Down-regulation of brain nuclear factor-kappa B pathway in the cyclooxygenase-2 knockout mouse

Molecular Brain Research 139 (2005) 217 – 224 www.elsevier.com/locate/molbrainres

Research Report

Down-regulation of brain nuclear factor-kappa B pathway in the cyclooxygenase-2 knockout mouse Jagadeesh S. Raoa,*, Robert Langenbachb, Francesca Bosettia a

Brain Physiology and Metabolism Section, National Institute on Aging, National Institutes of Health, 9000 Rockville Pike, Building 9, Room 1S 128, Bethesda, MD 20892, USA b National Institute of Environmental Health Sciences Laboratory of Experimental Carcinogenesis and Mutagenesis, Research Triangle Park, NC 27709, USA Accepted 12 May 2005 Available online 1 August 2005

Abstract Cyclooxygenase (COX) is the rate-limiting enzyme in the synthesis of prostaglandins (PGs) from arachidonic acid. Evidence suggests that neuronal COX-2 gene expression is mainly regulated by the transcription factor nuclear factor kappa-B (NF-nB). The present study was undertaken to determine whether there is a shared regulation of NF-nB or of nuclear factor of activated T-cells cytoplasmic (NFATc) with COX-2 and whether these transcription factors known to regulate COX-2 expression are altered in brain from COX-2 knockout (COX-2 / ) mice compared to wild type. We found a decrease in NF-nB DNA – protein binding activity, which was accompanied by a reduction of the phosphorylation state of both I-nB a and p65 proteins in the COX-2 / mice. The mRNA and protein levels of p65 were also reduced in COX-2 / mice, whereas total cytoplasmic I-nB protein level was not significantly changed. Taken together, these changes may be responsible for the observed decrease in NF-nB DNA binding activity. NF-nB DNA binding activity was selectively affected in the COX-2 / mice compared to the wild type as there was no significant change in NFATc DNA binding activity. Overall, our data indicate that constitutive brain NF-nB activity is decreased in COX-2 deficient mice and suggest a reciprocal coupling between NF-nB and COX-2. Published by Elsevier B.V. Theme: Disorders of the nervous system Topic: Genetic models Keywords: NF-nB; p65; Phospho p65; p50; Phospho I-nBa; COX-2 KO

1. Introduction Cyclooxygenase (COX) is the rate-limiting enzyme in the synthesis of prostaglandins (PGs) from arachidonic acid. Of the two COX isoenzymes, COX-1 and COX-2, COX-1 is usually constitutively expressed, whereas COX-2 is inducible upon different stimuli, mainly inflammatory [39]. However, brain and spinal cord express relatively high basal levels of COX-2, which is thought to play a role in fundamental brain functions, such as synaptic activity, synaptic remodeling, memory consolidation, and functional hyperemia [1,29,43].

* Corresponding author. Fax: +1 301 402 0074. E-mail address: [email protected] (J.S. Rao). 0169-328X/$ - see front matter. Published by Elsevier B.V. doi:10.1016/j.molbrainres.2005.05.008

Evidence from different cell lines indicates that inducible COX-2 gene expression is regulated by the nuclear factorkappa B (NF-nB) [15,31]. The role of NF-nB in COX-2 expression is confirmed by the presence of at least two sites for NF-nB binding in the proximal promoter region of COX2 gene of mouse, rat, and human [21,25,32]. NF-nB is a homo- or heterodimer of proteins, belonging to the NF-nB/Rel family, which contains five subunits identified in mammalian cells: RelA or p65, RelB, c-rel, p50, and p52 [20,42]. In contrast to p50, p52, and p65, which are ubiquitous, RelB and c-rel are restricted mainly to the lymphoid tissues [11]. The heterodimer p50/p65, considered the prototype of the NF-nB factors, is the most prominent [20,42], and it is selectively localized at synapses, where it is likely playing a role in signaling

218

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

mechanisms. Long-term changes to adult neuronal function caused by synaptic stimulation can be regulated by NF-nB nuclear translocation and gene activation [27]. Indeed, mice lacking NF-nB subunits p50 or p65 show deficits in specific cognitive tasks [19]. Activation and nuclear translocation of NF-nB can be mediated by multiple stimuli, including tumor necrosis factor-a [7], bacterial lipopolysaccharide, nitric oxide, and oxidative stress [2,38]. These stimuli trigger the activation of an I-nB kinase (IKK) complex, which in turn phosphorylates specific serines within the InBs, leading to their ubiquitination and proteosomal degradation. Active NF-nB then translocates to the nucleus and binds DNA consensus sequences in the promoter regions of target genes, promoting their transcription [42]. Constitutive COX-2 activity in neurons has been reported to be dependent on the DNA binding activity of NF-nB [17]. It is well documented that basal NF-nB activity is spontaneously activated by basal synaptic neurotransmission and is involved in hippocampal synaptic plasticity [16]. Several physiological signals have been shown to mobilize intracellular Ca2+ and activate NF-nB [36,40,41], contributing to a growing number of reports involving Ca2+ as a second messenger necessary for the induction of NF-nB [23]. Additionally, studies have documented NF-nB activation in brain tissues in rodent models of pathological conditions such as stroke, traumatic shock, transient global or focal ischemia, and seizure [4,6,37,45,47]. A relationship between the extent of NF-nB DNA binding and the abundance of the COX-2 mRNA signal has been described in both normally aging brain and in Alzheimer’s disease-affected neocortex [25], suggesting that the increase in NF-nB DNA binding may play a central role in driving transcription of the inflammationrelated gene COX-2 in inflamed tissues. Additionally, increase in NF-nB DNA binding immediately precedes the up-regulation of COX-2 gene transcription induced by IL-1h or PAF in different cell lines [25,32]. The NF-nB pathway not only is involved in the stimulus-induced up-regulation of COX-2, but also in its down-regulation by anti-inflammatory drugs and curcumin [5,33]. Thus, NF-nB activity plays role in both physiological and pathological conditions. COX-2 knockout (COX-2 / ) mice show increased resistance to ischemic injury induced by transient middle cerebral artery occlusion and to 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine (MPTP)-induced neurotoxicity [8,13], conditions that involve an activation of the NF-nB pathway. The involvement of NF-nB in the constitutive over expression of COX-2 has also been shown in COX-1 null immortalized cells, where activated NF-nB levels were proportional to constitutive levels of COX-2 promoter activity [18]. The mechanisms and consequences of NF-nB activation in the CNS and in its physiological involvement in specialized signaling from the synapse to the nucleus still remain largely unknown [27]. Based on the evidence of a correlation between the expression of NF-nB and COX-2, we thought it of interest to examine whether the absence of COX2 gene would affect the expression and binding activity of its

putative transcriptional regulator, NF-nB in brain tissue from COX-2 / and wild-type mice. We also examined the binding activity of another transcription factor, nuclear factor of activated T-cells (NFATc), which contributes to the control of COX-2 gene expression in human T lymphocytes [14] to see whether COX-2 deficiency was selectively affecting the NF-nB pathway. Specific NFAT family members are expressed in the brain [34], where they are implicated in brain development and function, as well as in hippocampal synaptic plasticity and memory [34].

2. Materials and methods 2.1. Animals The study conformed to the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 80-23). Threemonth-old wild-type and COX-2 / mice (Taconic, Germantown, NY), which have been maintained on a C57Bl/6129/Ola background for 30 generations [30], were used in this study. The mice were acclimated for 1 week in our animal facility, in which temperature, humidity, and light cycle are controlled, and had free access to food and water. Mice were killed with an overdose of sodium pentobarbital (100 mg/kg, i.p.). Brains were rapidly excised, frozen in 50 -C 2-methylbutane, and stored at 80 -C until use. 2.2. Preparation of cytosolic and nuclear extracts Nuclear extracts were prepared from the whole brain of wild-type and COX-2 / mice as described [22]. Briefly, tissue was homogenized in 10 mM HEPES pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 10 mM KCl buffer with a cocktail of protease inhibitors (Roche, Indianapolis, IN) using a Teflon-glass homogenizer. After the addition of 0.5% NP-40, five additional strokes of homogenization were performed. The suspension was incubated for 10 min on ice and then centrifuged in a microcentrifuge at 12,900  g for 1 min at 4 -C. The supernatant contained mostly cytoplasmic constituents. To the nuclear pellet, solution B (20 mM HEPES pH 7.9, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.4 M NaCl) (Applied Biosystems, Foster City, CA) with a cocktail of protease inhibitors was added. Tubes were mixed, placed on a rotatory shaker for 30 min, and then centrifuged at 12,900  g for 3 min at 4 -C. The supernatant containing the proteins from the nuclear extracts was removed and transferred to a fresh tube. The protein concentration of cytoplasmic and nuclear extracts was determined using Bio-Rad protein Reagent (Bio-Rad, Hercules, CA). 2.3. Electrophoretic mobility shift assay (EMSA) Gelshift assay was performed with 10 Ag of nuclear extracts, incubated in the presence and absence of nonradioactive (10 ng) biotin labeled DNA oligo consensus

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

(Panomics, Redwood city, CA) in gelshift assay buffer (10 mM Tris –HCl, pH 7.5, 1 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 4% glycerol and 50 Ag/ml poly dI:dC) for 30 min on ice. DNA – protein complexes were separated on 5% TBE gel and electrophoretically transferred to a nylon membrane. Biotin labeled oligonucleotide complexes were visualized using a streptavidin – horseradish peroxidase conjugate coupled with chemiluminescence reaction on X-ray films (Kodak, Rochester, NY). The following oligonucleotides sequences were used: NFnB—AGTTGAGGGGACTTTCCCGGC and NFATc— ACGCCCAAAGAGGAAAATTTGTTTCATACA. The specificity of the NF-nB and NFATc transcriptional factors was determined by using an excess amount (100 times) of unlabeled NF-nB and NFATc probes with fixed amount of biotin labeled DNA oligo consensus (10 ng) and nuclear extracts (10 Ag). For the supershift assay, nuclear extracts (15Ag) were preincubated with antibodies (1Ag) for p50 or p65 (Cell Signaling, Beverly, MA) or p52 (Santa Cruz, Santa Cruz, CA) for 60 min at 4 -C. Then, the gelshift assay was performed as described above. All the gelshift assay experiments were carried out twice with 6 animals in each group. Optical densities of gelshift bands were quantified using Alpha Innotech software (Alpha Innotech, San Leandro, CA). Values were expressed as a percent of control.

219

was measured by quantitative real time RT-PCR, using ABI PRISM 7000 sequence detection system (Applied Biosystems) using specific primers and probe for p65 from the available Assays-on-Demand (Applied Biosystems), consisting of a 20 mix of unlabeled PCR primers and Taqman minor groove binder (MGB) probe (FAM dyelabeled). To normalize the amount of cDNA present in each reaction, we used phosphoglyceratekinase 1 (pgk1) as the endogenous control. Appropriate no-template controls were run on each plate in triplicate. The thermal cycling conditions were set at 50 -C for 2 min and 95 -C for 10 min followed by 15 s at 95 -C (melting step) and 1 min at 60 -C (annealing/extending step) for 40 cycles. The fluorescence in each well was monitored throughout 40 cycles of amplification, as reported [3]. Data were analyzed using sequence detection systems software (Applied Biosystems). A threshold value was placed in the exponential phase of the amplification plot, where the levels of fluorescence were increasing linearly. Data were analyzed using the relative quantification technique [24]. Results were expressed as relative levels of target gene in the COX-2 / , compared to wild-type samples (the calibrator). The amount of target gene normalized to the endogenous control (pgk1) and relative to the wild-type was calculated using the DDCT method [3,9,24].

2.4. Western blotting 2.6. Statistical analysis Sixty micrograms of cellular and nuclear extracts were separated on 10% SDS-polyacrylamide gels (Bio-Rad). Following SDS-PAGE, proteins were electrophoretically transferred to a nitrocellulose membrane. After overnight blocking in PBS containing 5% non-fat dried milk and 0.1% Tween-20, blots were incubated overnight with specific 1:1000 primary antibodies (Cell Signaling) for NF-nB p65, NF-nB p50, phospho NF-nB p65, I-nBa, or phospho I-nBa followed by a secondary antibody conjugated with horseradish peroxidase (Bio-Rad). Immunoblots were visualized using a chemiluminescence reaction (Amersham, Piscataway, NJ) on X-ray films (XAR-5, Kodak). All the experiments were carried out twice with six independent samples. Optical densities were normalized to h-actin (Sigma, St. Louis, MO) to correct for possible unequal loading. Values were expressed as percent of control. 2.5. Total RNA isolation and real time RT-PCR Brain total RNA was isolated using RNeasy mini kit for brain and lipid tissue (Qiagen Valencia, CA). cDNA was prepared from 5 Ag of total RNA using high capacity cDNA Archive kit (Applied Biosystems, Foster city, CA). Five micrograms of RNA sample was incubated similarly in the absence of reverse transcriptase to ensure that PCR products resulted from amplification from the specific mRNA rather than from genomic DNA contamination. Brain p65 gene expression in wild type and COX-2 /

Data are expressed as mean T SEM. Statistical significance was calculated using two tailed unpaired t test and set as P < 0.05.

3. Results 3.1. NF-jB DNA binding To determine whether NF-nB DNA binding activity was changed in COX-2 / mice, we measured NF-nB DNA binding activity in the whole brain nuclear extracts of wild-type and COX-2 / mice by EMSA. The specificity of the NF-nB DNA binding was confirmed by the absence of a band in the presence of an excess amount of unlabeled NF-nB probe (Fig. 1A). We found a 30% decrease in the NF-nB DNA binding activity in COX-2 / mice compared to the wild-type mice (70.0 T 6.0% vs. 100.0 T 9.0%; n = 6, P < 0.01) (Fig. 1B). To determine whether the effect was selective for NF-nB, we examined the DNA binding activity of NFATc in brain extracts from wild-type and COX-2 / mice. There was no significant change in the NFATc transcriptional factor in COX-2 / compared to wild-type mice (Figs. 1A, B), suggesting that the NF-nB pathway is selectively altered in brain from COX-2 / mice. The specificities of the NF-nB and NFATc probe were tested by showing that an excess of

220

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

Fig. 1. NF-nB and NFATc DNA binding activities in wild-type (WT) and COX-2 / (KO) mice. (A) Typical gelshift bands for NF-nB and NFATc DNA binding activities. DNA binding activities were determined in 10 Ag of brain nuclear extracts in the presence of NF-nB or NFATc (10 ng) DNA oligonucleotides consensus. DNA – protein complexes were electrophoretically transferred to a nylon membrane and identified using a HRP-linked chemiluminescent method. Competition studies were carried out in brain nuclear extracts in the absence ( ) and in the presence (+) of 100-fold excess of unlabeled NF-nB and NFATc oligonucleotides and biotin-labeled NF-nB and NFATc. The presence of either p50 or p65 antibody retarded the shift of the band, compared to the absence of antibody, indicating the presence of p50/p65 proteins in the complex. (B) DNA binding activities in COX-2 KO expressed as percent of controls. Data are mean T SEM of 6 independent samples and are expressed as percent of controls; **P < 0.01.

unlabeled NF-nB or NFATc (+) consensus blocked the binding of labeled NF-nB and NFATc to the nuclear factors compared to the absence ( ) of labeled oligonucleotides (Fig. 1A). No band was detected in the absence of either oligo consensus in the gelshift assay (data not shown). The presence of either p50 or p65 antibody retarded the shift of the band, compared to the absence of antibody, indicating the presence of p50/p65 proteins in the complex (Fig. 1A). In the presence of the antibody for p52, no shifting of the band was observed, indicating that p52 complexes were not present (data not shown).

3.2. Immunolabeling of phosphorylated I-jBa and p65 Since the phosphorylation of I-nBa and p65 by IKK a and h represents a critical step in activating the NF-nB DNA binding activity, we measured the phosphorylation state of InBa and p65 in nuclear and cytoplasmic extracts. As shown in Fig. 2A, protein level of phosphorylated cytoplasmic InBa protein was decreased in COX-2 / compared to the wild-type mice (37.2 T 11.4% vs. 100.0 T 20.5%, n = 6; P < 0.05). In contrast, there was no significant change in the levels of total cytoplasmic I-nBa in COX-2 / mice

Fig. 2. (A) Brain phospho I-nB alpha protein level in the cytosolic fraction from wild-type (WT) and COX-2 KO mice. Protein samples (60 Ag) were subjected to 10% polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane, and then incubated with a specific phospho I-nB alpha primary antibody. The membranes were stripped and then reprobed with h-actin antibody. Data are expressed as mean T SEM of 6 independent samples; *P < 0.05. (B) Brain protein levels of phospho p65 subunit of NF-nB in cytosolic and nuclear fractions from wild-type (WT) and COX-2 KO mice. Data are ratios of phospho-p65 to h-actin optical densities. Protein samples (60 Ag) were separated on 10% polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane, and then incubated with specific phospho-p65 primary antibody. The membranes were stripped and reprobed with h-actin. Data are expressed as mean T SEM (n = 6 for cytosolic fraction, n = 5 for nuclear fractions. *P < 0.05, **P < 0.01).

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

compared to the wild-type mice (95.0 T 18.0% vs. 100.0 T 11.0%, n = 6). Additionally, we found a decrease in both cytoplasmic (64.0 T 8.3% vs. 100 T 9.5%; n = 6; P < 0.01) and nuclear levels of phosphorylated p65 subunit (66.4 T 6.7% vs. 100.0 T 12.6%; n = 5; P < 0.05) (Fig. 2B) in the COX-2 / mice. 3.3. Expression of p65 and p50 To see whether the down-regulation of NF-nB was accompanied by a decrease in the expression of its subunits p50 or p65, we measured the protein levels of p65 (65 kDa) and p50 (50 kDa) in the cytoplasmic and nuclear extracts. Immunoblotting indicated that p65 protein level was decreased both in the cytoplasmic (61.2 T 10.3% vs. 100.0 T 11.7% n = 6, P < 0.05) and in the nuclear extracts (67.4 T 9.6% vs. 100.2 T 8.2%, n = 5; P < 0.05) (Fig. 3A) of COX2 / mice. In contrast, there was no significant change in the levels of p50 in either the cytoplasmic (67.7 T 8.4% vs. 100.2 T 13.9%; n = 6) or nuclear extracts (88.7 T 14.6% vs. 100.2 T 17.8%; n = 6). To further examine if the decrease in brain p65 protein level in the COX-2 / mice was due to a change in its gene expression, the mRNA level of p65 was determined using real time RT-PCR. As shown in Fig. 3B, we found a 50% decrease in the p65 mRNA level relative to the endogenous control gene pgk1 in the COX-2 / compared to the wildtype mice (n = 5; P < 0.05).

4. Discussion Although NF-nB DNA binding activity has been related to basal neuronal COX-2 activity [17], how COX-2 activity can affect NF-nB pathway and their shared regulation under

221

basal conditions in the brain has not been fully elucidated. Our study indicates that the NF-nB DNA binding activity was significantly decreased in COX-2 / compared to wildtype mice. This effect was selective for the NF-nB pathway since the binding activity of NFATc was not significantly changed in the COX-2 / mice. We also found a significant decrease in brain protein and mRNA levels of p65, phosphorylated-p65, and phosphorylated-I-nBalevels. In contrast, cytoplasmic and nuclear protein levels of p50 were not significantly changed. We suggest that the above changes may be responsible for the decrease in brain NF-nB activity. A reciprocal coupling between NF-nB and COX-2 is supported by evidence that some drugs that inhibit COX-2 activity can also decrease NF-nB DNA binding activity. Aspirin and salicylate, non-selective COX inhibitors, can inhibit I-nB kinase h and, in turn, alter NF-nB activity [46]. Sulindac, another non-steroidal anti-inflammatory agent that inhibits COX-2, has been shown to inhibit IKKh kinase and to regulate the NF-nB pathway [44]. Overall, these data suggest that drugs targeting COX-2 can modulate the NF-nB pathway, but it remains unclear if the two effects are independent from each other or consequential. Our results from COX-2 / mice suggest that in addition to the well-documented capability of NFnB to regulate COX-2 expression, COX-2 expression also seems to modulate the level of NF-nB DNA binding activity by one or more of the following factors. The reduction of phosphorylated I-nB protein level in the cytosolic fraction of COX-2 / mice might decrease the dissociation of NF-nB–I-nB complex (I-nB/p65/p50) and the translocation of p65 to the nucleus, with a consequent alteration of the NF-nB DNA binding activity. However, the decrease in NF-nB DNA activity also might be due to the down-regulation of p65 protein or gene expression

Fig. 3. (A) Brain protein levels of p65 subunit of NF-nB in cytosolic and nuclear fractions from wild-type (WT) and COX-2 KO mice. Data are ratios of p65 to h-actin optical densities. Protein samples (60 Ag) were separated on 10% polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and then incubated with specific p65 primary antibody. The membranes were stripped and reprobed with h-actin. Data are mean T SEM (n = 6 for cytosolic fraction, n = 5 for nuclear fractions; *P < 0.05). (B) Brain mRNA level of p65 in wild-type (WT) and COX-2 KO mice. p65 mRNA level was measured using real time RT-PCR and normalized to an endogenous reference (pgk1) in the COX-2 / group relative to the wild-type (the calibrator), chosen to represent 1 expression of this gene, using the DDCT method. Each sample was assayed in triplicate in two independent experiments. Data are mean T SEM of 5 independent samples; *P < 0.05.

222

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

and/or phosphorylation. We found that the protein level of phosphorylated p65 was decreased in both cytoplasmic and nuclear extracts from COX-2 / mice. Since the phosphorylation of p65 plays an important role in the transcriptional activation of the NF-nB complex [10,48,49], this decrease may contribute to the observed reduction of NFnB binding activity. Consistent with this observation, a report indicates that mice lacking the IL-1a converting enzyme, which, like COX-2 is a target gene of NF-nB, exhibit a decrease in the phosphorylation of p65, accompanied by decreased NF-nB activity [12]. Similarly, mice deficient in TNF-a, another target gene of NF-nB, exhibit low levels of NF-nB DNA binding activity compared to their wild-type littermates [50]. Our results indicate that COX-2 gene deletion reduces protein and mRNA levels of p65. Although it is not clear how COX-2 deficiency can alter brain p65 gene expression, a report indicates that p65 knockout mice show no stimulated or occult NF-nB binding activity at the synapses [27], thus suggesting that p65 protein is essential for NF-nB activity. Another possible mechanism of down-regulation of NFnB activity may involve prostaglandin E2 (PGE2). PGE2 has been shown to increase during inflammation and to trigger phosphorylation-mediated transactivation of p65, which in turn leads to an increase in NF-nB activity [35]. We have previously reported that brain PGE2 level is decreased in the COX-2 / mice [3]. Although further studies are needed to understand direct interaction of PGE2 with p65 protein, it is possible that the decrease in brain basal PGE2 level can lead to decreased activation of p65 and NF-nB activity via I-nB and p65 phosphorylation. Evidence suggests that regulation of COX-2 expression by NFAT is controlled by two cis-acting elements in the COX-2 promoter region, named distal and proximal NFAT response elements [14]. Our results indicate that brain basal NF-nB activity is decreased, but basal NFATc activity is unchanged in COX-2 / mice, suggesting that NF-nB, but not NFATc, is likely involved in the regulation of constitutive COX-2. This lack of change in brain NFATc activity in COX-2 / mice might be related to tissue- or stimulus-specific events. Further studies are needed to explore the role of NFATc in regulation of COX-2 gene in basal conditions and upon stimulation in different tissues and animal models. Earlier reports have indicated that the activation of COX2 gene transcription is mediated by several cis-acting promoter elements that respond to multiple intracellular signaling pathways. The specific factors involved in the activation of COX-2 gene transcription are cell- and stimulus-dependent [28]. In C6 cells, LPS has been shown to stimulate NF-nB but not activator protein-1, cAMPresponsive element, and glucocorticoid response elementdependent transcription (K. Aoki, T. Yamakuni, K. Nakatani, N. Kondo, H. Oku, K. Ishiguro, and Y. Ohizumi, unpublished data).

In summary, our results suggest that NF-nB not only controls COX-2 / mice transcription, but that, in turn, COX-2 deficiency can also modulate the upstream NF-nB pathway under basal conditions. Since NF-nB nuclear translocation and gene activation can trigger long-term changes to adult neuronal synaptic function, COX-2 / mice may suffer alterations in synaptic transmission. Although behavioral tests have not yet been performed in COX-2 deficient mice, data in the literature indicate that mice lacking NF-nB subunits p50 or p65 show deficits in specific cognitive tasks [19]. In view of the increasing importance that NF-nB may play in a range of disorders involving neuronal degeneration and/or perturbed synaptic function [26], it is crucial to better understand the regulation of the NF-nB/COX-2 pathway under both physiological conditions and pathological activation. Future studies addressing the role of NF-nB in neuroinflammation, neurodegeneration, excitotoxicity, and transient forebrain ischemia in COX-2 deficient mice or using selective COX-2 inhibitors can help to elucidate the physiological role of this important pathway as well as the mechanisms of neuroprotection observed in the COX-2 deficient mice.

Acknowledgments We are grateful to Dr. Stanley I. Rapoport for helpful discussion on the manuscript. This work was supported by the Intramural Research Program of the National Institute on Aging, National Institutes of Health.

References [1] S.B. Appleby, A. Ristimaki, K. Neilson, K. Narko, T. Hla, Structure of the human cyclo-oxygenase-2 gene, J. Biochem. 302 (Pt. 3) (1994) 723 – 727. [2] P.A. Baeuerle, D. Baltimore, Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-kappa B transcription factor, Cell 53 (1988) 211 – 217. [3] F. Bosetti, R. Langenbach, G.R. Weerasinghe, Prostaglandin E2 and microsomal prostaglandin E synthase-2 expression are decreased in the cyclooxygenase-2-deficient mouse brain despite compensatory induction of cyclooxygenase-1 and Ca2+-dependent phospholipase A2, J. Neurochem. 91 (2004) 1389 – 1397. [4] J.E. Carroll, E.F. Howard, D.C. Hess, C.G. Wakade, Q. Chen, C. Cheng, Nuclear factor-kappa B activation during cerebral reperfusion: effect of attenuation with N-acetylcysteine treatment, Brain Res. Mol. Brain Res. 56 (1998) 186 – 191. [5] K.S. Chun, Y.S. Keum, S.S. Han, Y.S. Song, S.H. Kim, Y.J. Surh, Curcumin inhibits phorbol ester-induced expression of cyclooxygenase-2 in mouse skin through suppression of extracellular signalregulated kinase activity and NF-kappaB activation, Carcinogenesis 24 (2003) 1515 – 1524. [6] J.A. Clemens, D.T. Stephenson, E.B. Smalstig, E.P. Dixon, S.P. Little, Global ischemia activates nuclear factor-kappa B in forebrain neurons of rats, Stroke 28 (1997) 1073 – 1080 (discussion 1080 – 1081). [7] E.J. Duh, W.J. Maury, T.M. Folks, A.S. Fauci, A.B. Rabson, Tumor necrosis factor alpha activates human immunodeficiency virus type 1

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

[8]

[9]

[10] [11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20] [21]

[22]

[23] [24]

[25]

[26]

through induction of nuclear factor binding to the NF-kappa B sites in the long terminal repeat, Proc. Natl. Acad. Sci. U. S. A. 86 (1989) 5974 – 5978. Z. Feng, D. Li, P.C. Fung, Z. Pei, D.B. Ramsden, S.L. Ho, COX-2deficient mice are less prone to MPTP-neurotoxicity than wild-type mice, NeuroReport 14 (2003) 1927 – 1929. S. Ghelardoni, Y.A. Tomita, J.M. Bell, S.I. Rapoport, F. Bosetti, Chronic carbamazepine selectively downregulates cytosolic phospholipase A2 expression and cyclooxygenase activity in rat brain, Biol. Psychiatry 56 (2004) 248 – 254. S. Ghosh, M. Karin, Missing pieces in the NF-kappaB puzzle, Cell 109 (2002) S81 – S96 (Suppl.). M. Grilli, J.J. Chiu, M.J. Lenardo, NF-kappa B and Rel: participants in a multiform transcriptional regulatory system, Int. Rev. Cytol. 143 (1993) 1 – 62. F.P. Huang, Z.Q. Wang, D.C. Wu, G.P. Schielke, Y. Sun, G.Y. Yang, Early NFkappaB activation is inhibited during focal cerebral ischemia in interleukin-1beta-converting enzyme deficient mice, J. Neurosci. Res. 73 (2003) 698 – 707. C. Iadecola, K. Niwa, S. Nogawa, X. Zhao, M. Nagayama, E. Araki, S. Morham, M.E. Ross, Reduced susceptibility to ischemic brain injury and N-methyl-d-aspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 1294 – 1299. M.A. Iniguez, S. Martinez-Martinez, C. Punzon, J.M. Redondo, M. Fresno, An essential role of the nuclear factor of activated T cells in the regulation of the expression of the cyclooxygenase-2 gene in human T lymphocytes, J. Biol. Chem. 275 (2000) 23627 – 23635. Y.J. Jung, J.S. Isaacs, S. Lee, J. Trepel, L. Neckers, IL-1beta-mediated up-regulation of HIF-1alpha via an NFkappaB/COX-2 pathway identifies HIF-1 as a critical link between inflammation and oncogenesis, FASEB J. 17 (2003) 2115 – 2117. C. Kaltschmidt, B. Kaltschmidt, H. Neumann, H. Wekerle, P.A. Baeuerle, Constitutive NF-kappa B activity in neurons, Mol. Cell. Biol. 14 (1994) 3981 – 3992. B. Kaltschmidt, R.A. Linker, J. Deng, C. Kaltschmidt, Cyclooxygenase-2 is a neuronal target gene of NF-kappaB, BMC Mol. Biol. 3 (2002) 16. T. Kanekura, S. Goorha, K. Kirtikara, L.R. Ballou, The involvement of NF-kappaB in the constitutive overexpression of cyclooxygenase-2 in cyclooxygenase-1 null cells, Biochim. Biophys. Acta 1542 (2002) 14 – 22. C.A. Kassed, M. Herkenham, NF-kappaB p50-deficient mice show reduced anxiety-like behaviors in tests of exploratory drive and anxiety, Behav. Brain Res. 154 (2004) 577 – 584. E.B. Kopp, S. Ghosh, NF-kappa B and rel proteins in innate immunity, Adv. Immunol. 58 (1995) 1 – 27. T. Kosaka, A. Miyata, H. Ihara, S. Hara, T. Sugimoto, O. Takeda, E. Takahashi, T. Tanabe, Characterization of the human gene (PTGS2) encoding prostaglandin-endoperoxide synthase 2, Eur. J. Biochem. 221 (1994) 889 – 897. D.K. Lahiri, An region upstream of the gene promoter for the betaamyloid precursor protein interacts with proteins from nuclear extracts of the human brain and PC12 cells, Brain Res. Mol. Brain Res. 58 (1998) 112 – 122. A. Lilienbaum, A. Israel, From calcium to NF-kappa B signaling pathways in neurons, Mol. Cell. Biol. 23 (2003) 2680 – 2698. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (2001) 402 – 408. W.J. Lukiw, N.G. Bazan, Strong nuclear factor-kappaB-DNA binding parallels cyclooxygenase-2 gene transcription in aging and in sporadic Alzheimer’s disease superior temporal lobe neocortex, J. Neurosci. Res. 53 (1998) 583 – 592. M.P. Mattson, S. Camandola, NF-kappaB in neuronal plasticity and neurodegenerative disorders, J. Clin. Invest. 107 (2001) 247 – 254.

223

[27] M.K. Meffert, J.M. Chang, B.J. Wiltgen, M.S. Fanselow, D. Baltimore, NF-kappa B functions in synaptic signaling and behavior, Nat. Neurosci. 6 (2003) 1072 – 1078. [28] J.R. Mestre, D.E. Rivadeneira, P.J. Mackrell, M. Duff, P.P. Stapleton, V. Mack-Strong, S. Maddali, G.P. Smyth, T. Tanabe, J.M. Daly, Overlapping CRE and E-box promoter elements can independently regulate COX-2 gene transcription in macrophages, FEBS Lett. 496 (2001) 147 – 151. [29] L. Minghetti, Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases, J. Neuropathol. Exp. Neurol. 63 (2004) 901 – 910. [30] S.G. Morham, R. Langenbach, C.D. Loftin, H.F. Tiano, N. Vouloumanos, J.C. Jennette, J.F. Mahler, K.D. Kluckman, A. Ledford, C.A. Lee, et al., Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse, Cell 83 (1995) 473 – 482. [31] S. Nakao, Y. Ogtata, E. Shimizu, M. Yamazaki, S. Furuyama, H. Sugiya, Tumor necrosis factor alpha (TNF-alpha)-induced prostaglandin E2 release is mediated by the activation of cyclooxygenase-2 (COX-2) transcription via NFkappaB in human gingival fibroblasts, Mol. Cell. Biochem. 238 (2002) 11 – 18. [32] R. Newton, L.M. Kuitert, M. Bergmann, I.M. Adcock, P.J. Barnes, Evidence for involvement of NF-kappaB in the transcriptional control of COX-2 gene expression by IL-1beta, Biochem. Biophys. Res. Commun. 237 (1997) 28 – 32. [33] J. Paik, J.Y. Lee, D. Hwang, Signaling pathways for TNFa-induced COX-2 expression: mediation through MAP kinases and NFkB, and inhibition by certain nonsteroidal anti-inflammatory drugs, Adv. Exp. Med. Biol. 507 (2002) 503 – 508. [34] S. Plyte, M. Boncristiano, E. Fattori, F. Galvagni, S.R. Paccani, M.B. Majolini, S. Oliviero, G. Ciliberto, J.L. Telford, C.T. Baldari, Identification and characterization of a novel nuclear factor of activated T-cells-1 isoform expressed in mouse brain, J. Biol. Chem. 276 (2001) 14350 – 14358. [35] B. Poligone, A.S. Baldwin, Positive and negative regulation of NFkappaB by COX-2: roles of different prostaglandins, J. Biol. Chem. 276 (2001) 38658 – 38664. [36] K.L. Quinlan, S.M. Naik, G. Cannon, C.A. Armstrong, N.W. Bunnett, J.C. Ansel, S.W. Caughman, Substance P activates coincident NF-ATand NF-kappa B-dependent adhesion molecule gene expression in microvascular endothelial cells through intracellular calcium mobilization, J. Immunol. 163 (1999) 5656 – 5665. [37] A. Salminen, P.K. Liu, C.Y. Hsu, Alteration of transcription factor binding activities in the ischemic rat brain, Biochem. Biophys. Res. Commun. 212 (1995) 939 – 944. [38] R. Schreck, P. Rieber, P.A. Baeuerle, Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1, EMBO J. 10 (1991) 2247 – 2258. [39] K. Seibert, J. Masferrer, Y. Zhang, S. Gregory, G. Olson, S. Hauser, K. Leahy, W. Perkins, P. Isakson, Mediation of inflammation by cyclooxygenase-2, Agents Actions Suppl. 46 (1995) 41 – 50. [40] V.A. Shatrov, V. Lehmann, S. Chouaib, Sphingosine-1-phosphate mobilizes intracellular calcium and activates transcription factor NFkappa B in U937 cells, Biochem. Biophys. Res. Commun. 234 (1997) 121 – 124. [41] L. Sun, G. Carpenter, Epidermal growth factor activation of NFkappaB is mediated through IkappaBalpha degradation and intracellular free calcium, Oncogene 16 (1998) 2095 – 2102. [42] I.M. Verma, J.K. Stevenson, E.M. Schwarz, D. Van Antwerp, S. Miyamoto, Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation, Genes Dev. 9 (1995) 2723 – 2735. [43] K. Yamagata, K.I. Andreasson, W.E. Kaufmann, C.A. Barnes, P.F. Worley, Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids, Neuron 11 (1993) 371 – 386. [44] Y. Yamamoto, M.J. Yin, K.M. Lin, R.B. Gaynor, Sulindac inhibits activation of the NF-kappaB pathway, J. Biol. Chem. 274 (1999) 27307 – 27314.

224

J.S. Rao et al. / Molecular Brain Research 139 (2005) 217 – 224

[45] K. Yang, X.S. Mu, R.L. Hayes, Increased cortical nuclear factor-kappa B (NF-kappa B) DNA binding activity after traumatic brain injury in rats, Neurosci. Lett. 197 (1995) 101 – 104. [46] M.J. Yin, Y. Yamamoto, R.B. Gaynor, The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta, Nature 396 (1998) 77 – 80. [47] S. Zhang, T. Tobaru, J.A. Zivin, D.A. Shackelford, Activation of nuclear factor-kappaB in the rabbit spinal cord following ischemia and reperfusion, Brain Res. Mol. Brain Res. 63 (1998) 121 – 132.

[48] H. Zhong, R.E. Voll, S. Ghosh, Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300, Mol. Cell 1 (1998) 661 – 671. [49] H. Zhong, M.J. May, E. Jimi, S. Ghosh, The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1, Mol. Cell 9 (2002) 625 – 636. [50] M.A. Zimmerman, C.H. Selzman, L.L. Reznikov, S.A. Miller, C.D. Raeburn, J. Emmick, X. Meng, A.H. Harken, Lack of TNF-alpha attenuates intimal hyperplasia after mouse carotid artery injury, Am. J. Physiol.: Regul., Integr. Comp. Physiol. 283 (2002) R505 – R512.