (Bray, 1984; Pfister et al., 2004). The third pattern of tension generation (e.g., passive extension of axons caused by a rapid increase of tissue volume [i.e., cells] along the axonal route)

Cell Reports 29, 1555–1567, November 5, 2019 1563

can be expected to apply to the earliest corticofugal (SP-derived) axons due to massive supply of the ventral-to-dorsal migratory neurons into the PSP boundary and the lateral pallial region around E13 (de Carlos et al., 1996; Anderson et al., 1997; Tamamaki et al., 1997; Teissier et al., 2010). PP Neurons Play Frontier-Advancing and Pre-patterning Roles in the Early Embryonic Pallium through Give-andTake of Mechanical Stresses We used the same (E10 dorsal pallium-directed) IUE technique to reduce the PP stream. Our results suggest that in addition to their previously known roles in layer formation and the connection between the cortex and thalamus (reviewed in Allendoerfer and Shatz, 1994; Hoerder-Suabedissen and Molna´r, 2015), PP neurons promote, through ventral streaming via tangential locomotion (E11–E12) and axon-based mechanisms (E13), the ventral extension of CP (E14), thereby playing a priming physical role in postnatal neocortical arealization (Figures 1C and S7). At this point, we cannot determine whether either of the two streaming patterns (locomotion versus axon-mediated), and if so which of the two, more strongly contributes to the deviation of RFs and the extension of CP. A possible approach to dissect this issue would be to use animal models lacking the earliest corticofugal axons. One candidate for such a model would be mice that conditionally lack Celsr3 (under Foxg1-cre or Dlx5/6-cre) in the route of corticothalamic axons (Zhou et al., 2008). In the Celse3/Dlx mouse, postnatal neocortices exhibit tangential shrinkage (Zhou et al., 2010), and it would be interesting to assess CP (at E14) and RFs or warping of cerebral wall slices (at E13) in this mouse. It remains unclear how the preexisting PP stream helps the ventral growth of CP by E14, but the oblique entrance of CP-initiating neurons (Figure S5E) may underlie this phenomenon; this could be attributed to the obliqueness of RFs, as well as the possible ventral-ward dragging of the CP-initiating neurons by the PP stream. Recent studies explored the molecular mechanisms underlying neocortical arealization. Cell-intrinsically, Emx2 and Pax6 (Bishop et al., 2000), which are transcriptional regulation of the enhancers active in protodomains (Pattabiraman et al., 2014), and Pbx (Golonzhka et al., 2015) are important, whereas cell-extrinsically, FGF8 (Fukuchi-Shimogori and Grove, 2001; Garel et al., 2003) and FGF17 (Cholfin and Rubenstein, 2007) play essential roles. Barber et al. (2015) provided a new viewpoint focusing on cell migration, showing that appropriate and balanced tangential migration of CR cells from three different origins (i.e., the hem, septum, and PS angle) to cooperatively cover the entire pallial surface by E12 underlies the normal regionalization of postnatal neocortex. It remained unclear, however, how CR cells contribute to this early embryonic ‘‘pre-patterning’’ role in terms of postnatal arealization. Our discovery of ventral PP streaming and its contribution to CP formation and postnatal arealization supports the idea that CR cells, and perhaps also lot cells (Tomioka et al., 2000; Hirata et al., 2002), are the first flow generators in the developing pallium, and their movements influence the overall physical behaviors of PP neurons, affecting the initiation and formation of CP. From E11 to E12, the basal/outer endfeet of RFs are ventrally displaced along the basal lamina, deflecting the most distal portion of RFs (%30 mm from the surface) ventrally. This could simply occur passively, as in the endfeet of chicken retinal neuro-

1564 Cell Reports 29, 1555–1567, November 5, 2019

epithelial cells co-cultured with tangentially migrating cells (Halfter et al., 1988), but may also involve active crawling of RFs on the basal lamina, as suggested in the zebrafish retina (Sidhaye and Norden, 2017) and the gut villus epithelium (Krndija et al., 2019). In either case, pushing forces generated by the ventralward flow of the somata of PP neurons (on the basis of traction at their leading processes) seem to be received by RGCs. The neocortex and the striatum are in a dorsal-ventral relationship during the early embryonic primordial period and in a superficial-deep relationship in the postnatal/adult mammalian cranium. A ventral spreading of the neocortex to externally or superficially cover the striatum (to be worn as a ‘‘pallium’’ [vestment] by the striatum) is coupled with an inward growth of the striatum to narrow the lateral ventricle. Together, these effects promote space efficiency in the fetal cranium, whose growth is ultimately constrained by the size of the birth canal. Recent studies revealed that embryonic brains that develop under space limitations are sensitive to the physical conditions faced by their cells during development (Okamoto et al., 2013) and that developing brains use physical or mechanical factors that emerge as a function of the morphology, three-dimensional (3D) assembly pattern, and behavior of brain-forming cells (Koser et al., 2016; Karzbrun et al., 2018; Long et al., 2018; Shinoda et al., 2018; Watanabe et al., 2018; reviewed in Franze, 2013; Llinares-Benadero and Borrell, 2019). In this study, we identified another way in which cells use an externally provided force to fulfill their developmental roles. The asymmetric (ventral-ward) deflection of RFs, which forms the basis for the protomap mechanism underlying the establishment of functional neocortical maps (Rakic, 1988), depends on the ventral streaming of PP neurons (including future SP neurons) born early in the pallium (Figures 1C and S7). STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d

d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS METHOD DETAILS B In utero electroporation B Plasmids B DiI labeling B Slice culture and live imaging B Slice bending assay B Beads traction assay B Physical simulations B Immunohistochemistry B In situ hybridization B Scanning electron microscopy QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. celrep.2019.09.075.

ACKNOWLEDGMENTS

Bray, D. (1984). Axonal growth in response to experimentally applied mechanical tension. Dev. Biol. 102, 379–389.

We thank T. Shimogori for instructing us in IUE at E10 and providing comments on the manuscript; T. Kawauchi, R.L. Huganir, F. Matsuzaki, K. Kaibuchi, and T. Sapir for plasmids; M. Yamamoto and Y. Tomooka for antibodies; T. Hirata, T. Kawasaki, and M. Ogawa for antibodies and suggestions; T. Fujimori and T. Nagasawa for mice; M. Masaoka, Y. Enomoto, T. Sato, T. Shimamura, and Y. Muto for excellent technical assistance; and members of the Miyata lab for valuable discussions. This work was supported by MEXT Grant-in-Aid for Scientific Research on Innovative Areas (‘‘Cross-Talk between Moving Cells and Microenvironment as a Basis of Emerging Order’’) 22111006 (T.M.); Japan Society for the Promotion of Science (JSPS) Grant-in-Aid for Scientific Research (A) 16H02457 (T.M.); and JSPS Grant-in-Aid (C) 17K10176 (K.S.).

Cholfin, J.A., and Rubenstein, J.L. (2007). Patterning of frontal cortex subdivisions by Fgf17. Proc. Natl. Acad. Sci. U S A 104, 7652–7657.

AUTHOR CONTRIBUTIONS K.S. and T.M. designed the study and acquired and analyzed the data. K.S., M.O., and N.N. performed most of the experiments. DTA-based experiments were performed by Y.W., postnatal analyses by Y.N., mechanical assays by A.N., and live imaging by T.S. and A.S. K.S. and T.M. wrote the manuscript, with input from the other authors. DECLARATION OF INTERESTS The authors declare no competing financial interests. Received: April 16, 2019 Revised: July 11, 2019 Accepted: September 25, 2019 Published: November 5, 2019 REFERENCES Abe, T., Kiyonari, H., Shioi, G., Inoue, K., Nakao, K., Aizawa, S., and Fujimori, T. (2011). Establishment of conditional reporter mouse lines at ROSA26 locus for live cell imaging. Genesis 49, 579–590. Allendoerfer, K.L., and Shatz, C.J. (1994). The subplate, a transient neocortical structure: its role in the development of connections between thalamus and cortex. Annu. Rev. Neurosci. 17, 185–218. Anderson, S.A., Eisenstat, D.D., Shi, L., and Rubenstein, J.L. (1997). Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes. Science 278, 474–476. Auladell, C., Pe´rez-Sust, P., Supe`r, H., and Soriano, E. (2000). The early development of thalamocortical and corticothalamic projections in the mouse. Anat. Embryol. (Berl.) 201, 169–179. Barber, M., and Pierani, A. (2016). Tangential migration of glutamatergic neurons and cortical patterning during development: lessons from Cajal-Retzius cells. Dev. Neurobiol. 76, 847–881. Barber, M., Arai, Y., Morishita, Y., Vigier, L., Causeret, F., Borello, U., Ledonne, F., Coppola, E., Contremoulins, V., Pfrieger, F.W., et al. (2015). Migration speed of Cajal-Retzius cells modulated by vesicular trafficking controls the size of higher-order cortical areas. Curr. Biol. 25, 2466–2478. Bazellie`res, E., Conte, V., Elosegui-Artola, A., Serra-Picamal, X., Bintanel-Morcillo, M., Roca-Cusachs, P., Mun˜oz, J.J., Sales-Pardo, M., Guimera`, R., and Trepat, X. (2015). Control of cell-cell forces and collective cell dynamics by the intercellular adhesome. Nat. Cell Biol. 17, 409–420. ^me, N., Vigneau, S., Sigrist, M., Arber, S., Bielle, F., Griveau, A., Narboux-Ne Wassef, M., and Pierani, A. (2005). Multiple origins of Cajal-Retzius cells at the borders of the developing pallium. Nat. Neurosci. 8, 1002–1012. Bishop, K.M., Goudreau, G., and O’Leary, D.D. (2000). Regulation of area identity in the mammalian neocortex by Emx2 and Pax6. Science 288, 344–349. Borrell, V., and Marı´n, O. (2006). Meninges control tangential migration of hemderived Cajal-Retzius cells via CXCL12/CXCR4 signaling. Nat. Neurosci. 9, 1284–1293.

Chun, J.J.M., and Shatz, C.J. (1989). The earliest-generated neurons of the cat cerebral cortex: characterization by MAP2 and neurotransmitter immunohistochemistry during fetal life. J. Neurosci. 9, 1648–1667. Cocas, L.A., Miyoshi, G., Carney, R.S.E., Sousa, V.H., Hirata, T., Jones, K.R., Fishell, G., Huntsman, M.M., and Corbin, J.G. (2009). Emx1-lineage progenitors differentially contribute to neural diversity in the striatum and amygdala. J. Neurosci. 29, 15933–15946. Crandall, J.E., Jacobson, M., and Kosik, K.S. (1986). Ontogenesis of microtubule-associated protein 2 (MAP2) in embryonic mouse cortex. Brain Res. 393, 127–133. Davis, J.A. (2013). Mechanical and mathematical models of morphogenesis. Mechanism of Morphogenesis (Academic Press, Elsevier), pp. 347–363. De Carlos, J.A., and O’Leary, D.D.M. (1992). Growth and targeting of subplate axons and establishment of major cortical pathways. J. Neurosci. 12, 1194– 1211. de Carlos, J.A., Lo´pez-Mascaraque, L., and Valverde, F. (1996). Dynamics of cell migration from the lateral ganglionic eminence in the rat. J. Neurosci. 16, 6146–6156. de Frutos, C.A., Bouvier, G., Arai, Y., Thion, M.S., Lokmane, L., Keita, M., Garcia-Dominguez, M., Charnay, P., Hirata, T., Riethmacher, D., et al. (2016). Reallocation of olfactory Cajal-Retzius cells shapes neocortex architecture. Neuron 92, 435–448. Erzurumlu, R.S., and Jhaveri, S. (1992). Emergence of connectivity in the embryonic rat parietal cortex. Cereb. Cortex 2, 336–352. Espinosa, A., Gil-Sanz, C., Yanagawa, Y., and Faire´n, A. (2009). Two separate subtypes of early non-subplate projection neurons in the developing cerebral cortex of rodents. Front. Neuroanat. 3, 27. Franze, K. (2013). The mechanical control of nervous system development. Development 140, 3069–3077. Fukuchi-Shimogori, T., and Grove, E.A. (2001). Neocortex patterning by the secreted signaling molecule FGF8. Science 294, 1071–1074. Gao, P., Postiglione, M.P., Krieger, T.G., Hernandez, L., Wang, C., Han, Z., Streicher, C., Papusheva, E., Insolera, R., Chugh, K., et al. (2014). Deterministic progenitor behavior and unitary production of neurons in the neocortex. Cell 159, 775–788. Garcı´a-Moreno, F., Lo´pez-Mascaraque, L., and de Carlos, J.A. (2008). Early telencephalic migration topographically converging in the olfactory cortex. Cereb. Cortex 18, 1239–1252. Garcı´a-Moreno, F., Anderton, E., Jankowska, M., Begbie, J., Encinas, J.M., Irimia, M., and Molna´r, Z. (2018). Absence of tangentially migrating glutamatergic neurons in the developing avian brain. Cell Rep. 22, 96–109. Garel, S., Huffman, K.J., and Rubenstein, J.L. (2003). Molecular regionalization of the neocortex is disrupted in Fgf8 hypomorphic mutants. Development 130, 1903–1914. Ghosh, A., Antonini, A., McConnell, S.K., and Shatz, C.J. (1990). Requirement for subplate neurons in the formation of thalamocortical connections. Nature 347, 179–181. €sslein-Volhard, C. (2004). TowGilmour, D., Knaut, H., Maischein, H.M., and Nu ing of sensory axons by their migrating target cells in vivo. Nat. Neurosci. 7, 491–492. Golonzhka, O., Nord, A., Tang, P.L.F., Lindtner, S., Ypsilanti, A.R., Ferretti, E., Visel, A., Selleri, L., and Rubenstein, J.L.R. (2015). Pbx regulates patterning of the cerebral cortex in progenitors and postmitotic neurons. Neuron 88, 1192–1207. Halfter, W., Diamantis, I., and Monard, D. (1988). Migratory behavior of cells on embryonic retina basal lamina. Dev. Biol. 130, 259–275.

Cell Reports 29, 1555–1567, November 5, 2019 1565

Hamasaki, T., Goto, S., Nishikawa, S., and Ushio, Y. (2001). Early-generated preplate neurons in the developing telencephalon: inward migration into the developing striatum. Cereb. Cortex 11, 474–484.

Matsuda, M., Katoh-Semba, R., Kitani, H., and Tomooka, Y. (1996). A possible role of the nestin protein in the developing central nervous system in rat embryos. Brain Res. 723, 177–189.

Hicks, S.P., and D’Amato, C.J. (1968). Cell migrations to the isocortex in the rat. Anat. Rec. 160, 619–634.

McConnell, S.K., Ghosh, A., and Shatz, C.J. (1989). Subplate neurons pioneer the first axon pathway from the cerebral cortex. Science 245, 978–982.

Hirata, T., Nomura, T., Takagi, Y., Sato, Y., Tomioka, N., Fujisawa, H., and Osumi, N. (2002). Mosaic development of the olfactory cortex with Pax6dependent and -independent components. Brain Res. Dev. Brain Res. 136, 17–26.

Me´tin, C., Dele´glise, D., Serafini, T., Kennedy, T.E., and Tessier-Lavigne, M. (1997). A role for netrin-1 in the guidance of cortical efferents. Development 124, 5063–5074.

Hoerder-Suabedissen, A., and Molna´r, Z. (2013). Molecular diversity of earlyborn subplate neurons. Cereb. Cortex 23, 1473–1483. Hoerder-Suabedissen, A., and Molna´r, Z. (2015). Development, evolution and pathology of neocortical subplate neurons. Nat. Rev. Neurosci. 16, 133–146. Karzbrun, E., Kshirsagar, A., Cohen, S.R., Hanna, J.H., and Reiner, O. (2018). Human brain organoids on a chip reveal the physics of folding. Nat. Phys. 14, 515–522. Kawasaki, T., Ito, K., and Hirata, T. (2006). Netrin 1 regulates ventral tangential migration of guidepost neurons in the lateral olfactory tract. Development 133, 845–853. Kawauchi, T. (2015). Cellullar insights into cerebral cortical development: focusing on the locomotion mode of neuronal migration. Front. Cell. Neurosci. 9, 394. Kawauchi, T., Chihama, K., Nabeshima, Y., and Hoshino, M. (2003). The in vivo roles of STEF/Tiam1, Rac1 and JNK in cortical neuronal migration. EMBO J. 22, 4190–4201. Kawauchi, T., Sekine, K., Shikanai, M., Chihama, K., Tomita, K., Kubo, K., Nakajima, K., Nabeshima, Y., and Hoshino, M. (2010). Rab GTPases-dependent endocytic pathways regulate neuronal migration and maturation through N-cadherin trafficking. Neuron 67, 588–602. Kim, G.J., Shatz, C.J., and McConnell, S.K. (1991). Morphology of pioneer and follower growth cones in the developing cerebral cortex. J. Neurobiol. 22, 629–642. Konno, D., Shioi, G., Shitamukai, A., Mori, A., Kiyonari, H., Miyata, T., and Matsuzaki, F. (2008). Neuroepithelial progenitors undergo LGN-dependent planar divisions to maintain self-renewability during mammalian neurogenesis. Nat. Cell Biol. 10, 93–101. Koser, D.E., Thompson, A.J., Foster, S.K., Dwivedy, A., Pillai, E.K., Sheridan, G.K., Svoboda, H., Viana, M., Costa, L.D., Guck, J., et al. (2016). Mechanosensing is critical for axon growth in the developing brain. Nat. Neurosci. 19, 1592–1598.

Minegishi, T., Uesugi, Y., Kaneko, N., Yoshida, W., Sawamoto, K., and Inagaki, N. (2018). Shootin1b mediates a mechanical clutch to produce force for neuronal migration. Cell Rep. 25, 624–639.e6. Misson, J.-P., Edwards, M.A., Yamamoto, M., and Caviness, V.S., Jr. (1988). Identification of radial glial cells within the developing murine central nervous system: studies based upon a new immunohistochemical marker. Brain Res. Dev. Brain Res. 44, 95–108. Misson, J.-P., Austin, C.P., Takahashi, T., Cepko, C.L., and Caviness, V.S., Jr. (1991). The alignment of migrating neural cells in relation to the murine neopallial radial glial fiber system. Cereb. Cortex 1, 221–229. Miyata, T., Kawaguchi, A., Okano, H., and Ogawa, M. (2001). Asymmetric inheritance of radial glial fibers by cortical neurons. Neuron 31, 727–741. Molna´r, Z., Adams, R., Goffinet, A.M., and Blakemore, C. (1998). The role of the first postmitotic cortical cells in the development of thalamocortical innervation in the reeler mouse. J. Neurosci. 18, 5746–5765. Moreno-Juan, V., Filipchuk, A., Anto´n-Bolan˜os, N., Mezzera, C., Gezelius, H., Andre´s, B., Rodrı´guez-Malmierca, L., Susı´n, R., Schaad, O., Iwasato, T., et al. (2017). Prenatal thalamic waves regulate cortical area size prior to sensory processing. Nat. Commun. 8, 14172. Nuriya, M., and Huganir, R.L. (2006). Regulation of AMPA receptor trafficking by N-cadherin. J. Neurochem. 97, 652–661. O’Rourke, N.A., Dailey, M.E., Smith, S.J., and McConnell, S.K. (1992). Diverse migratory pathways in the developing cerebral cortex. Science 258, 299–302. Ogawa, M., Miyata, T., Nakajima, K., Yagyu, K., Seike, M., Ikenaka, K., Yamamoto, H., and Mikoshiba, K. (1995). The reeler gene-associated antigen on Cajal-Retzius neurons is a crucial molecule for laminar organization of cortical neurons. Neuron 14, 899–912. Ohtaka-Maruyama, C., Okamoto, M., Endo, K., Oshima, M., Kaneko, N., Yura, K., Okado, H., Miyata, T., and Maeda, N. (2018). Synaptic transmission from subplate neurons controls radial migration of neocortical neurons. Science 360, 313–317.

Krndija, D., El Marjou, F., Guirao, B., Richon, S., Leroy, O., Bellaiche, Y., Hannezo, E., and Matic Vignjevic, D. (2019). Active cell migration is critical for steady-state epithelial turnover in the gut. Science 365, 705–710.

Okamoto, M., Namba, T., Shinoda, T., Kondo, T., Watanabe, T., Inoue, Y., Takeuchi, K., Enomoto, Y., Ota, K., Oda, K., et al. (2013). TAG-1-assisted progenitor elongation streamlines nuclear migration to optimize subapical crowding. Nat. Neurosci. 16, 1556–1566.

Kuroda, S., Fukata, M., Nakagawa, M., Fujii, K., Nakamura, T., Ookubo, T., Izawa, I., Nagase, T., Nomura, N., Tani, H., et al. (1998). Role of IQGAP1, a target of the small GTPases Cdc42 and Rac1, in regulation of E-cadherinmediated cell-cell adhesion. Science 281, 832–835.

Pattabiraman, K., Golonzhka, O., Lindtner, S., Nord, A.S., Taher, L., Hoch, R., Silberberg, S.N., Zhang, D., Chen, B., Zeng, H., et al. (2014). Transcriptional regulation of enhancers active in protodomains of the developing cerebral cortex. Neuron 82, 989–1003.

Lamoureux, P., Buxbaum, R.E., and Heidemann, S.R. (1989). Direct evidence that growth cones pull. Nature 340, 159–162.

Pedraza, M., Hoerder-Suabedissen, A., Albert-Maestro, M.A., Molna´r, Z., and De Carlos, J.A. (2014). Extracortical origin of some murine subplate cell populations. Proc. Natl. Acad. Sci. U S A 111, 8613–8618.

Llinares-Benadero, C., and Borrell, V. (2019). Deconstructing cortical folding: genetic, cellular and mechanical determinants. Nat. Rev. Neurosci. 20, 161–176.

Pfister, B.J., Iwata, A., Meaney, D.F., and Smith, D.H. (2004). Extreme stretch growth of integrated axons. J. Neurosci. 24, 7978–7983.

Long, K.R., Newland, B., Florio, M., Kalebic, N., Langen, B., Kolterer, A., Wimberger, P., and Huttner, W.B. (2018). Extracellular matrix components HAPLN1, Lumican and collagen I cause hyaluronic acid-dependent folding of the developing human brain. Neuron 99, 702–719.e6.

Pin˜on, M.C., Jethwa, A., Jacobs, E., Campagnoni, A., and Molna´r, Z. (2009). Dynamic integration of subplate neurons into the cortical barrel field circuitry during postnatal development in the Golli-tau-eGFP (GTE) mouse. J. Physiol. 587, 1903–1915.

Luccardini, C., Hennekinne, L., Viou, L., Yanagida, M., Murakami, F., Kessaris, N., Ma, X., Adelstein, R.S., Me`ge, R.M., and Me´tin, C. (2013). N-cadherin sustains motility and polarity of future cortical interneurons during tangential migration. J. Neurosci. 33, 18149–18160.

Pombero, A., Bueno, C., Saglietti, L., Rodenas, M., Guimera, J., Bulfone, A., and Martinez, S. (2011). Pallial origin of basal forebrain cholinergic neurons in the nucleus basalis of Meynert and horizontal limb of the diagonal band nucleus. Development 138, 4315–4326.

Marin-Padilla, M. (1971). Early prenatal ontogenesis of the cerebral cprtex (neocortex) of the cat (Felis Domestica). A Golgi study. Z. Anat. Entwickl. Gesch. 134, 117–145.

Puelles, L., Kuwana, E., Puelles, E., Bulfone, A., Shimamura, K., Keleher, J., Smiga, S., and Rubenstein, J.L. (2000). Pallial and subpallial derivatives in the embryonic chick and mouse telencephalon, traced by the expression of

1566 Cell Reports 29, 1555–1567, November 5, 2019

the genes Dlx-2, Emx-1, Nkx-2.1, Pax-6, and Tbr-1. J. Comp. Neurol. 424, 409–438. Rajagopalan, J., Tofangchi, A., and A Saif, M.T. (2010). Drosophila neurons actively regulate axonal tension in vivo. Biophys. J. 99, 3208–3215. Rakic, P. (1972). Mode of cell migration to the superficial layers of fetal monkey neocortex. J. Comp. Neurol. 145, 61–83. Rakic, P. (1988). Specification of cerebral cortical areas. Science 241, 170–176. Remedios, R., Huilgol, D., Saha, B., Hari, P., Bhatnagar, L., Kowalczyk, T., Hevner, R.F., Suda, Y., Aizawa, S., Ohshima, T., et al. (2007). A stream of cells migrating from the caudal telencephalon reveals a link between the amygdala and neocortex. Nat. Neurosci. 10, 1141–1150. Rickmann, M., Chronwall, B.M., and Wolff, J.R. (1977). On the development of non-pyramidal neurons and axons outside the cortical plate: the early marginal zone as a pallial anlage. Anat. Embryol. (Berl.) 151, 285–307. Ruiz-Reig, N., Andre´s, B., Huilgol, D., Grove, E.A., Tissir, F., Tole, S., Theil, T., Herrera, E., and Faire´n, A. (2017). Lateral thalamic eminence: a novel origin for mGluR1/lot cells. Cereb. Cortex 27, 2841–2856. Saito, K., Kawaguchi, A., Kashiwagi, S., Yasugi, S., Ogawa, M., and Miyata, T. (2003). Morphological asymmetry in dividing retinal progenitor cells. Dev. Growth Differ. 45, 219–229. Sakakibara, A., Sato, T., Ando, R., Noguchi, N., Masaoka, M., and Miyata, T. (2014). Dynamics of centrosome translocation and microtubule organization in neocortical neurons during distinct modes of polarization. Cereb. Cortex 24, 1301–1310. Sapir, T., Sapoznik, S., Levy, T., Finkelshtein, D., Shmueli, A., Timm, T., Mandelkow, E.M., and Reiner, O. (2008). Accurate balance of the polarity kinase MARK2/Par-1 is required for proper cortical neuronal migration. J. Neurosci. 28, 5710–5720. Shimogori, T., and Ogawa, M. (2008). Gene application with in utero electroporation in mouse embryonic brain. Dev. Growth Differ. 50, 499–506. Shinoda, T., Nagasaka, A., Inoue, Y., Higuchi, R., Minami, Y., Kato, K., Suzuki, M., Kondo, T., Kawaue, T., Saito, K., et al. (2018). Elasticity-based boosting of neuroepithelial nucleokinesis via indirect energy transfer from mother to daughter. PLoS Biol. 16, e2004426.

Tabata, H., and Nakajima, K. (2003). Multipolar migration: the third mode of radial neuronal migration in the developing cerebral cortex. J. Neurosci. 23, 9996–10001. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., et al. (1998). The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393, 591–594. Takiguchi-Hayashi, K., Sekiguchi, M., Ashigaki, S., Takamatsu, M., Hasegawa, H., Suzuki-Migishima, R., Yokoyama, M., Nakanishi, S., and Tanabe, Y. (2004). Generation of reelin-positive marginal zone cells from the caudomedial wall of telencephalic vesicles. J. Neurosci. 24, 2286–2295. Tamamaki, N., Fujimori, K.E., and Takauji, R. (1997). Origin and route of tangentially migrating neurons in the developing neocortical intermediate zone. J. Neurosci. 17, 8313–8323. Tan, S.-S., Faulkner-Jones, B., Breen, S.J., Walsh, M., Bertram, J.F., and Reese, B.E. (1995). Cell dispersion patterns in different cortical regions studied with an X-inactivated transgenic marker. Development 121, 1029–1039. Teissier, A., Griveau, A., Vigier, L., Piolot, T., Borello, U., and Pierani, A. (2010). A novel transient glutamatergic population migrating from the pallial-subpallial boundary contributes to neocortical development. J. Neurosci. 30, 10563– 10574. Tomioka, N., Osumi, N., Sato, Y., Inoue, T., Nakamura, S., Fujisawa, H., and Hirata, T. (2000). Neocortical origin and tangential migration of guidepost neurons in the lateral olfactory tract. J. Neurosci. 20, 5802–5812. Umeshima, H., Nomura, K.I., Yoshikawa, S., Ho¨rning, M., Tanaka, M., Sakuma, S., Arai, F., Kaneko, M., and Kengaku, M. (2019). Local traction force in the proximal leading process triggers nuclear translocation during neuronal migration. Neurosci. Res. 142, 38–48. Valverde, F., De Carlos, J.A., and Lo´pez-Mascaraque, L. (1995). Time of origin and early fate of preplate cells in the cerebral cortex of the rat. Cereb. Cortex 5, 483–493. Vassilev, V., Platek, A., Hiver, S., Enomoto, H., and Takeichi, M. (2017). Catenins steer cell migration via stabilization of front-rear polarity. Dev. Cell 43, 463–479.e5. Watanabe, Y., Kawaue, T., and Miyata, T. (2018). Differentiating cells mechanically limit the interkinetic nuclear migration of progenitor cells to secure apical cytogenesis. Development 145, dev162883.

Sidhaye, J., and Norden, C. (2017). Concerted action of neuroepithelial basal shrinkage and active epithelial migration ensures efficient optic cup morphogenesis. eLife 6, e22689.

Yoshida, M., Assimacopoulos, S., Jones, K.R., and Grove, E.A. (2006). Massive loss of Cajal-Retzius cells does not disrupt neocortical layer order. Development 133, 537–545.

Siechen, S., Yang, S., Chiba, A., and Saif, T. (2009). Mechanical tension contributes to clustering of neurotransmitter vesicles at presynaptic terminals. Proc. Natl. Acad. Sci. U S A 106, 12611–12616.

Zhou, L., Bar, I., Achouri, Y., Campbell, K., De Backer, O., Hebert, J.M., Jones, K., Kessaris, N., de Rouvroit, C.L., O’Leary, D., et al. (2008). Early forebrain wiring: genetic dissection using conditional Celsr3 mutant mice. Science 320, 946–949.

Smart, I.H.M., and Smart, M. (1977). The location of nuclei of different labelling intensities in autoradiographs of the anterior forebrain of postnatial mice injected with [3H]thymidine on the eleventh and twelfth days post-conception. J. Anat. 123, 515–525.

Zhou, L., Gall, D., Qu, Y., Prigogine, C., Cheron, G., Tissir, F., Schiffmann, S.N., and Goffinet, A.M. (2010). Maturation of ‘‘neocortex isole’’ in vivo in mice. J. Neurosci. 30, 7928–7939.

Cell Reports 29, 1555–1567, November 5, 2019 1567

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

mouse anti-Satb2

abcam

Cat# ab51502; RRID:AB_882455

rabbit anti-Tbr1

abcam

Cat# ab31940; RRID:AB_2200219

rabbit anti-Tbr2 (Eomes)

abcam

Cat# ab23345; RRID:AB_778267

rat anti-pH3

abcam

Cat# ab10543; RRID:AB_2295065

rat anti-Ctip2

abcam

Cat# ab18465; RRID:AB_2064130

rabbit-anti-GFP

MBL International Corporation

Cat# 598, RRID:AB_591819

chicken anti-GFP

Aves Labs

Cat# GFP-1020; RRID:AB_10000240

rat anti-GFP

Nacalai Tesque

Cat# 04404-84; RRID:AB_10013361

rabbit anti-Pax6

Covance

Cat# PRB-278P; RRID:AB_291612

mouse 9-4c

gift from Tatsumi Hirata (Hirata et al., 2002)

N/A

mouse mAb lot

gift from Tatsumi Hirata (Tomioka et al., 2000)

N/A

rabbit anti-Nestin

gift from Yasuhiro Tomooka (Matsuda et al., 1996)

N/A

mouse IgM RC2

gift from Miyuki Yamamoto (Misson et al., 1988)

N/A

rabbit anti-Laminin A

Sigma-Aldrich

Cat# L9393; RRID:AB_477163

mouse anti-b III-tubulin

Covance

Cat# MMS-435P; RRID:AB_2313773

goat anti-TAG-1

R&D

Cat# AF1714; RRID:AB_2245173

rat anti-L1

Millipore

Cat# MAB5272; RRID:AB_2133200

rat anti-BrdU

Novus

Cat# NB500169; RRID:AB_10002608

mouse anti-MAP2

Sigma-Aldrich

Cat# M1406; RRID:AB_477171

mouse anti-Calbindin

Sigma

Cat# c9848; RRID:AB_476894

Antibodies

rabbit anti-cleaved caspase3

Cell Signaling

Cat# 9661; RRID:AB_2341188

goat anti-Nurr1

R&D

Cat# AF2156; RRID:AB_2153894

mouse anti-Reelin(G10)

Calbiochem

Cat# 553731; RRID:AB_565117

rabbit anti-Cux1

Santa Cruz Biotechnology

Cat# sc13024; RRID:AB_2261231

5-Bromo-20 -depoxyuridine

Sigma-Aldrich

B5002

DMEM/F12

Sigma-Aldrich

D8437-500ML

horse serum

Biowest

S0900-500

fetal bovine serum

NICHIREI BIOSCIENCES Inc.

171012

N2

Thermo Fisher Scientific

17502048

Chemicals

recombinant EGF

Peprotech

AF-100-15

recombinant bFGF

GIBCO

PHG0368

Cellmatrix Type I -A (Collagen, Type I, 3 mg/mL, pH 3.0)

Nitta Gelatin Inc.

KP-2100

DiI C18(3)

Molecular Probes

D-282

Cytochrom C

Sigma-Aldrich

C3131

red fluorescent microbeads

Thermo Fisher Scientific

Fluoro-Max

5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt

Sigma-Aldrich

B0274-10TAB

Nitro Blue Tetrazolium tablet

Sigma-Aldrich

N5514-10TAB

Expression plasmid: pEF-LPL-Lyn-EGFP

Okamoto et al., 2013; Sakakibara et al., 2014

N/A

Expression plasmid: pBA-LPL-H2B-mRFP1

Okamoto et al., 2013; Sakakibara et al., 2014

N/A

Expression plasmid: pEF-Cre

Okamoto et al., 2013; Sakakibara et al., 2014

N/A

Recombinant DNA

(Continued on next page)

e1 Cell Reports 29, 1555–1567.e1–e5, November 5, 2019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Expression plasmid: pNeuroD-Cre

T. Sapir gift (Sapir et al., 2008)

N/A

Expression plasmid: pBA-LPL- GAP43N mStrawberry

This paper

N/A

Expression plasmid: pCAG-EGFP-3NLS

F. Matsuzaki gift (Konno et al., 2008)

N/A

Expression plasmid: pEF-LPL-Lyn-mCherry

Watanabe et al., 2018

N/A

Expression plasmid: pCAG-EGFP

Okamoto et al., 2013

N/A

Expression plasmid: pEF-Lyn-EGFP

Okamoto et al., 2013

N/A

Expression plasmid: pNeuroD-DTA

Watanabe et al., 2018

N/A

Expression plasmid: pEF-LPL-N17-Rac1

This paper

N/A

Expression plasmid: pEF-LPL-DN-N-Cadherin

This paper

N/A

Plasmid ISH template: MsFGF8

This paper

N/A

Plasmid ISH template: MsWnt3a

This paper

N/A

Plasmid ISH template: MsPax6

This paper

N/A

Plasmid ISH template: MsEmx1

This paper

N/A

ICR wild type

SLC

N/A

reeler mice

M. Ogawa gift; Jackson laboratory

https://www.jax.org/strain/000235

CXCR4 knock-out mice

T. Nagasawa gift (Tachibana et al., 1998)

N/A

R26-H2B-mCherry transgenic mice

T. Fujimori gift (Abe et al., 2011)

CDB0239K

Ai14 mice

Jackson Laboratory

https://www.jax.org/strain/007914

ImageJ

National Institute of Health

https://imagej.nih.gov/ij/

Move-tr/2D

Library Co., Ltd.

http://www.library-japan.com/pro_1.html

R package

Hadley Wickham

http://r-pkgs.had.co.nz

Experimental Models: Organisms/Strains

Software and Algorithms

LEAD CONTACT AND MATERIALS AVAILABILITY All unique/stable reagents generated in this study are available from the Lead Contact without restriction. Further information and request for resources and reagents should be directed to and will be fulfilled by Takaki Miyata ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Animal experiments were conducted according to the Japanese Act on Welfare and Management of Animals, Guidelines for Proper Conduct of Animal Experiments (published by Science Council of Japan), and the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions (published by the Ministry of Education, Culture, Sports, Science and Technology of Japan). All protocols for animal experiments were approved by the Animal Care and Use Committee of Nagoya University (No. 29006). R26-H2B-mCherry transgenic mice (accession number CDB0239K) (Abe et al., 2011) were provided by Toshihiko Fujimori (NIBB, Japan). Ai14 mice were purchased from Jackson Laboratory (007914). Timed-pregnant ICR mice were obtained from SLC (Hamamatsu, Japan). Reeler mice (gift from Dr. Masaharu Ogawa, RIKEN) and CXCR4 knock-out mice (Tachibana et al., 1998) (gift form Dr. Takashi Nagasawa, Osaka University) were maintained and used in Nagoya University. The day when the vaginal plug was detected was considered E0. Both male and female embryos were used, and very similar results were obtained. METHOD DETAILS In utero electroporation Our IUE at E10 was established based on Shimogori and Ogawa (2008), with some modifications. After anesthesia with sodium pentobarbital (50 mg per gram body weight, intraperitoneally), a pregnant mouse (embryonic day 10) was subjected to abdominal incision, and all of its uterine horns were carefully exposed onto phosphate-buffered saline (PBS)-moistened cotton gauze, which is placed around the wound. The uterus was kept moist with PBS all of the time. For visualization of embryos, a flexible fiber cable (Leica CLS 150x, Wetzlar, Germany) was held between the index and middle fingers and placed under the uterine horn. The tip of the

Cell Reports 29, 1555–1567.e1–e5, November 5, 2019 e2

fiber cable and the uterus were moistened with warm (37 C) PBS. The uterus was positioned between the optic fiber light and the thumb, and squeezed gently to push up the embryo closer to the uterine wall. When the embryos have been positioned, 1 ml of DNA (1 mg/ml) solution, mixed with the non-toxic dye fast green (SIGMA, Tokyo, Japan), was injected into the ventricle via a pulled glass capillary using an IM-31 injector (Narishige, Tokyo, Japan). Then, the head of the embryo in the uterus was placed between the discs of a forceps-type electrode (disc electrodes of 1 mm; CUY560P1, NEPA GENE, Chiba, Japan), and electric pulses (50 V) were administered four times, resulting in gene transfection into the cerebral wall. The uterine horn was then placed back in its original location. The abdominal muscle layer and the skin were sequentially sutured with 5-0 Nylon (Bear Medic Corporation, Tokyo, Japan). Animals were then kept warm until they recovered from anesthesia by placement of a heating pad under them (around 2 h). Plasmids For visualization of preplate neurons, E10 mice were electroporated with a mixture of pEF-LPL-Lyn-EGFP (0.5 mg/ml) and/or pBALPL-H2B-mRFP1 (0.5 mg/ml) and a Cre-recombinase expression plasmid, pEF-Cre (0.001 mg/ml for sporadic labeling; 0.1 mg/ml for massive/diffuse labeling) (Okamoto et al., 2013; Sakakibara et al., 2014) (Figures 3C, 3D, 3E, 4A, and S3A; Video S1B) or pNeuroD-Cre (Sapir et al., 2008) (Figures 2D, 2E, 3A, 3B, S2D–S2F, and S5B–S5D). Alternatively, a mixture of pBA-LPLGAP43N-mStrawberry (0.5 mg/ml) (constructed from pH2B-Strawberry [Addgene], Gap43 N-terminal membrane-targeted signal sequence, and pBA-LPL-H2B-mRFP) and pCAG-EGFP-3NLS (0.5 mg/ml) (Konno et al., 2008) (Figures 4C, S2B, S2C, S3G, and S3H) was used. In other experiments, pCAG-EGFP (0.5 mg/ml) (Figures 2A–2C and 7B), or pEF-Lyn-EGFP (0.5 mg/ml) was used (Figures 2D, 4H, 4I, S4A–S4G, and S5A–S5C). For IUE-mediated neuron ablation, E10 ICR mice were electroporated with pNeuroD-DTA (1 mg/ml) together with pEF-Lyn-EGFP (0.5 mg/ml), as previously described (Watanabe et al., 2018) (Figures 5B–5E, 6A–6I, and S4A– S4G). pNeuroD-DTA IUE was also performed on Ai14 mice with pEF-Cre (0.1 mg/ml) (Figures 7B–7D and S6A–S6C). pEF-LPL-N17Rac1 (1 mg/ml), constructed from pEF-BOS-N17-Rac1 (Kuroda et al., 1998) and pEF-LPL-Lyn-EGFP, and pEF-LPL-DN-N-Cadherin (1 mg/ml), constructed from pTa1-DN-N-Cadherin (Kawauchi et al., 2010; Nuriya and Huganir, 2006) and pEF-LPL-Lyn-EGFP, were used with NeuroD-Cre (1 mg/ml) (Figure S2F). DiI labeling We performed two different types of live labeling of cerebral walls with DiI. Initially, a stock solution of DiI was made by dissolving 1,1dioctadecyl-3,3,3,3-tetramethylindocarbocyanine perchlorate, DiI C18(3) (D-282; Molecular Probes) in 99.5% ethanol to obtain a concentration of 10 mg/ml. For retrograde labeling of PP neurons (Figures 4D and 4E), a 1:100 diluted DiI solution (with DMEM/ F12) was injected into coronal slices of E13 hemispheres using a Narishige injector (IM-31, Japan), and hemispheres were sliced and cultured as described below. For DiI labeling from the pial surface to visualize neurons and radial glial cells (Figures 5C–5E and S3F), a more diluted 1:1000 DiI solution was made with DMEM/F12 (Saito et al., 2003). The size of each crystal in this 1:1000 DiI solution was approximately
2 mm in diameter. Pallial walls were incubated in the 1:1000 DiI solution for 3 min at room temperature, and then gently washed in DMEM/F12 to remove excessive DiI. For radial fiber assessment (Figures 5 and S5A), DiI-labeled live hemispheres were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer and embedded in 2% agarose, then sectioned (200 mm) using a vibratome (microslicer DTK-3000, D.S.K., Kyoto, Japan). Slice culture and live imaging Cross-sectional (coronal) slices (250–300 mm thick) of cerebral walls were prepared as described previously (Miyata et al., 2001; Okamoto et al., 2013; Shinoda et al., 2018). Embryos were dissected in a Petri dish containing DMEM/F12, and hemispheres were removed and freed from meninges or cranial mesenchymal tissues. Using a disposable pipette (inner diameter 3 mm, Samco Scientific, USA), hemispheres were transferred with DMEM/F12 onto silicon rubber (5–10 mm thick, transparent) previously solidified in a Petri dish by mixing KE-103 and CAT-103 from Shin-Etsu Silicones (Niigata, Japan), and sliced manually using microknives. Silicone rubber plates are helpful for illumination/observation of hemispheres or slices in dark-field stereo-microscopy and for avoiding damages to microknives. Microknives were made from disposable scalpels (Feather, Tokyo, Japan) or purchased from Alcon (V-Lance Ophthalmic corneal/scleral knife, 20 Gauge). Using a 200 mL pipetman (Gilson) with a large orifice (1–2 mm) tip, slices were transferred with approximately 200 ml enriched medium, which is DMEM/F12 supplemented with 5% horse serum, 5% fetal bovine serum, N2 (1:100, Thermo Fisher Scientific), EGF (10 ng/ml, Peprotech), and bFGF (10 ng/ml, GIBCO), to a 35 mm glass-bottom (27 mm diameter) dish (IWAKI, Japan). Slices were mixed with approximately 200 mL of 2 3 type I collagen solution (1.5– 1.6 mg/ml in distilled water, 5 3 DMEM/F12 and a neutralizing buffer; Cellmatrix IA; Nitta Gelatin, Osaka, Japan), that had been prepared according to the manufacturer’s instructions and kept on ice until use. The gel (final concentration 0.7–0.8 mg/ml) was immediately spread on the dish base (glass-bottomed area) using a pipette tip. Using a tungsten needle, the ventricular and pial surfaces of the slices were arranged to be perpendicular to the dish base, and the gel was allowed to nearly solidify (approximately 5 min). The dish was placed in an incubator (37 C; 5% CO2, 40% O2) to allow for further gel solidification (5–10 min). Enriched medium (0.7–0.8 ml) was added to the gel and spread over the entire dish surface, including the rim of the dish. For basal en face imaging (Figure S3A), meninges-free cerebral walls were attached (basal bottom) on a polystyrene cell-culture dish (Corning) which was previously coated with type-I collagen gel (Nitta Gelatin) at a concentration of about 1 mg/ml. The attached cerebral walls were then further embedded in collagen gel (0.7–0.8 mg/ml) to ensure stability. Time-lapse confocal microscopy was performed on an inverted CV1000 spinning disc confocal system (Yokogawa, Japan) with a 40 3 objective lens (UPLFLN 40XD, (NA) 0.75, Olympus, Japan), a e3 Cell Reports 29, 1555–1567.e1–e5, November 5, 2019

BX51W1 microscope (Olympus) equipped with a CSU-X1 spinning disc confocal unit (Yokogawa) with a 40 3 objective lens (LUMPLFLN40XW, Olympus) or 100 3 objective lens (LUMPLFL100XW, Olympus) and an iXon+ EMCCD camera (Andor), in an on-stage culture chamber (Tokai Hit) filled with 55% N2, 40% O2, and 5% CO2. Averaged velocities of E10 IUE-labeled PP neurons (observed longer than 100 min) were obtained from 20 cells (averaged observation time 296 min) in 8 slices prepared at E11 (6 different experiments), 18 cells (averaged observation time 199 min) in 4 slices prepared at E12 (4 different experiments), and 25 cells (averaged observation time 1156 min) in 8 slices prepared at E13 (4 different experiments). For assessment of locomotion velocity in neurons subjected to IUE with dominant-negative Rac1 or N-cadherin, 25 control GFP-introduced cells (averaged observation time 716 min, from 3 experiments), 21 cells expressing dominant-negative Rac1 (averaged observation time 1048 min, from 2 experiments), and 26 cells expressing dominant-negative N-cadherin (averaged observation time 798 min, from 3 experiments) were monitored in slices prepared at late E12. Slice bending assay Coronal slices (250–300 mm thick) were manually prepared from E13 cerebral hemispheres (both pallial and striatal regions together), and then placed into a polystyrene suspension cell culture dish (Corning) containing DMEM/F12. Bending and/or warping (Figures 4H and 4I) was recorded using an Olympus IX71 (4 3 ) equipped with an on-stage culture chamber (Tokai Hit), temperature-controlled and filled with 5% CO2, and an Orca ER camera (Hamamatsu Photonics), as previously described (Okamoto et al., 2013; Shinoda et al., 2018). In some slices, transections were made (Figure 4I) at the route of corticofugal axons using a microknife (Alcon). Beads traction assay Explants (Figure S3B) or slices (Figure 3A) were embedded in very soft (0.2–0.3 mg/ml) collagen gel containing red fluorescent microbeads (Fluoro-Max [Thermo Fisher Scientific], 1 mm in diameter, 0.5% v/v). Physical simulations Based on the usefulness of physical (non-mathematical) models for simulating morphogenetic events during development (Davis, 2013), a simulation of physical events involving PP neurons (Figure 4G) was prepared using mechanically appropriate materials (e.g., a rubber string to mimic axons [Bray,1984; Lamoureux et al., 1989] and styrofoam blocks to model a cerebral wall). Immunohistochemistry Cross-sectional and whole-mount immunohistochemistry experiments were performed as described previously (Okamoto et al., 2013; Shinoda et al., 2018). Embryonic brains were fixed for 1 hr at 4 C with periodate–lysine–paraformaldehyde (PLP) fixative. Frozen sections (16 mm thick) were treated with the following primary antibodies: 9-4c (mouse, gift from Tatsumi Hirata, hybridoma supernatant), Mab lot (mouse, gift from Tatsumi Hirata, hybridoma supernatant), anti-Pax6 (rabbit, PRB-278O, COVANCE, 1:300), anti-Tbr1 (rabbit, ab31940, Abcam, 1:500), anti-Tbr2 (rabbit, ab23345, Abcam, 1:500), anti-pH3 (rat, ab10543, Abcam, 1:500), anti-Nestin (rabbit, gift from Yasuhiro Tomooka, 1:2000), RC2 (mouse IgM, gift from Miyuki Yamamoto, hybridoma supernatant), anti–Laminin A chain (rabbit, L9393, Sigma-Aldrich, 1:50), anti-L1 (rat, MAB5272, Millipore, 1:200), anti-Rellin(G10) (mouse, 553731, Calbiochem, 1:500), anti-MAP2 (mouse, M1406, Sigma-Aldrich, 1:5000), anti-Nurr1 (goat, AF2156, R&D, 1:500), anti– cleaved caspase 3 (rabbit, #9661, Cell Signaling, 1:200), anti–phospho-myosin light chain (ab2480, Abcam, 1:500), anti-calbindin (mouse, C9848, Sigma, 1:3000), anti-TAG1 (goat, AF1714, R&D Systems, 1:400), anti–bIII-tubulin (mouse, MMS-435P, COVANCE, 1:1000), anti-BrdU (rat, NB500-169, Novus Biologicals, 1:2000) (following intraperitoneal administration of BrdU [50 mg/g b.w.] to a pregnant female mouse), anti-Ctip2 (rat, ab18465, Abcam, 1:1000); anti-Satb2 (mouse, ab51502, Abcam, 1:400); anti-Cux1 (rabbit, sc-13024, Santa Cruz Biotechnology, 1:300), anti-GFP (rat, 04404-84, Nacalai Tesque, 1:500; rabbit, 598, MBL, 1:500; chick, GFP1020, Aves Labs, 1:500). After washes, sections were treated with Alexa Fluor 488–, Alexa Fluor 546–, or Alexa Fluor 647–conjugated secondary antibodies (Molecular Probes, A-11029, A-11006, A-11034, A-11030, A-11035, A-11081, A-21236, A-21245, 1:200), and subjected to confocal microscopy (FV1000; Olympus, Tokyo, Japan). In situ hybridization Riboprobes were synthesized using the following primers: Emx1 (703-1118, NM_010131) Fw: TACAAACGGCAGAAGCTGGAA, Rv: TATTCCCATAGGGAAGGGGGA; Pax6 (702-1547, NM_001244198) Fw: AGGGGGTCTGTACCAACGAT, Rv: ACATGTCAGGTTC ACTCCCG; Wnt3a (1805-2643, NM_009522) Fw: TGAAGACTCATGGGATGGAGC, Rv: GTCTAAATCCAGTGGTGGGTGG; FGF8 (537-1009, XM_006526668) Fw: ATCCGGACCTACCAGCTCTAC, Rv: TATGCACAACTAGAAGGCAGCTC; Rorb (1107-1994, NM_001043354) Fw, GACATGACTGGGATCAAACAGAT; Rv, GCCTTGTACAATGGAGGAAACAGT. Probes were labeled with digoxigenin (Roche Diagnostics, Sigma-Aldrich). E11 cerebral hemispheres that were electroporated at E10 with NeuroD-DTA were fixed overnight with 4% paraformaldehyde at 4 C. Postnatal mice that had been electroporated at E10 with NeuroD-DTA were fixed by transcardiac perfusion with 4% paraformaldehyde. Frozen sections (20 mm) were pretreated with 4% paraformaldehyde (5 min) and 0.1 M triethanolamine / 0.25% acetic anhydride (10 min), and then hybridized at 60 C for 15 hr in a solution containing 50% formamide, 0.1% SDS, 0.64 mg/ml tRNA, and 0.5 mg/ml riboprobes. The labeled cRNAs were visualized using nitroblue tetrazolium/5bromo-4-chloro-3-indolyl phosphate solution.

Cell Reports 29, 1555–1567.e1–e5, November 5, 2019 e4

Scanning electron microscopy Cerebral hemispheres were fixed with 4% paraformaldehyde / 2.5% glutaraldehyde in 0.1 M phosphate buffer (PB) at 4 C, trimmed with a blade, and then subjected to post-fixation in 1% osmium tetroxide in 0.1 M PB. The samples were dehydrated and coated with osmium. Images were collected on a JSM-7610F Schottky Field Emission SEM (JEOL). QUANTIFICATION AND STATISTICAL ANALYSIS Image analyses and quantifications were conducted using ImageJ (National Institute of Health). Nuclear tracking was performed using the Move-tr/2D software (Library Co., Ltd., Japan). The ‘‘length ratio’’ for each DiI-labeled RGC (Figure 5D) was obtained by dividing the total length of a RGC by the length of a straight line drawn perpendicularly from the apical/ventricular endfoot of that RGC to the outer/pial surface of the wall. The ‘‘angle’’ (Figure 5E) was measured between the intra-VZ portion of an RGC and a straight line drawn perpendicularly from the apical endfoot of that RGC. To evaluate correlations between the length ratio and the angle with the distance from the PS angle, the Spearman rank correlation coefficient was calculated (Figures 5D and 5E). Differences were analyzed using the Exact Wilcoxon rank–sum test (Figures 4H, 4I, and 6E–6G) and ANCOVA (Figures 5D and 5E) in the R statistical environment. All values represent means ± standard error of the mean (SEM). Significance was set at p = 0.05. No statistical methods were used to predetermine sample size, but sample sizes were similar to those described in related studies (Okamoto et al., 2013; Shinoda et al., 2018). No randomization of samples was performed, and no blinding was performed. The number of samples or cells examined in each analysis is shown in the legends or text. DATA AND CODE AVAILABILITY Source Data that support the findings of this study are available from the Lead Contact upon reasonable request.

e5 Cell Reports 29, 1555–1567.e1–e5, November 5, 2019