- Email: [email protected]
Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer € bel a, b, e, 1, Nikolai Jaschke a, b, c, Alexander Kleymann d, Lorenz C. Hofbauer a, b, e, Andy Go a, b, e, *, 1 Tilman D. Rachner €t Dresden, Dresden, Germany Division of Endocrinology and Metabolic Bone Diseases, Department of Medicine III, Technische Universita €t Dresden, Dresden, Germany Center for Healthy Ageing Department of Medicine III, Technische Universita c Department of Internal Medicine I, Gastroenterology, Hepatology, Endocrinology and Metabolism, Medical University of Innsbruck, Austria d €t Dresden, Dresden, Germany Division of Rheumatology, Department of Medicine III, Technische Universita e German Cancer Consortium (DKTK), Dresden and German Cancer Research Center (DKFZ), Heidelberg, Germany a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 January 2020 Accepted 19 January 2020 Available online xxx
Advanced stages of breast cancer are frequently complicated by bone metastases which cause substantial cancer-related morbidity and mortality. The Wnt-signaling antagonist Dickkopf-1 (DKK-1) has emerged as a crucial factor in the development and progression of osteolytic bone metastases. Although several signaling pathways have been implicated in promoting DKK-1 production in breast cancer cells, pharmacological interventions that interfere with tumor DKK-1 synthesis still remain scarce. In the current study, using an unbiased approach, we identified the small molecule Dorsomorphin as a potent suppressor of DKK-1 in several breast cancer cell lines (MDA-MB-231, MDA-Bone, MDA-MET and MCF7, respectively). Here, Dorsomorphin suppressed DKK-1 mRNA and protein production by 70 and 90%, respectively (p <0.001). Whereas bone morphogenic protein (BMP)- and AMP activated protein kinase (AMPK)-signaling are two well-established targets of Dorsomorphin, we show that neither pathway is essentially involved in facilitating its inhibitory effects on DKK-1. In summary, we identified Dorsomorphin as a potent pharmacological inhibitor of DKK-1 production in breast cancer cells. Whether Dorsomorphin reflects a valuable therapeutic agent in breast cancer warrants further investigations. © 2020 Published by Elsevier Inc.
Keywords: Breast cancer Dickkopf-1 Dorsomorphin Bone metastases
1. Introduction Breast cancer is the most common malignancy in women and advanced stages of the disease are frequently complicated by osteolytic bone metastases [1,2]. The latter not only inflict patients with considerable morbidity but also substantially contribute to cancer-related mortality [3]. Although progress has been made in understanding the pathogenesis of bone metastases, effective therapeutic interventions still remain sparse. A growing body of literature has suggested that Dickkopf (DKK) proteins might be critically involved in the development and progression of bone metastases [2,4]. The DKK family encompasses at least four different members (DKK-1-4) of cysteine-rich proteins
* Corresponding author. Division of Endocrinology, Diabetes and Bone Diseases & Healthy Aging Department of Medicine III, Fetscherstraße 74, D-01037, Dresden, Germany. E-mail address: [email protected] (T.D. Rachner). 1 Both authors contributed equally.
with DKK-1 being the most extensively investigated molecule [5]. DKK-1 is a well-established inhibitor of canonical Wnt-signaling, thereby acting as a negative regulator of bone formation [6]. Several lines of evidence have supported the concept that DKK-1 is a major driver of malignant bone disease. Patients with breast cancer display elevated serum concentrations of DKK-1 compared to healthy controls [7]. Moreover, high systemic DKK-1 levels are associated with poor patient outcome in breast cancer [8]. At the molecular level, breast cancer cells express and secrete biologically active DKK-1, which inhibits bone formation, while simultaneously promoting bone resorption [9]. Together, these changes might foster the seeding of tumor cells to the skeleton and also promote tumor growth within the bone microenvironment [2,10]. Thus, interfering with DKK-1 production and/or signaling represents a promising approach for treating malignant bone disease. Multiple studies have highlighted pathways which are involved in promoting DKK-1 production in breast cancer cells including the mevalonate pathway, as well as mitogen activated protein kinase (MAPK)-signaling [11,12]. Yet, pharmacological interventions to
https://doi.org/10.1016/j.bbrc.2020.01.106 0006-291X/© 2020 Published by Elsevier Inc.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
2
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
modulate tumor-intrinsic DKK-1 expression are currently limited. In the current study, we aimed to identify novel inhibitors of DKK-1 production in breast cancer cells which might have clinical implications for the treatment of bone metastases in the future.
presented as relative expression to the house keeping gene (GAPDH) or as a percentage of control.
2. Methods
Western blot analyses were performed as previously described [14]. Cells were cultured and treated as described, washed and scraped in a lysis buffer and total protein concentrations was quantified. Twenty mg (20 mg) of protein was loaded on a SDSePAGE and transferred onto a 0.2 mm nitrocellulose membrane. After blocking with 5% non-fat dry milk in Tris-buffered saline with 1% tween-20 (TBS-T), membranes were incubated with a primary antibody overnight. The following antibodies were used: anti-pSMAD1/5/8, anti-SMAD1 and anti-GAPDH (all from Cell signaling, Frankfurt, Germany). Then the membrane was incubated for 1 h with the HRPconjugated secondary antibody. Membranes were washed twice with TBS-T, and proteins were visualized with Super Signal (Pierce, Bonn, Germany) enhanced chemiluminescence.
2.1. Cells and reagents Human MDA-MB-231 and MCF-7 breast cancer cells, as well as the human osteosarcoma cell line SaOS-2 were purchased from ATCC (Manassas, VA). MDA-BONE cells (also known as MB-231TxSA cells) were obtained from the University of Texas (San Antonio, TX, USA). MDA-MET cells were kindly provided by Prof. L. Suva (Center for Orthopedic Research, University of Arkansas, AR, USA). All cell lines were cultured in DMEM/Ham’s F-12 (PAA, Pasching, Austria) with 10% fetal calf serum supreme (Lonza, Cologne, Germany) and 1% penicillin/streptomycin (PAA, Pasching, Austria). The authenticity of cell lines was determined by short tandem repeat profiling and by matching with the known profiles at DSMZ (German Collection of Microorganisms and Cell Cultures). Dorsomorphin was purchased from Selleck (TX, USA) and used at a concentration of 10 mM for all experiments if not otherwise stated. Adenine 9-b-D-arabinofuranoside (Ara-A) and C75 were obtained from Sigma-Aldrich (Munich, Germany), dissolved in DMSO and diluted to 100 mM for all experiments. Recombinant human BMPs (BMP-2, -4 and -6, respectively) were purchased from PeproTech (PeproTech, Hamburg, Germany). Working solutions contained 200 ng/ml of each BMP. The highly-specific canonical BMP inhibitor LDN193189 (Selleck, TX, USA) was used at 10 mM in all cell culture experiments. Metformin-HCl, as well as 5-aminoimidazole-4-carboxamide-1b-D- ribofuranoside (AICAR) were both obtained from SigmaAldrich (Munich, Germany). The former was diluted to 5 mM, while the latter was used at 10 mM. 2.2. Chemical inhibitor array To identify molecular inhibitors of DKK-1 expression, the Sure Find Transcriptome PCR array was used (Qiagen, MD, USA). This array contains cDNAs of MCF7 breast cancer cells treated with 90 chemical inhibitors of distinct signaling pathways. Alterations of DKK-1 expression were assessed by qPCR analysis and expressed as fold change compared to vehicle-treated control cells. The following primers were used: DKK-1 sense AGCACCTTGGATGGGTATTC and anti-sense CACACTTGACCTTCTTTCAGGAC; Beta-Actin sense CCAACCGCGAGAAGATGA and anti-sense CCAGAGGCGTACAGGGATAG.
2.4. Western blot
2.5. Human Dickkopf-1 ELISA The content of secreted Dkk-1 in cell culture supernatants was assessed using a commercially available enzyme-linked immunosorbent assay (ELISA) (Biomedica, Vienna, Austria) according to the manufacturer’s protocol. In brief, cell culture supernatants were diluted appropriately and incubated with an anti-DKK-1 capture antibody which was pre-coated to a microwell plate. After a washing step, the biotinylated detection antibody was applied, followed by the Streptavidin-HRP conjugate. After another washing step, the substrate Tetramethylbenzidine (TBMA) was added. Finally, the reaction was stopped and the absorbance was measured at 450 nm. 2.6. Cell titer blue Cell viability was assessed using the CellTiterBlue® assay (Promega, Mannheim, Germany). 2.7. Statistical analysis Results are presented as mean ± standard deviation (SD). All experiments were repeated at least three independent times. Student’s unpaired, two-sided -test was utilized for comparisons between two groups, whereas one-way ANOVA with Sidak’s or Dunnett’s post hoc test, respectively, was used to evaluate differences between groups of three or more. P values < 0.05 were considered statistically significant. All statistical analysis were performed using Graphpad V8 (Graphpad Inc., La Jolla, CA, USA).
2.3. RNA isolation, RT and real-time PCR 3. Results RNA isolation, reverse transcription (RT) and real-time PCR were performed as previously published [13]. Briefly, RNA was isolated using the High Pure RNA extraction kit from Roche according to the manufacturer’s protocol. Five-hundred ng RNA were reversetranscribed using Superscript II (Invitrogen, Darmstadt, Germany). A standard SYBR green-based real-time PCR protocol was used. Primer sequences for DKK-1 are listed above. The primer pairs for GAPDH were as follows: sense CATCACCATCTTCCAGGAGCG and anti-sense TGACCTTGCCCACAGCCTTG. PCR conditions were 50 C for 2 min and 95 C for 10 min followed by 40 cycles with 95 C for 15 s and 60 C for 1 min. The melting curve as assessed in the following program: 95 C for 15 s, 60 C for 1 min and 95 C for 30 s. The results were calculated applying the DDCT method and are
3.1. The small molecule Dorsomorphin suppresses DKK-1 expression in breast cancer cells Using an unbiased approach, we performed a chemical inhibitor PCR array analysis to identify novel suppressors of DKK-1 expression in the estrogen receptor-positive breast cancer cell line MCF7. While multiple molecules affecting distinct signaling-pathways mildly interfered with DKK-1 expression, the small molecule Dorsomorphin (also known as “Compound C00 ) potently suppressed DKK-1 mRNA levels by over 20-fold (Fig. 1A). To validate these results, MCF7 cells were incubated with Dorsomorphin for 24 h and DKK-1 expression was analyzed. In line
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. The small molecule Dorsomorphin suppresses DKK-1 expression in breast cancer cells. (A) Chemical inhibitor array PCR analysis in MCF7 breast cancer cells (B) DKK-1 mRNA levels assessed by qPCR in MCF7 cells after incubating them with 10 mM Dorsomorphin for 24 h (C) Dickkopf-1 expression in MDA-231 cells after being exposed to 10 mM Dorsomorphin for 24 h (D) Dose-dependent suppression of DKK-1 mRNA in MDA-231 cells. Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to two-tailed, unpaired student’s t-test and one-way ANOVA followed by Sidak’s post-hoc test, respectively.
with our initial discovery, Dorsomorphin significantly suppressed DKK-1 mRNA levels in MCF7 cells (p ¼ 0.0144) (Fig. 1B). To further expand these findings, similar experiments were performed using the hormone receptor negative breast cancer cell line MDA-MB-231 (in this manuscript further referred to as “MDA231”). Compared to MCF7 cells, DKK-1 suppression by Dorsomorphin was even more pronounced in MDA-231 cells (70%, p ¼ 0.0017) (Fig. 1C). Thus, further experiments were conducted using these cells. In MDA-231 cells, Dorsomorphin suppressed DKK-1 mRNA levels in a dose-dependent fashion (Fig. 1D), which was also highly evident in two osteotropic MDA-231-derived subclones, namely MDA-Bone and MDA-MET cells (Supp. Fig. 1A and B). Of note, significant cytotoxicity was observed at higher Dorsomorphin concentrations in MDA-231 after 48 h exposure to the substance as illustrated by a significant loss of cell vitality (up to 60% compared to controls; p ¼ 0.0001) (Supp. Fig. 1C). Importantly, the suppression of DKK-1 mRNA levels by Dorsomorphin also translated into a prominent reduction of DKK-1 protein secretion by almost 90% (p < 0.0001) (Fig. 2A). Intriguingly, the inhibitory effects of Dorsomorphin on DKK-1 expression were evident as early as 1 h after treating the cells with the molecule and persisted for 24 h (Fig. 2B). To investigate whether the modulation of DKK-1 production by Dorsomorphin was restricted to breast cancer, osteosarcoma cells (SaOS-2) were used. Similarly to our previous findings, Dorsomorphin also significantly inhibited DKK-1 expression in SaOS2 cells, although the observed effects were slightly delayed (Fig. 2C).
3.2. Dorsomorphin regulates DKK-1 independently of AMPKsignaling in breast cancer Previously published data has demonstrated that Dorsomorphin acts by inhibiting AMP Kinase (AMPK)- and bone morphogenic protein (BMP)-signaling [15,16]. Thus, we treated MDA-231 cells with the two AMPK inhibitors C75 and Ara-A to elucidate whether changes in DKK-1 expression could be induced. However, none of the two molecules had an effect on DKK-1 mRNA levels (Fig. 2D and E). In line with this, Dorsomorphininduced suppression of DKK-1 could not be rescued by the two AMPK activators metformin and 5-aminoimidazole-4carboxamide-1-b-D-ribofuranoside (AICAR) (Fig. 2F). 3.3. BMP-signaling is dispensable for DKK-1 suppression by dorsomorphin To elucidate whether the BMP-pathway might be involved in facilitating the effect of Dorsomorphin on DKK-1, we first sough to confirm the molecule’s inhibitory properties on canonical BMPsignaling. In line with previous reports [17], Dorsomorphin effectively abrogated canonical BMP-signaling as demonstrated by abolished BMP-induced SMAD1/5/8 phosphorylation in the presence of the molecule (Fig. 3A). However, stimulation of MDA-231 cells with various BMPs (BMP-2, -4 and -6, respectively) did not yield alterations in DKK-1 mRNA levels (Fig. 3B). Similarly, the highly specific canonical BMP-signaling-inhibitor LDN193189 did not modulate DKK-1 expression in these cells (Supp. Fig. 1D). Moreover, the effect of
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
4
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Dorsomorphin regulates DKK-1 independently of AMPK in breast cancer (A) DKK-1 protein levels in culture medium of MDA-231 cells after being exposed to 10 mM Dorsomorphin for 24 h assessed by ELISA (B) Time course of DKK-1 mRNA suppression by 10 mM Dorsomorphin in MDA-231 cells. (C) DKK-1 expression in osteosarcoma SaOS-2 cells treated with 10 mM Dorsomorphin (D, E) DKK-1 mRNA levels in MDA-231 cells after being exposed to the two AMPK inhibitors C75 and Ara-A, respectively, for 24 h. Both substances were used at a final concentration of 100 mM (F) DKK-1 expression in MDA-231 cells after being treated with 10 mM Dorsomorphin in the presence or absence of the two AMPK activators metformin (5 mM) and AICAR (0,25 mM) for 6 h. Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to two-tailed, unpaired student’s t-test and one-way ANOVA followed by Dunnett’s post-hoc test, respectively.
Fig. 3. BMP-signaling is dispensable for DKK-1 suppression by Dorsomorphin. (A) Canonical BMP-signaling in MCF7 cells evaluated by immunoblot analysis in the presence or absence of 10 mM Dorsomorphin (B) DKK-1 expression in MDA-231 cells treated with 200 ng/ml of various BMPs for 24 h. (C) Levels of DKK-1 mRNA after co-incubating MDA-231 cells with BMP4 (200 ng/ml) and Dorsomorphin (10 mM) or either substance alone (D, E) DKK-1 expression in MCF7 and SaOS-2 cells after being exposed to different BMPs (each at 200 ng/ml). Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to one-way ANOVA followed by Dunnett’s or Sidak’s post-hoc test, respectively.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Dorsomorphin on DKK-1 mRNA levels could not be rescued by the presence of BMP4 (Fig. 3C). In contrast, DKK-1 expression was strongly induced by BMP-4 in MCF7 breast cancer cells (Fig. 3D). Additionally, BMP-4, as well as BMP-6 promoted DKK-1 production in SaOS-2 osteosarcoma cells (Fig. 3E) suggesting that BMPs exert differential effects on DKK-1 depending on the subtype of cancer cell lines used. 4. Discussion Effective pharmacological approaches for treating malignant bone disease are desperately needed. Accumulating evidence has implied that overexpression of DKK-1 is causally involved in the formation and progression of osteolytic bone metastases, not only in breast cancer, but also in multiple myeloma [9,18,19]. As such, interfering with DKK-1 production and/or secretion in these cells might represent a promising strategy for treating bone metastases. Using an unbiased approach, we identified Dorsomorphin as a novel pharmacological inhibitor of DKK-1 production in multiple breast cancer cells lines. Intriguingly, the suppressive effects of Dorsomorphin on DKK-1 were evident as early as 1 h after challenging the cells with the substance pointing towards rapid genomic or potentially nongenomic regulatory mechanisms (e.g. mRNA degradation). Notably, DKK-1 inhibition by Dorsomorphin was not limited to breast cancer cells but also observable in osteosarcoma cells, suggesting that the molecule acts broadly against DKK-1. Previously published data has shown that Dorsomorphin interferes with AMPK- signaling [20]. In the current study, neither inhibition, nor activation of AMPK altered DKK-1 expression arguing against a prominent role of this pathway in facilitating Dorsomorphin’s effects on DKK-1. Besides AMPK, BMP receptors are well-established targets of Dorsomorphin. In fact, inhibition of BMP-signaling by Dorsomorphin reverses the mesenchymal phenotype of cancer-initiating cells, thereby reducing tumor cell motility, growth and invasiveness [21]. In our experiments, we confirmed the potent inhibitory effects of Dorsomorphin on canonical BMP-signaling but did not find evidence for an involvement of this pathway in facilitating the suppressive effects of Dorsomorphin on DKK-1. Collectively, these results imply that both AMPK- and BMPsignaling are dispensable for Dorsomorphin’s suppressive effects on DKK-1 in breast cancer. Importantly, Dorsomorphin appears to interact with a wide range of different kinases [22,23]. In fact, one study found that the activity of 64 (out of 119 tested) protein kinases was strongly modulated in the presence of 10 mM Dorsomorphin [24]. As such, the precise mechanisms how Dorsomorphin affects DKK-1 remain to be deciphered. Yet, the potent and rapid inhibitory effects of the substance on DKK-1 mRNA and protein abundance renders Dorsomorphin a promising agent for modulating DKK-1 biology in breast cancer. It is also worth noting that prolonged Dorsomorphin exposure (48 h) caused significant cytotoxicity at higher concentrations, an effect that may add anti-tumor potential to its clinical use but could also be associated with adverse events. To date, no clinical trials with Dorsomorphin have been conducted. As such, the question whether Dorsomorphin also elicits cytotoxicity in humans and whether such effects are restricted to tumor cells or not remains to be elucidated. In conclusion, we identified Dorsomorphin as a novel inhibitor of DKK-1 production in breast cancer cells. Neither AMPK-, nor BMP-signaling are essentially involved in facilitating Dorsomorphin’s strong suppressive effects on DKK-1.
5
Future studies investigating the effects of Dorsomorphin on breast cancer metabolism and survival using specific in vivo models of primary and bone-metastatic breast cancer are warranted. Author contribution Study Design: AG and TDR. Study conduct: AG and NJ. Data collection: AG, and NJ. Data analysis: NJ, AG, AK and TDR. Data interpretation: NJ, AG and TDR. Drafting Manuscript: NJ, AG, AK and TDR. Revising manuscript content: NJ, AG, AK, LCH and TDR. Approving final version of manuscript: NJ, AG, AK, LCH, and TDR. TDR takes responsibility for the integrity of the data analysis. Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: The authors have received grants or honorarium for advisory boards or lectures to the individual or the institution by Amgen (LCH, TDR), and UCB (LCH, TDR). AG, AK and NJ declare no conflict of interest. Acknowledgments € tzel for her excellent The authors would like to thank Josefa Ho technical assistance and Ms. Theresa Reiche for her secretarial assistance. The work was funded by the Deutsche Forschungsgemeinschaft to AG (GO 3055/1-1), TDR (RA 2151/3-1, and 4-1), and to LCH (HO 1875/15-1 and 16-1) as part of the DFG Research group SKELMET and the Schwerpunktprogramm-2084 mBone. Further funding was provided by the German Academic Exchange Service (Deutscher Akademischer Austauschdienst) to NJ. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2020.01.106. References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, Ca - Cancer J. Clin. 69 (2019) 7e34, https://doi.org/10.3322/caac.21551, 2019. [2] L.C. Hofbauer, T.D. Rachner, R.E. Coleman, F. Jakob, Endocrine aspects of bone metastases, Lancet Diabetes Endocrinol. 2 (2014) 500e512, https://doi.org/ 10.1016/S2213-8587(13)70203-1. [3] N. Brook, E. Brook, A. Dharmarajan, C.R. Dass, A. Chan, Breast cancer bone metastases: pathogenesis and therapeutic targets, Int. J. Biochem. Cell Biol. 96 (2018) 63e78, https://doi.org/10.1016/j.biocel.2018.01.003. €bel, P. Benad-Mehner, L.C. Hofbauer, M. Rauner, Dickkopf-1 [4] T.D. Rachner, A. Go as a mediator and novel target in malignant bone disease, Canc. Lett. 346 (2014) 172e177, https://doi.org/10.1016/j.canlet.2014.01.010. [5] D. Diarra, M. Stolina, K. Polzer, J. Zwerina, M.S. Ominsky, D. Dwyer, A. Korb, J. Smolen, M. Hoffmann, C. Scheinecker, D. van der Heide, R. Landewe, D. Lacey, W.G. Richards, G. Schett, Dickkopf-1 is a master regulator of joint remodeling, Nat. Med. 13 (2007) 156e163, https://doi.org/10.1038/nm1538. [6] Y. Huang, L. Liu, A. Liu, Dickkopf-1: current knowledge and related diseases, Life Sci. 209 (2018) 249e254, https://doi.org/10.1016/j.lfs.2018.08.019. [7] N. Voorzanger-Rousselot, F. Journe, V. Doriath, J.J. Body, P. Garnero, Assessment of circulating Dickkopf-1 with a new two-site immunoassay in healthy subjects and women with breast cancer and bone metastases, Calcif. Tissue Int. 84 (2009) 348e354, https://doi.org/10.1007/s00223-009-9225-y. [8] S.J. Zhou, S.R. Zhuo, X.Q. Yang, C.X. Qin, Z.L. Wang, Serum Dickkopf-1 expression level positively correlates with a poor prognosis in breast cancer, Diagn. Pathol. 9 (2014) 161, https://doi.org/10.1186/s13000-014-0161-4. [9] N. Voorzanger-Rousselot, D. Goehrig, F. Journe, V. Doriath, J.J. Body, zardin, P. Garnero, Increased Dickkopf-1 expression in breast cancer P. Cle bone metastases, Br. J. Canc. 97 (2007) 964e970, https://doi.org/10.1038/ sj.bjc.6603959. [10] J.J. Pinzone, B.M. Hall, N.K. Thudi, M. Vonau, Y.W. Qiang, T.J. Rosol, J.D. Shaughnessy, The role of Dickkopf-1 in bone development, homeostasis, and disease, Blood 113 (2009) 517e525, https://doi.org/10.1182/blood-200803-145169.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
6
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
€ bel, S. Thiele, M. Rauner, P. Benad-Mehner, P. Hadji, [11] T.D. Rachner, A. Go T. Bauer, M.H. Muders, G.B. Baretton, F. Jakob, R. Ebert, M. Bornh€ auser, C. Schem, L.C. Hofbauer, Dickkopf-1 is regulated by the mevalonate pathway in breast cancer, Breast Cancer Res. 16 (2014) R20, https://doi.org/10.1186/ bcr3616. €bel, A. Browne, J. Ho € tzel, M. Rauner, L.C. Hofbauer, P38 [12] T.D. Rachner, A. Go regulates the Wnt inhibitor Dickkopf-1 in breast cancer, Biochem. Biophys. Res. Commun. 466 (2015) 728e732, https://doi.org/10.1016/ j.bbrc.2015.09.101. €bel, M. Rauner, P. Benad-Mehner, N. Schütze, S. Füssel, P. Hadji, [13] M. Wilke, A. Go L.C. Hofbauer, T.D. Rachner, Zoledronic acid and atorvastatin inhibit avb3mediated adhesion of breast cancer cells, J. Bone Oncol. 3 (2014) 10e17, https://doi.org/10.1016/j.jbo.2014.02.001. €bel, T.D. Rachner, S. Fuessel, M. Froehner, M.H. Muders, [14] S. Thiele, A. Go €user, M. Rauner, G.B. Baretton, R. Bernhardt, F. Jakob, C.C. Glüer, M. Bornha L.C. Hofbauer, WNT5A has anti-prostate cancer effects in vitro and reduces tumor growth in the skeleton in vivo, J. Bone Miner. Res. 30 (2015) 471e480, https://doi.org/10.1002/jbmr.2362. [15] A. Isakovic, L. Harhaji, D. Stevanovic, Z. Markovic, M. Sumarac-Dumanovic, V. Starcevic, D. Micic, V. Trajkovic, Dual antiglioma action of metformin: cell cycle arrest and mitochondria-dependent apoptosis, Cell. Mol. Life Sci. 64 (2007) 1290e1302, https://doi.org/10.1007/s00018-007-7080-4. [16] J.H. Boergermann, J. Kopf, P.B. Yu, P. Knaus, Dorsomorphin and LDN-193189 inhibit BMP-mediated Smad, p38 and Akt signalling in C2C12 cells, Int. J. Biochem. Cell Biol. 42 (2010) 1802e1807, https://doi.org/10.1016/ j.biocel.2010.07.018. [17] P.B. Yu, C.C. Hong, C. Sachidanandan, J.L. Babitt, D.Y. Deng, S.A. Hoyng, H.Y. Lin, K.D. Bloch, R.T. Peterson, Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism, Nat. Chem. Biol. 4 (2008) 33e41, https://
doi.org/10.1038/nchembio.2007.54. [18] M. Kaiser, M. Mieth, P. Liebisch, R. Oberl€ ander, J. Rademacher, C. Jakob, L. Kleeberg, C. Fleissner, E. Braendle, M. Peters, D. Stover, O. Sezer, U. Heider, Serum concentrations of DKK-1 correlate with the extent of bone disease in patients with multiple myeloma, Eur. J. Haematol. 80 (2008) 490e494, https://doi.org/10.1111/j.1600-0609.2008.01065.x. [19] E. Tian, F. Zhan, R. Walker, E. Rasmussen, Y. Ma, B. Barlogie, J.D. Shaughnessy, The role of the Wnt-signaling antagonist DKK1 in the development of osteolytic lesions in multiple myeloma, N. Engl. J. Med. 349 (2003) 2483e2494, https://doi.org/10.1056/NEJMoa030847. ~ arís, AMPK [20] M. Ríos, M. Foretz, B. Viollet, A. Prieto, M. Fraga, J.A. Costoya, R. Sen activation by oncogenesis is required to maintain cancer cell proliferation in astrocytic tumors, Canc. Res. 73 (2013) 2628e2638, https://doi.org/10.1158/ 0008-5472.CAN-12-0861. [21] C. Garulli, C. Kalogris, L. Pietrella, C. Bartolacci, C. Andreani, M. Falconi, C. Marchini, A. Amici, Dorsomorphin reverses the mesenchymal phenotype of breast cancer initiating cells by inhibition of bone morphogenetic protein signaling, Cell. Signal. 26 (2014) 352e362, https://doi.org/10.1016/ j.cellsig.2013.11.022. [22] X. Liu, R.R. Chhipa, I. Nakano, B. Dasgupta, The AMPK inhibitor compound C is a potent AMPK-independent antiglioma agent, Mol. Canc. Therapeut. 13 (2014) 596e605, https://doi.org/10.1158/1535-7163.MCT-13-0579. [23] B. Dasgupta, W. Seibel, Compound C/Dorsomorphin: its use and misuse as an AMPK inhibitor, Methods Mol. Biol. 1732 (2018) 195e202, https://doi.org/ 10.1007/978-1-4939-7598-3_12. [24] J. Vogt, R. Traynor, G.P. Sapkota, The specificities of small molecule inhibitors of the TGFß and BMP pathways, Cell. Signal. 23 (2011) 1831e1842, https:// doi.org/10.1016/j.cellsig.2011.06.019.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer € bel a, b, e, 1, Nikolai Jaschke a, b, c, Alexander Kleymann d, Lorenz C. Hofbauer a, b, e, Andy Go a, b, e, *, 1 Tilman D. Rachner €t Dresden, Dresden, Germany Division of Endocrinology and Metabolic Bone Diseases, Department of Medicine III, Technische Universita €t Dresden, Dresden, Germany Center for Healthy Ageing Department of Medicine III, Technische Universita c Department of Internal Medicine I, Gastroenterology, Hepatology, Endocrinology and Metabolism, Medical University of Innsbruck, Austria d €t Dresden, Dresden, Germany Division of Rheumatology, Department of Medicine III, Technische Universita e German Cancer Consortium (DKTK), Dresden and German Cancer Research Center (DKFZ), Heidelberg, Germany a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 January 2020 Accepted 19 January 2020 Available online xxx
Advanced stages of breast cancer are frequently complicated by bone metastases which cause substantial cancer-related morbidity and mortality. The Wnt-signaling antagonist Dickkopf-1 (DKK-1) has emerged as a crucial factor in the development and progression of osteolytic bone metastases. Although several signaling pathways have been implicated in promoting DKK-1 production in breast cancer cells, pharmacological interventions that interfere with tumor DKK-1 synthesis still remain scarce. In the current study, using an unbiased approach, we identified the small molecule Dorsomorphin as a potent suppressor of DKK-1 in several breast cancer cell lines (MDA-MB-231, MDA-Bone, MDA-MET and MCF7, respectively). Here, Dorsomorphin suppressed DKK-1 mRNA and protein production by 70 and 90%, respectively (p <0.001). Whereas bone morphogenic protein (BMP)- and AMP activated protein kinase (AMPK)-signaling are two well-established targets of Dorsomorphin, we show that neither pathway is essentially involved in facilitating its inhibitory effects on DKK-1. In summary, we identified Dorsomorphin as a potent pharmacological inhibitor of DKK-1 production in breast cancer cells. Whether Dorsomorphin reflects a valuable therapeutic agent in breast cancer warrants further investigations. © 2020 Published by Elsevier Inc.
Keywords: Breast cancer Dickkopf-1 Dorsomorphin Bone metastases
1. Introduction Breast cancer is the most common malignancy in women and advanced stages of the disease are frequently complicated by osteolytic bone metastases [1,2]. The latter not only inflict patients with considerable morbidity but also substantially contribute to cancer-related mortality [3]. Although progress has been made in understanding the pathogenesis of bone metastases, effective therapeutic interventions still remain sparse. A growing body of literature has suggested that Dickkopf (DKK) proteins might be critically involved in the development and progression of bone metastases [2,4]. The DKK family encompasses at least four different members (DKK-1-4) of cysteine-rich proteins
* Corresponding author. Division of Endocrinology, Diabetes and Bone Diseases & Healthy Aging Department of Medicine III, Fetscherstraße 74, D-01037, Dresden, Germany. E-mail address: [email protected] (T.D. Rachner). 1 Both authors contributed equally.
with DKK-1 being the most extensively investigated molecule [5]. DKK-1 is a well-established inhibitor of canonical Wnt-signaling, thereby acting as a negative regulator of bone formation [6]. Several lines of evidence have supported the concept that DKK-1 is a major driver of malignant bone disease. Patients with breast cancer display elevated serum concentrations of DKK-1 compared to healthy controls [7]. Moreover, high systemic DKK-1 levels are associated with poor patient outcome in breast cancer [8]. At the molecular level, breast cancer cells express and secrete biologically active DKK-1, which inhibits bone formation, while simultaneously promoting bone resorption [9]. Together, these changes might foster the seeding of tumor cells to the skeleton and also promote tumor growth within the bone microenvironment [2,10]. Thus, interfering with DKK-1 production and/or signaling represents a promising approach for treating malignant bone disease. Multiple studies have highlighted pathways which are involved in promoting DKK-1 production in breast cancer cells including the mevalonate pathway, as well as mitogen activated protein kinase (MAPK)-signaling [11,12]. Yet, pharmacological interventions to
https://doi.org/10.1016/j.bbrc.2020.01.106 0006-291X/© 2020 Published by Elsevier Inc.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
2
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
modulate tumor-intrinsic DKK-1 expression are currently limited. In the current study, we aimed to identify novel inhibitors of DKK-1 production in breast cancer cells which might have clinical implications for the treatment of bone metastases in the future.
presented as relative expression to the house keeping gene (GAPDH) or as a percentage of control.
2. Methods
Western blot analyses were performed as previously described [14]. Cells were cultured and treated as described, washed and scraped in a lysis buffer and total protein concentrations was quantified. Twenty mg (20 mg) of protein was loaded on a SDSePAGE and transferred onto a 0.2 mm nitrocellulose membrane. After blocking with 5% non-fat dry milk in Tris-buffered saline with 1% tween-20 (TBS-T), membranes were incubated with a primary antibody overnight. The following antibodies were used: anti-pSMAD1/5/8, anti-SMAD1 and anti-GAPDH (all from Cell signaling, Frankfurt, Germany). Then the membrane was incubated for 1 h with the HRPconjugated secondary antibody. Membranes were washed twice with TBS-T, and proteins were visualized with Super Signal (Pierce, Bonn, Germany) enhanced chemiluminescence.
2.1. Cells and reagents Human MDA-MB-231 and MCF-7 breast cancer cells, as well as the human osteosarcoma cell line SaOS-2 were purchased from ATCC (Manassas, VA). MDA-BONE cells (also known as MB-231TxSA cells) were obtained from the University of Texas (San Antonio, TX, USA). MDA-MET cells were kindly provided by Prof. L. Suva (Center for Orthopedic Research, University of Arkansas, AR, USA). All cell lines were cultured in DMEM/Ham’s F-12 (PAA, Pasching, Austria) with 10% fetal calf serum supreme (Lonza, Cologne, Germany) and 1% penicillin/streptomycin (PAA, Pasching, Austria). The authenticity of cell lines was determined by short tandem repeat profiling and by matching with the known profiles at DSMZ (German Collection of Microorganisms and Cell Cultures). Dorsomorphin was purchased from Selleck (TX, USA) and used at a concentration of 10 mM for all experiments if not otherwise stated. Adenine 9-b-D-arabinofuranoside (Ara-A) and C75 were obtained from Sigma-Aldrich (Munich, Germany), dissolved in DMSO and diluted to 100 mM for all experiments. Recombinant human BMPs (BMP-2, -4 and -6, respectively) were purchased from PeproTech (PeproTech, Hamburg, Germany). Working solutions contained 200 ng/ml of each BMP. The highly-specific canonical BMP inhibitor LDN193189 (Selleck, TX, USA) was used at 10 mM in all cell culture experiments. Metformin-HCl, as well as 5-aminoimidazole-4-carboxamide-1b-D- ribofuranoside (AICAR) were both obtained from SigmaAldrich (Munich, Germany). The former was diluted to 5 mM, while the latter was used at 10 mM. 2.2. Chemical inhibitor array To identify molecular inhibitors of DKK-1 expression, the Sure Find Transcriptome PCR array was used (Qiagen, MD, USA). This array contains cDNAs of MCF7 breast cancer cells treated with 90 chemical inhibitors of distinct signaling pathways. Alterations of DKK-1 expression were assessed by qPCR analysis and expressed as fold change compared to vehicle-treated control cells. The following primers were used: DKK-1 sense AGCACCTTGGATGGGTATTC and anti-sense CACACTTGACCTTCTTTCAGGAC; Beta-Actin sense CCAACCGCGAGAAGATGA and anti-sense CCAGAGGCGTACAGGGATAG.
2.4. Western blot
2.5. Human Dickkopf-1 ELISA The content of secreted Dkk-1 in cell culture supernatants was assessed using a commercially available enzyme-linked immunosorbent assay (ELISA) (Biomedica, Vienna, Austria) according to the manufacturer’s protocol. In brief, cell culture supernatants were diluted appropriately and incubated with an anti-DKK-1 capture antibody which was pre-coated to a microwell plate. After a washing step, the biotinylated detection antibody was applied, followed by the Streptavidin-HRP conjugate. After another washing step, the substrate Tetramethylbenzidine (TBMA) was added. Finally, the reaction was stopped and the absorbance was measured at 450 nm. 2.6. Cell titer blue Cell viability was assessed using the CellTiterBlue® assay (Promega, Mannheim, Germany). 2.7. Statistical analysis Results are presented as mean ± standard deviation (SD). All experiments were repeated at least three independent times. Student’s unpaired, two-sided -test was utilized for comparisons between two groups, whereas one-way ANOVA with Sidak’s or Dunnett’s post hoc test, respectively, was used to evaluate differences between groups of three or more. P values < 0.05 were considered statistically significant. All statistical analysis were performed using Graphpad V8 (Graphpad Inc., La Jolla, CA, USA).
2.3. RNA isolation, RT and real-time PCR 3. Results RNA isolation, reverse transcription (RT) and real-time PCR were performed as previously published [13]. Briefly, RNA was isolated using the High Pure RNA extraction kit from Roche according to the manufacturer’s protocol. Five-hundred ng RNA were reversetranscribed using Superscript II (Invitrogen, Darmstadt, Germany). A standard SYBR green-based real-time PCR protocol was used. Primer sequences for DKK-1 are listed above. The primer pairs for GAPDH were as follows: sense CATCACCATCTTCCAGGAGCG and anti-sense TGACCTTGCCCACAGCCTTG. PCR conditions were 50 C for 2 min and 95 C for 10 min followed by 40 cycles with 95 C for 15 s and 60 C for 1 min. The melting curve as assessed in the following program: 95 C for 15 s, 60 C for 1 min and 95 C for 30 s. The results were calculated applying the DDCT method and are
3.1. The small molecule Dorsomorphin suppresses DKK-1 expression in breast cancer cells Using an unbiased approach, we performed a chemical inhibitor PCR array analysis to identify novel suppressors of DKK-1 expression in the estrogen receptor-positive breast cancer cell line MCF7. While multiple molecules affecting distinct signaling-pathways mildly interfered with DKK-1 expression, the small molecule Dorsomorphin (also known as “Compound C00 ) potently suppressed DKK-1 mRNA levels by over 20-fold (Fig. 1A). To validate these results, MCF7 cells were incubated with Dorsomorphin for 24 h and DKK-1 expression was analyzed. In line
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. The small molecule Dorsomorphin suppresses DKK-1 expression in breast cancer cells. (A) Chemical inhibitor array PCR analysis in MCF7 breast cancer cells (B) DKK-1 mRNA levels assessed by qPCR in MCF7 cells after incubating them with 10 mM Dorsomorphin for 24 h (C) Dickkopf-1 expression in MDA-231 cells after being exposed to 10 mM Dorsomorphin for 24 h (D) Dose-dependent suppression of DKK-1 mRNA in MDA-231 cells. Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to two-tailed, unpaired student’s t-test and one-way ANOVA followed by Sidak’s post-hoc test, respectively.
with our initial discovery, Dorsomorphin significantly suppressed DKK-1 mRNA levels in MCF7 cells (p ¼ 0.0144) (Fig. 1B). To further expand these findings, similar experiments were performed using the hormone receptor negative breast cancer cell line MDA-MB-231 (in this manuscript further referred to as “MDA231”). Compared to MCF7 cells, DKK-1 suppression by Dorsomorphin was even more pronounced in MDA-231 cells (70%, p ¼ 0.0017) (Fig. 1C). Thus, further experiments were conducted using these cells. In MDA-231 cells, Dorsomorphin suppressed DKK-1 mRNA levels in a dose-dependent fashion (Fig. 1D), which was also highly evident in two osteotropic MDA-231-derived subclones, namely MDA-Bone and MDA-MET cells (Supp. Fig. 1A and B). Of note, significant cytotoxicity was observed at higher Dorsomorphin concentrations in MDA-231 after 48 h exposure to the substance as illustrated by a significant loss of cell vitality (up to 60% compared to controls; p ¼ 0.0001) (Supp. Fig. 1C). Importantly, the suppression of DKK-1 mRNA levels by Dorsomorphin also translated into a prominent reduction of DKK-1 protein secretion by almost 90% (p < 0.0001) (Fig. 2A). Intriguingly, the inhibitory effects of Dorsomorphin on DKK-1 expression were evident as early as 1 h after treating the cells with the molecule and persisted for 24 h (Fig. 2B). To investigate whether the modulation of DKK-1 production by Dorsomorphin was restricted to breast cancer, osteosarcoma cells (SaOS-2) were used. Similarly to our previous findings, Dorsomorphin also significantly inhibited DKK-1 expression in SaOS2 cells, although the observed effects were slightly delayed (Fig. 2C).
3.2. Dorsomorphin regulates DKK-1 independently of AMPKsignaling in breast cancer Previously published data has demonstrated that Dorsomorphin acts by inhibiting AMP Kinase (AMPK)- and bone morphogenic protein (BMP)-signaling [15,16]. Thus, we treated MDA-231 cells with the two AMPK inhibitors C75 and Ara-A to elucidate whether changes in DKK-1 expression could be induced. However, none of the two molecules had an effect on DKK-1 mRNA levels (Fig. 2D and E). In line with this, Dorsomorphininduced suppression of DKK-1 could not be rescued by the two AMPK activators metformin and 5-aminoimidazole-4carboxamide-1-b-D-ribofuranoside (AICAR) (Fig. 2F). 3.3. BMP-signaling is dispensable for DKK-1 suppression by dorsomorphin To elucidate whether the BMP-pathway might be involved in facilitating the effect of Dorsomorphin on DKK-1, we first sough to confirm the molecule’s inhibitory properties on canonical BMPsignaling. In line with previous reports [17], Dorsomorphin effectively abrogated canonical BMP-signaling as demonstrated by abolished BMP-induced SMAD1/5/8 phosphorylation in the presence of the molecule (Fig. 3A). However, stimulation of MDA-231 cells with various BMPs (BMP-2, -4 and -6, respectively) did not yield alterations in DKK-1 mRNA levels (Fig. 3B). Similarly, the highly specific canonical BMP-signaling-inhibitor LDN193189 did not modulate DKK-1 expression in these cells (Supp. Fig. 1D). Moreover, the effect of
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
4
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. Dorsomorphin regulates DKK-1 independently of AMPK in breast cancer (A) DKK-1 protein levels in culture medium of MDA-231 cells after being exposed to 10 mM Dorsomorphin for 24 h assessed by ELISA (B) Time course of DKK-1 mRNA suppression by 10 mM Dorsomorphin in MDA-231 cells. (C) DKK-1 expression in osteosarcoma SaOS-2 cells treated with 10 mM Dorsomorphin (D, E) DKK-1 mRNA levels in MDA-231 cells after being exposed to the two AMPK inhibitors C75 and Ara-A, respectively, for 24 h. Both substances were used at a final concentration of 100 mM (F) DKK-1 expression in MDA-231 cells after being treated with 10 mM Dorsomorphin in the presence or absence of the two AMPK activators metformin (5 mM) and AICAR (0,25 mM) for 6 h. Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to two-tailed, unpaired student’s t-test and one-way ANOVA followed by Dunnett’s post-hoc test, respectively.
Fig. 3. BMP-signaling is dispensable for DKK-1 suppression by Dorsomorphin. (A) Canonical BMP-signaling in MCF7 cells evaluated by immunoblot analysis in the presence or absence of 10 mM Dorsomorphin (B) DKK-1 expression in MDA-231 cells treated with 200 ng/ml of various BMPs for 24 h. (C) Levels of DKK-1 mRNA after co-incubating MDA-231 cells with BMP4 (200 ng/ml) and Dorsomorphin (10 mM) or either substance alone (D, E) DKK-1 expression in MCF7 and SaOS-2 cells after being exposed to different BMPs (each at 200 ng/ml). Bar graphs show the mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 according to one-way ANOVA followed by Dunnett’s or Sidak’s post-hoc test, respectively.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Dorsomorphin on DKK-1 mRNA levels could not be rescued by the presence of BMP4 (Fig. 3C). In contrast, DKK-1 expression was strongly induced by BMP-4 in MCF7 breast cancer cells (Fig. 3D). Additionally, BMP-4, as well as BMP-6 promoted DKK-1 production in SaOS-2 osteosarcoma cells (Fig. 3E) suggesting that BMPs exert differential effects on DKK-1 depending on the subtype of cancer cell lines used. 4. Discussion Effective pharmacological approaches for treating malignant bone disease are desperately needed. Accumulating evidence has implied that overexpression of DKK-1 is causally involved in the formation and progression of osteolytic bone metastases, not only in breast cancer, but also in multiple myeloma [9,18,19]. As such, interfering with DKK-1 production and/or secretion in these cells might represent a promising strategy for treating bone metastases. Using an unbiased approach, we identified Dorsomorphin as a novel pharmacological inhibitor of DKK-1 production in multiple breast cancer cells lines. Intriguingly, the suppressive effects of Dorsomorphin on DKK-1 were evident as early as 1 h after challenging the cells with the substance pointing towards rapid genomic or potentially nongenomic regulatory mechanisms (e.g. mRNA degradation). Notably, DKK-1 inhibition by Dorsomorphin was not limited to breast cancer cells but also observable in osteosarcoma cells, suggesting that the molecule acts broadly against DKK-1. Previously published data has shown that Dorsomorphin interferes with AMPK- signaling [20]. In the current study, neither inhibition, nor activation of AMPK altered DKK-1 expression arguing against a prominent role of this pathway in facilitating Dorsomorphin’s effects on DKK-1. Besides AMPK, BMP receptors are well-established targets of Dorsomorphin. In fact, inhibition of BMP-signaling by Dorsomorphin reverses the mesenchymal phenotype of cancer-initiating cells, thereby reducing tumor cell motility, growth and invasiveness [21]. In our experiments, we confirmed the potent inhibitory effects of Dorsomorphin on canonical BMP-signaling but did not find evidence for an involvement of this pathway in facilitating the suppressive effects of Dorsomorphin on DKK-1. Collectively, these results imply that both AMPK- and BMPsignaling are dispensable for Dorsomorphin’s suppressive effects on DKK-1 in breast cancer. Importantly, Dorsomorphin appears to interact with a wide range of different kinases [22,23]. In fact, one study found that the activity of 64 (out of 119 tested) protein kinases was strongly modulated in the presence of 10 mM Dorsomorphin [24]. As such, the precise mechanisms how Dorsomorphin affects DKK-1 remain to be deciphered. Yet, the potent and rapid inhibitory effects of the substance on DKK-1 mRNA and protein abundance renders Dorsomorphin a promising agent for modulating DKK-1 biology in breast cancer. It is also worth noting that prolonged Dorsomorphin exposure (48 h) caused significant cytotoxicity at higher concentrations, an effect that may add anti-tumor potential to its clinical use but could also be associated with adverse events. To date, no clinical trials with Dorsomorphin have been conducted. As such, the question whether Dorsomorphin also elicits cytotoxicity in humans and whether such effects are restricted to tumor cells or not remains to be elucidated. In conclusion, we identified Dorsomorphin as a novel inhibitor of DKK-1 production in breast cancer cells. Neither AMPK-, nor BMP-signaling are essentially involved in facilitating Dorsomorphin’s strong suppressive effects on DKK-1.
5
Future studies investigating the effects of Dorsomorphin on breast cancer metabolism and survival using specific in vivo models of primary and bone-metastatic breast cancer are warranted. Author contribution Study Design: AG and TDR. Study conduct: AG and NJ. Data collection: AG, and NJ. Data analysis: NJ, AG, AK and TDR. Data interpretation: NJ, AG and TDR. Drafting Manuscript: NJ, AG, AK and TDR. Revising manuscript content: NJ, AG, AK, LCH and TDR. Approving final version of manuscript: NJ, AG, AK, LCH, and TDR. TDR takes responsibility for the integrity of the data analysis. Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: The authors have received grants or honorarium for advisory boards or lectures to the individual or the institution by Amgen (LCH, TDR), and UCB (LCH, TDR). AG, AK and NJ declare no conflict of interest. Acknowledgments € tzel for her excellent The authors would like to thank Josefa Ho technical assistance and Ms. Theresa Reiche for her secretarial assistance. The work was funded by the Deutsche Forschungsgemeinschaft to AG (GO 3055/1-1), TDR (RA 2151/3-1, and 4-1), and to LCH (HO 1875/15-1 and 16-1) as part of the DFG Research group SKELMET and the Schwerpunktprogramm-2084 mBone. Further funding was provided by the German Academic Exchange Service (Deutscher Akademischer Austauschdienst) to NJ. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2020.01.106. References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, Ca - Cancer J. Clin. 69 (2019) 7e34, https://doi.org/10.3322/caac.21551, 2019. [2] L.C. Hofbauer, T.D. Rachner, R.E. Coleman, F. Jakob, Endocrine aspects of bone metastases, Lancet Diabetes Endocrinol. 2 (2014) 500e512, https://doi.org/ 10.1016/S2213-8587(13)70203-1. [3] N. Brook, E. Brook, A. Dharmarajan, C.R. Dass, A. Chan, Breast cancer bone metastases: pathogenesis and therapeutic targets, Int. J. Biochem. Cell Biol. 96 (2018) 63e78, https://doi.org/10.1016/j.biocel.2018.01.003. €bel, P. Benad-Mehner, L.C. Hofbauer, M. Rauner, Dickkopf-1 [4] T.D. Rachner, A. Go as a mediator and novel target in malignant bone disease, Canc. Lett. 346 (2014) 172e177, https://doi.org/10.1016/j.canlet.2014.01.010. [5] D. Diarra, M. Stolina, K. Polzer, J. Zwerina, M.S. Ominsky, D. Dwyer, A. Korb, J. Smolen, M. Hoffmann, C. Scheinecker, D. van der Heide, R. Landewe, D. Lacey, W.G. Richards, G. Schett, Dickkopf-1 is a master regulator of joint remodeling, Nat. Med. 13 (2007) 156e163, https://doi.org/10.1038/nm1538. [6] Y. Huang, L. Liu, A. Liu, Dickkopf-1: current knowledge and related diseases, Life Sci. 209 (2018) 249e254, https://doi.org/10.1016/j.lfs.2018.08.019. [7] N. Voorzanger-Rousselot, F. Journe, V. Doriath, J.J. Body, P. Garnero, Assessment of circulating Dickkopf-1 with a new two-site immunoassay in healthy subjects and women with breast cancer and bone metastases, Calcif. Tissue Int. 84 (2009) 348e354, https://doi.org/10.1007/s00223-009-9225-y. [8] S.J. Zhou, S.R. Zhuo, X.Q. Yang, C.X. Qin, Z.L. Wang, Serum Dickkopf-1 expression level positively correlates with a poor prognosis in breast cancer, Diagn. Pathol. 9 (2014) 161, https://doi.org/10.1186/s13000-014-0161-4. [9] N. Voorzanger-Rousselot, D. Goehrig, F. Journe, V. Doriath, J.J. Body, zardin, P. Garnero, Increased Dickkopf-1 expression in breast cancer P. Cle bone metastases, Br. J. Canc. 97 (2007) 964e970, https://doi.org/10.1038/ sj.bjc.6603959. [10] J.J. Pinzone, B.M. Hall, N.K. Thudi, M. Vonau, Y.W. Qiang, T.J. Rosol, J.D. Shaughnessy, The role of Dickkopf-1 in bone development, homeostasis, and disease, Blood 113 (2009) 517e525, https://doi.org/10.1182/blood-200803-145169.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106
6
N. Jaschke et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
€ bel, S. Thiele, M. Rauner, P. Benad-Mehner, P. Hadji, [11] T.D. Rachner, A. Go T. Bauer, M.H. Muders, G.B. Baretton, F. Jakob, R. Ebert, M. Bornh€ auser, C. Schem, L.C. Hofbauer, Dickkopf-1 is regulated by the mevalonate pathway in breast cancer, Breast Cancer Res. 16 (2014) R20, https://doi.org/10.1186/ bcr3616. €bel, A. Browne, J. Ho € tzel, M. Rauner, L.C. Hofbauer, P38 [12] T.D. Rachner, A. Go regulates the Wnt inhibitor Dickkopf-1 in breast cancer, Biochem. Biophys. Res. Commun. 466 (2015) 728e732, https://doi.org/10.1016/ j.bbrc.2015.09.101. €bel, M. Rauner, P. Benad-Mehner, N. Schütze, S. Füssel, P. Hadji, [13] M. Wilke, A. Go L.C. Hofbauer, T.D. Rachner, Zoledronic acid and atorvastatin inhibit avb3mediated adhesion of breast cancer cells, J. Bone Oncol. 3 (2014) 10e17, https://doi.org/10.1016/j.jbo.2014.02.001. €bel, T.D. Rachner, S. Fuessel, M. Froehner, M.H. Muders, [14] S. Thiele, A. Go €user, M. Rauner, G.B. Baretton, R. Bernhardt, F. Jakob, C.C. Glüer, M. Bornha L.C. Hofbauer, WNT5A has anti-prostate cancer effects in vitro and reduces tumor growth in the skeleton in vivo, J. Bone Miner. Res. 30 (2015) 471e480, https://doi.org/10.1002/jbmr.2362. [15] A. Isakovic, L. Harhaji, D. Stevanovic, Z. Markovic, M. Sumarac-Dumanovic, V. Starcevic, D. Micic, V. Trajkovic, Dual antiglioma action of metformin: cell cycle arrest and mitochondria-dependent apoptosis, Cell. Mol. Life Sci. 64 (2007) 1290e1302, https://doi.org/10.1007/s00018-007-7080-4. [16] J.H. Boergermann, J. Kopf, P.B. Yu, P. Knaus, Dorsomorphin and LDN-193189 inhibit BMP-mediated Smad, p38 and Akt signalling in C2C12 cells, Int. J. Biochem. Cell Biol. 42 (2010) 1802e1807, https://doi.org/10.1016/ j.biocel.2010.07.018. [17] P.B. Yu, C.C. Hong, C. Sachidanandan, J.L. Babitt, D.Y. Deng, S.A. Hoyng, H.Y. Lin, K.D. Bloch, R.T. Peterson, Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism, Nat. Chem. Biol. 4 (2008) 33e41, https://
doi.org/10.1038/nchembio.2007.54. [18] M. Kaiser, M. Mieth, P. Liebisch, R. Oberl€ ander, J. Rademacher, C. Jakob, L. Kleeberg, C. Fleissner, E. Braendle, M. Peters, D. Stover, O. Sezer, U. Heider, Serum concentrations of DKK-1 correlate with the extent of bone disease in patients with multiple myeloma, Eur. J. Haematol. 80 (2008) 490e494, https://doi.org/10.1111/j.1600-0609.2008.01065.x. [19] E. Tian, F. Zhan, R. Walker, E. Rasmussen, Y. Ma, B. Barlogie, J.D. Shaughnessy, The role of the Wnt-signaling antagonist DKK1 in the development of osteolytic lesions in multiple myeloma, N. Engl. J. Med. 349 (2003) 2483e2494, https://doi.org/10.1056/NEJMoa030847. ~ arís, AMPK [20] M. Ríos, M. Foretz, B. Viollet, A. Prieto, M. Fraga, J.A. Costoya, R. Sen activation by oncogenesis is required to maintain cancer cell proliferation in astrocytic tumors, Canc. Res. 73 (2013) 2628e2638, https://doi.org/10.1158/ 0008-5472.CAN-12-0861. [21] C. Garulli, C. Kalogris, L. Pietrella, C. Bartolacci, C. Andreani, M. Falconi, C. Marchini, A. Amici, Dorsomorphin reverses the mesenchymal phenotype of breast cancer initiating cells by inhibition of bone morphogenetic protein signaling, Cell. Signal. 26 (2014) 352e362, https://doi.org/10.1016/ j.cellsig.2013.11.022. [22] X. Liu, R.R. Chhipa, I. Nakano, B. Dasgupta, The AMPK inhibitor compound C is a potent AMPK-independent antiglioma agent, Mol. Canc. Therapeut. 13 (2014) 596e605, https://doi.org/10.1158/1535-7163.MCT-13-0579. [23] B. Dasgupta, W. Seibel, Compound C/Dorsomorphin: its use and misuse as an AMPK inhibitor, Methods Mol. Biol. 1732 (2018) 195e202, https://doi.org/ 10.1007/978-1-4939-7598-3_12. [24] J. Vogt, R. Traynor, G.P. Sapkota, The specificities of small molecule inhibitors of the TGFß and BMP pathways, Cell. Signal. 23 (2011) 1831e1842, https:// doi.org/10.1016/j.cellsig.2011.06.019.
Please cite this article as: N. Jaschke et al., Dorsomorphin: A novel inhibitor of Dickkopf-1 in breast cancer, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.106