Down-regulation of CT120A by RNA interference suppresses lung cancer cells growth and sensitizes to ultraviolet-induced apoptosis

Cancer Letters 235 (2006) 26–33 www.elsevier.com/locate/canlet

Down-regulation of CT120A by RNA interference suppresses lung cancer cells growth and sensitizes to ultraviolet-induced apoptosis Dongning Pana,b, Lin Weib, Ming Yaob,c, Dafang Wanb,c, Jianren Gua,b,c,* a

b

Shanghai Medical College, Fudan University, Shanghai, People’s Republic of China National Laboratory for Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai, People’s Republic of China c Medical School of Shanghai Jiao Tong University, Shanghai, People’s Republic of China Received 1 March 2005; received in revised form 28 March 2005; accepted 30 March 2005

Abstract CT120A gene was isolated from chromosome 17p13.3 by using positional cloning and RACE by our laboratory. Here, we reported the evidence that CT120A protein was a potential molecular target for treatment of lung cancers. CT120A was overexpressed in 15 cases of the 16 primary lung cancer specimens. Knockdown of CT120A by small hairpin RNA in the human lung adenocarcinoma cell line SPC-A-1 cells resulted in a reduced cell growth rate in vitro and decrease of the capacity for anchorage-independent growth and tumorigenicity in nude mice. The suppression of CT120A expression also sensitized cells to ultraviolet-induced apoptosis. Atlas cDNA expression array revealed that the expressions of several apoptosis- and growth-associated genes were altered underlying the molecular mechanisms of these cell biological behaviors. These results suggested that CT120A was a novel lung cancer-related gene and CT120A might be a potential target for therapeutic anticancer drugs. q 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: CT120A; RNAi; Small hairpin RNA; Lung cancer

1. Introduction CT120A, a novel human plasma membraneassociated gene, was isolated from chromosome 17p13.3 by using positional cloning and RACE (rapid amplification of cDNA ends) by our laboratory * Corresponding author. Address: National Laboratory for Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai, PRC, No. 25/Ln2200 Xie-Tu Road, Shanghai 200032, People’s Republic of China. Tel.: C86 21 6417 7401; fax: C86 21 6417 7401. E-mail address: [email protected] (J. Gu).

(GeneBank accession no. AF477201) [1]. In our previous report, transcript of CT120A was not detectable in normal lung tissues, but was abundant in the human lung adenocarcinoma SPC-A-1 cell line. Ectopic expression of CT120A by cDNA transfection could promote the malignant transformation of NIH3T3 cells and overexpression of CT120A in the A549 (human lung adenocarcinoma) cells enhanced tumorigenicity in nude mice [2]. All these data indicated that CT120A gene might be a novel candidate gene closely related to pulmonary carcinogenesis or cancer progression.

0304-3835/$ - see front matter q 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2005.03.045

D. Pan et al. / Cancer Letters 235 (2006) 26–33

To validate our obtained outcomes and clarify the relationship between CT120A and oncogenesis of lung cancers, here we employed RNA interference (RNAi) to silence the endogenous CT120A expression in the SPC-A-1 cells. The knockdown of CT120A expression by small hairpin RNA (shRNA) reduced the cell growth rate, suppressed the cell clonogenicity in soft agarose and inhibited tumorigenicity in a xenograft model. Furthermore, it sensitized the cancer cells to ultraviolet (UV)-induced apoptosis. By Western blotting analysis, CT120A was overexpressed at protein levels in 15 cases of the 16 primary lung cancer specimens so far examined. All these results confirmed that CT120A was involved in lung cancer development or progression and the RNAi of CT120A might hold promise for development of a new strategy for treating lung cancers.

2. Materials and methods 2.1. Cells and tissue samples The SPC-A-1 cell line was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, People’s Republic of China). The human lung cancer samples and matched adjacent lung tissues were collected from the First Affiliated Hospital of Zhejiang University (Hangzhou, People’s Republic of China), including six squamous cell carcinomas, nine lung adenocarcinomas and one adenosquamous carcinoma.

27

(Roche). The extracted proteins were subjected to 15% SDS-PAGE and then transferred onto a nitrocellulose membrane (Schleicher & Schuell BioScience). Detection was performed by using an ECL system (PIERCE). The chicken anti-CT120A antibody was prepared by immunization of chicken with synthesized C-terminal 15-mer oligopeptide (CRKAVRLFDTPQAKK) of CT120A from amino acid 241–255. Anti-b-actin antibody was purchased from Santa Cruz Biotechnology. 2.3. Vector-based shRNA plasmid constructs pSilencer 2.1-U6 Neo shRNA Expression Vector (Ambion) contained a human U6 RNA polymerase III promoter and a neomycin resistance gene to enable antibiotic selection in mammalian cells. Two pairs of complementary oligonucleotides (shRNA-H and shRNA-K) were synthesized, targeting CT120A cDNA at nucleotide 579–599 and 531–551, respectively (Table 1). The synthesized shRNA cassette was annealed and ligated into the pSilencer vector according to the manufacturer’s instruction. The target sequences were submitted to a BLAST search against the human genome sequence to ensure that only the CT120A gene was targeted. The scrambled control plasmid (shRNA-SC) supplied by the kit was a circular plasmid encoding a shRNA which had the sequence not present in the mouse, human, or rat genome databases. The RNAi plasmid DNAs for CT120A and the scrambled control were then prepared for cell transfection.

2.2. Western blotting 2.4. Cell culture and stable transfection Cultured cells and clinical lung cancer samples were lysed in T-PER tissue protein extraction reagent (PIERCE) containing proteinase inhibitor cocktail

The SPC-A-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen),

Table 1 Hairpin siRNA insert sequence

shRNA-H shRNA-K shRNA-SC

Sequence

Target nucleotide sequence on CT120A cDNA

GATCCCGcagggttctgattcagctaaaTTCAAGAGAtttagctgaatcagaaccctgTTTTTTGGAAA GATCCCGcggctgcatcttcacggcagaTTCAAGAGAtctgccgtgaagatgcagccgTTTTTTGGAAA GATCCactaccgttgttataggtgTTCAAGAGAcacctataacaacggtagtTTTTTGGAAA

579–599

Bases underlined can form shRNA targeting CT120A cDNA.

531–551

28

D. Pan et al. / Cancer Letters 235 (2006) 26–33

supplemented with 10% newborn bovine serum in the humidified incubator with 5% CO2 at 37 8C. Cells were transfected with LipofectAMINE Reagent (Invitrogen). Stable transfectants were selected for neomycin resistance in the medium containing 1.0 mg/ml G418 and later maintained in the medium with 0.4 mg/ml G418. 2.5. Cell proliferation assay Cells were plated in triplicate in 96-well plates (1!103 cells/well) and cultured overnight. BrdU (5-bromo-2 0 -deoxyuridine) labeling solution (Roche) was added to each well to incubate for 3 h at the designated time for successive 6 days. Then the cellular DNA was denatured. Anti-BrdU-POD bound to the BrdU incorporated in newly synthesized DNA. The immune complexes were detected by the subsequent substrate reactions and quantitated by measuring the absorbance at 450 nm with a microplate reader (Bio-RAD Model 550). Results were presented as percentages of the values obtained for per that of the scrambled control cells. 2.6. Soft agarose colony formation assay Cells (2!103/well) were suspended in the complete medium containing 0.3% agarose (GIBCO/ BRL) and seeded in triplicate in six-well plates onto a bottom layer of complete medium containing 0.6% agarose. The plates were cultured for 14 days. Then the number of the colonies was counted. 2.7. Tumorigenicity in nude mice The experimental protocol was approved by the China Institutional Ethics Review Committee for Animal Experimentation. Cells (3!106/mouse) suspended in 0.2 ml DMEM were injected subcutaneously into the 6-week-old male BALB/c nude mice at the right flanks. The animals were sacrificed on the 28th day after injection and the tumors were dissected and weighed. 2.8. Atlas cDNA expression arrays Atlas cDNA Expression Arrays (Clontech) included 588 cDNAs spotted on a nylon membrane.

Detailed methods for labeling and subsequent hybridization to the array were followed the manufacturer’s recommendation. Data analysis was performed by using OptiQuant software (Packard Instruments Co.). A threshold of a 2.0-fold change was applied to identify the differentially expressed genes. Semiquantitative RT-PCR assays were used to confirm the altered expressions of interested genes based on the results of Atlas cDNA microarray. The primer sequences were summarized in Table 2. 2.9. Cell apoptosis assay To induce apoptosis, cells were irradiated in an ultraviolet cross-linker (Amersham Biosciences, Inc.) at 200 J/m2 for 1 min. Cells were further incubated for 12 h before the apoptosis assay. A quantitative analysis of apoptosis was performed by fluorescent staining of cells with Annexin V-PE apoptosis detection kit (BD Biosciences) with a FACSCalibur flow cytometer (BD Bioscience). Morphologically apoptotic cells were identified by a TUNEL-based [Terminal Deoxynucleotidyl Transferase (TdT)mediated dUTP Nick End Labeling] in situ apoptosis detection kit (R&D Systems, Inc.). It used TdT to transfer biotin-dUTP to the free 3 0 -OH of the cleaved DNA. The biotin-labeled cleavage sites were then Table 2 Primer sequences used in this study Primer name

Sequence 5 0 –3 0

Product (bp)

CT120A-F CT120A-R b-Actin-F b-Actin-R Caspase 8-F Caspase 8-R

TTGTGCCAGTCGCACAGAGGCT TTAGCCATCCTTTTTGGCTT TGCTATCCCTGTACGCCTCT CTAGAAGCATTTGCGGTGGA ACAGATGCCTCAGCCTACTTTC ATCACGAGGTCAGGAGATCAAG TGTGTCGGTCGAGAAGATTG CTGCTCAAAGATGTCGTCCA CACGGCTCACTGTAGTCTCG ATGCAGAGGGGACACAGAAT TGCACGTACTTCTCCCATCA CTCCATAGGCTGCAAACACA CCTGCAAGAGGTCCTGTCTT AGCCGTTCATTCTCTTCAGC GCCTTCGACAACCTCTATTACTG CCTCAGAATCCACAAAGACTCC

383

Caspase 9-F Caspase 9-R Caspase 10-F Caspase 10-R Tob-F Tob-R DDIT3-F DDIT3-R ErbB2-F ErbB2-R

713 323

349 355 341 351 355

D. Pan et al. / Cancer Letters 235 (2006) 26–33

29

Fig. 1. The expression of CT120A in primary lung cancer tissues (designated as T1–T16) and the paired adjacent normal tissues (designated as N1–N16) was measured by Western blotting. Increased expression of CT120A was observed in 15 cases of 16 lung cancer samples, except in the T6 specimen. b-Actin was used as an internal control. The SPC-A-1 cell lysates were loaded as positive control.

visualized by the reaction with fluorescein conjugated streptavidin. 3. Results 3.1. Overexpression of CT120A in lung cancer tissues We had observed transcript of CT120A was not detectable in normal lung tissues, but was abundant in the human lung adenocarcinoma SPC-A-1 cell line [1,2]. In the present study, we examined the expression of CT120A using Western blotting in 16 pairs of matched primary lung cancer samples with the relevant antibody. It was demonstrated that five out of six squamous cell carcinomas, all nine adenocarcinomas and one adenosquamous carcinoma overexpressed CT120A. Taken together, CT120A was overexpressed in 15 cases of the 16 primary lung tumors examined, except one sample of squamous cell carcinoma (Fig. 1).

3.2. Efficient knockdown of CT120A by vector-based shRNA in the SPC-A-1 cells To further confirm whether endogenous CT120A expression was essential for growth of lung cancer cells, RNAi technology was utilized to knockdown CT120A expression in the SPC-A-1 cells. The vectorbased shRNA plasmids (shRNA-SC, H, K) were transfected into the cells. Cells were selected with G418, and resistant clones were subjected to RT-PCR (primer sequences were in Table 2) and Western blotting to analyze the CT120A expression. When compared with the scrambled control cell line and parental SPC-A-1 cells, CT120A transcripts were reduced by 70 and 50% in two shRNA-H stable transfectants, H2 and H3 clones, respectively. The protein of CT120A was reduced by about 80% in both the H2 and H3 clones. However, the shRNA-K transfectants showed no apparent suppression in CT120A expression (Fig. 2).

Fig. 2. Vector-based shRNA knocked-down CT120A expression in the SPC-A-1 cells. The stable cell clones transfected with vector-based shRNA were subjected to semi-quantitative RT-PCR (A) and Western blotting (B). The expression of CT120A was effectively knocked-down in the H2 and H3 cell lines.

30

D. Pan et al. / Cancer Letters 235 (2006) 26–33

3.3. Knockdown of CT120A in the SPC-A-1 cells retards cell growth in vitro and in vivo For characterizing the role of CT120A on the growth of the SPC-A-1 cells, we measured the cell proliferation rate and the ability of cells to grow in an anchorage-independent manner in vitro. By BrdU incorporation assay, up to the sixth day a dramatic decrease in the cell growth rate (30–40%) was observed in the shRNA-H2 and shRNA-H3 cell lines as compared with the shRNA-SC transfectants (Fig. 3A). In addition, the colony formation rate in soft agarose of the two cell lines was reduced. The number of colonies formed by the shRNA-H2 and H3 cells was about one half that of the control cells (Fig. 3B). We further examined the effects of CT120A knockdown on the tumorigenicity in a xenograft model. After cells inoculation in nude mice for 28 days, a remarkable reduction of tumor weight of the groups shRNA-H2 and shRNA-H3 was observed as compared with that of the control. The average tumor weight (nZ8) of the groups shRNA-H2 and shRNA-H3 was 54 and 58%, respectively, that of the control group (Fig. 3C), indicating knockdown of CT120A in cancer cells reduced their tumorigenic potential.

2.4-fold; procaspase 10 up-regulated 2.3-fold; DDIT3 (DNA-damage-inducible transcript 3) up-regulated 2.0-fold; Tob (transducer of ErbB2) up-regulated 2.1-fold; and ErbB2 was down-regulated 2.5-fold.

3.4. Atlas cDNA expression arrays Since the shRNA-H2 cells had more significant inhibitory effects on cell growth than the shRNA-H3 cells, the shRNA-H2 cell line was selected for further cDNA expression array analysis. Five micrograms of total RNA from the shRNA-H2 and the scrambled control cell lines were reverse transcribed to a-32PdATP-labeled first-strand cDNA. The labeled cDNA was used for hybridization with the expression array membrane containing 588 genes. We compared the data of expression levels of the 588 genes in the shRNA-H2 cells with that of the control cells. A total of 19 genes were identified as altered expressions in the shRNA-H2 cells versus the control cells. In the light of the growth retardation, we selected six cell growth-associated genes to validate the expression alterations by semiquantitative RT-PCR. In each case, the RT-PCR data were consistent with the results obtained from the expression array analysis (Fig. 4A): procaspase 8 was up-regulated 2.1-fold; procaspase 9 up-regulated

Fig. 3. Knockdown of CT120A in the SPC-A-1 cells retarded cell growth. (A) Cell proliferation assay was determined with BrdU incorporation assay over a 6-day period. The growth rate of the shRNA-H2 and shRNA-H3 cells was decreased by 30–40% than the control on the sixth day examined. (B) The capability for anchorageindependent colony formation in soft agarose was analyzed. After 2 weeks of incubation, the number of colonies was counted and presented as meansGSE (nZ3). (C) The shRNA-H2, shRNA-H3, and scrambled control cells (3!106/mouse) were injected subcutaneously into the BALB/c nude mice at the right flanks. Four weeks later, the tumors were dissected and weighed. The average tumor weight (nZ8) of the groups shRNA-H2 and shRNA-H3 was 54 and 58%, respectively, that of the control cells. For t-tests, *P!0.05 and **P!0.01 were significantly different from the scrambled control.

D. Pan et al. / Cancer Letters 235 (2006) 26–33

3.5. Knockdown of CT120A aggravates UV-induced apoptosis As indicated by Atlas cDNA microarray, procaspase 8, procaspase 9 and procaspase 10 genes were up-regulated in the shRNA-H2 cells. Since all these three caspases were essential initiator molecules governing the caspase signaling cascade [3,4], we then explored the sensitivity of the shRNA-H2 cells in response to signals-induced cell apoptosis. Under the normal culture conditions, the shRNA-H2 cells had a low percentage of spontaneous apoptosis (4.38%). However, after ultraviolet exposure, apoptosis was dramatically induced in the shRNA-H2 cells revealed

31

by Annexin-V staining. The apoptotic fraction in the shRNA-H2 cells was increased up to 16.06% as compared with the control cells (3.58%) under the ultraviolet treatment (Fig. 4B). The TUNEL assay by detecting DNA fragmentation further confirmed the UV-induced apoptosis in the shRNA-H2 cells (Fig. 4C).

4. Discussion Molecules that can specifically silence gene expression become powerful research tools. The double-stranded RNA-mediated interference has

Fig. 4. (A) Validation of microarray results with semi-quantitative RT-PCR analysis. Six cell apoptosis- or growth-associated genes were selected to validate the expression array results from the total 19 differentially expressed genes. b-Actin was amplified as an internal control. (B) Cells were stained with Annexin V-PE and 7-amino-actinomycin (7-AAD) to detect early apoptotic cells. There was no obvious spontaneous apoptosis of shRNA-H2 cells without any irritation. After cells were irradiated with ultraviolet, the shRNA-H2 cells underwent dramatic apoptosis. (C) In situ apoptosis detection was used to identify UV-induced apoptotic cells based on the mechanisms of TUNEL assay. The apoptotic fluorescein-stained cells were visualized using fluorescence microscope. All cells in the field were indicated by being stained with DAPI (4 0 , 6 0 -diamidino-2-phenylindole) (magnification is 400!).

32

D. Pan et al. / Cancer Letters 235 (2006) 26–33

recently emerged as a powerful reverse genetic tool to silence gene expression [5–8]. Here we adopted the vector-based shRNA expression systems to elucidate the functions of CT120A, overcoming the limitations of transient and non-renewable nature of small interference RNA (siRNA). In this report, we have successfully selected an efficient target sequence to knockdown the endogenous CT120A expression. The silencing of CT120A in the SPC-A-1 cells inhibited the cell growth and maintained cancer cells at a less malignant phenotype by its suppressive effects on the clonogenicity and tumorigenicity. The suppression of CT120A expression also sensitized cells to UV-induced apoptosis. Resistance to apoptosis is considered to be a hallmark of cancer cells. Defects in apoptosis underlie not only the increase of tumorigenesis, but also the resistance to cancer treatments [9]. The knockdown of CT120A might overcome the antiapoptosis potential and trigger the apoptosis of lung cancer cells. By utilizing cDNA microarray technology, we attempted to explore the possible molecular events happened after the silencing of CT120A correlated to cell growth retardation. The expression profiling after silencing demonstrated that three procaspase (8,9,10) genes were up-regulated. They are involved in both death receptor- and mitochondrion-dependent apoptosis pathway. The up-regulation of procaspase 8, 9, and 10 may contribute to the sensitivity of the shRNA-H2 cells to the UV-induced apoptosis. In addition, the up-regulated Tob, DDIT3 and the downregulated ErbB2 genes provide insight into the molecular basis for the growth-inhibitory effects of silencing the CT120A expression in lung cancer cells. Tob is a member of the anti-proliferative gene family and functions as a negative regulator of cell proliferation [10,11]. DDIT3 is transcriptionally activated and is highly expressed following treatment of cells with a variety of growth arrest and/or DNA-damaging factors. It has also been implicated that DDIT3 is involved in the commitment to growth arrest or cell death [12]. Furthermore, ErbB2 is an essential member of the epidermal growth factor receptor (EGFR) family, responsible for cell proliferation and oncogenesis. It binds to other ligand-bound EGFR family members to form a heterodimer, stabilizing ligand binding

and enhancing kinase-mediated activation of downstream signaling pathways. Since ErbB2 is overexpressed in 16–57% of patients with non-small cell lung cancer (NSCLC), its down-regulation may indicate a good prognosis in patients with NSCLC [13]. Lung cancer is one of the most fatal malignancies throughout the world [14]. It is urgent to develop new therapeutic strategies for lung cancers. In the present study, our findings support the notion that CT120A is essential for the maintenance of highly malignant phenotypes of human lung cancers. The knockdown of CT120A expression by RNAi can successfully reverse the malignant behaviors of lung cancer cells, implicating that CT120A may be a new candidate of drug target for treatment of lung cancers.

Acknowledgements We thank Dr Fei Zhong for his contribution to the design of RNAi target sequence. This work was supported by National Grant of Key Basic Research Program (973) (Grant no. 2004CB518704).

References [1] X. He, Y. Di, J. Li, Y. Xie, Y. Tang, F. Zhang, et al., Molecular cloning and characterization of CT120, a novel membraneassociated gene involved in amino acid transport and glutathione metabolism, Biochem. Biophys. Res. Commun. 297 (2002) 528–536. [2] X.H. He, J.J. Li, Y.H. Xie, F.R. Zhang, S.M. Qu, Y.T. Tang, et al., Expression of human novel gene CT120 in lung cancer and its effects on cell growth, Ai Zheng 22 (2003) 113–118 (Chinese). [3] M. Chen, J. Wang, Initiator caspases in apoptosis signaling pathways, Apoptosis 7 (2002) 313–319. [4] M.G. Grutter, Caspases: key players in programmed cell death, Curr. Opin. Struct. Biol. 10 (2000) 649–655. [5] M. Miyagishi, H. Sumimoto, H. Miyoshi, Y. Kawakami, K. Taira, Optimization of an siRNA-expression system with an improved hairpin and its significant suppressive effects in mammalian cells, J. Gene Med. 6 (2004) 715–723. [6] G. Sui, C. Soohoo, E.B. Affar, F. Gay, Y. Shi, W.C. Forrester, Y. Shi, A DNA vector-based RNAi technology to suppress gene expression in mammalian cells, Proc. Natl Acad. Sci. USA 99 (2002) 5515–5520.

D. Pan et al. / Cancer Letters 235 (2006) 26–33 [7] J.Y. Yu, J. Taylor, S.L. DeRuiter, A.B. Vojtek, D.L. Turner, Simultaneous inhibition of GSK3alpha and GSK3beta using hairpin siRNA expression vectors, Mol. Ther. 7 (2003) 228–236. [8] J.Y. Yu, S.L. DeRuiter, D.L. Turner, RNA interfence by expression of short-interfering RNAs and hairpin RNAs in mammalian cells, Proc. Natl Acad. Sci. USA 99 (2002) 6047–6052. [9] H. Okada, T.W. Mak, Pathways of apoptotic and non-apoptotic death in tumour cells, Nat. Rev. Cancer 4 (2004) 592–603. [10] T. Suzuki, J.K. Tsuzuku, R. Ajima, T. Nakamura, Y. Yoshida, T. Yamamoto, Phosphorylation of three regulatory serines of Tob by Erk1 and Erk2 is required for Ras-mediated cell proliferation and transformation, Genes Dev. 16 (2002) 1356–1370.

33

[11] Y. Yoshida, T. Nakamura, M. Komoda, H. Satoh, T. Suzuki, J.K. Tsuzuku, et al., Mice lacking a transcriptional corepressor Tob are predisposed to cancer, Genes Dev. 17 (2003) 1201–1206. [12] D.G. Kim, K.R. You, M.J. Liu, Y.K. Choi, Y.S. Won, GADD153-mediated anticancer effects of N-(4-hydroxyphenyl)retinamide on human hepatoma cells, J. Biol. Chem. 277 (2002) 38930–38938. [13] F.R. Hirsch, C.J. Langer, The role of HER2/neu expression and trastuzumab in non-small cell lung cancer, Semin. Oncol. 31 (1 Suppl 1) (2004) 75–82. [14] W. Smith, F.R. Khuri, The care of the lung cancer patient in the 21st century: a new age, Semin. Oncol. 31 (2 Suppl 4) (2004) 11–15.