- Email: [email protected]
Down-Regulation of Macrophage CD9 Expression by Interferon-γ
Biochemical and Biophysical Research Communications 290, 891– 897 (2002) doi:10.1006/bbrc.2001.6293, available online at http://www.idealibrary.com on
Down-Regulation of Macrophage CD9 Expression by Interferon-␥ Xue-Qing Wang,* Glenn F. Evans,* M. Leticia Alfaro,† and Steven H. Zuckerman* ,1 *Division of Cardiovascular Research, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285; and †Universidad Auto´noma Metropolitana-Xochimilco, Mexico
Received December 12, 2001
CD9, a member of the tetraspanin family is a cell surface marker expressed on myeloid and nonmyeloid as well as on neoplastic cells. The present study has focused on the role of inflammation and macrophage activation in the regulation of CD9 expression. We report that the expression of CD9 on primary cultures of murine peritoneal macrophages was down regulated by Interferon-␥, IFN-␥. This down regulation was concentration-dependent and maximal by 48 h. The changes in surface expression were consistent with similar reductions in CD9 protein and message levels by Western and Northern blot analyses. The mechanism by which IFN-␥ decreases CD9 expression appears to be through the Stat1 signaling pathway as Stat1 knockout mice did not demonstrate any reduction in CD9 expression by IFN-␥ treatment. These results represent the first evidence for the down regulation of CD9 expression with macrophage activation. © 2002 Elsevier Science (USA)
Key Words: tetraspanin; macrophage; inflammation; Stat1.
CD9 is a member of the tetraspanin family and is expressed on both hematopoietic and nonhematopoietic cells (1). Tetraspanins in general and CD9 in specific have been implicated in the regulation of cell motility, differentiation, proliferation, and signaling (2– 5). CD9 transfection into CHO, MHO10, ARH77, and MAC 10 cells for example, inhibited cell motility with inhibition proportional to the amount of CD9 expressed (6). Consistent with these studies, in vivo observations on CD9 expression in various neoplasias have reported an inverse correlation between the amount of CD9 expressed and the extent of tumor metastasis and malignancy in human breast cancer, colon carcinoma, and melanomas (7–9). In distinction, an antibody against 1 To whom correspondence should be addressed. Fax: 317-4332815. E-mail: [email protected].
CD9 enhanced Schwann cell migration among a panel of antibodies to Schwann cell surface antigens (5). In addition to a potential role in modulating cell motility, CD9 may also serve as a cell surface molecular organizer to facilitate cross-talk between different surface receptors (10). CD9 as well as the other tetraspanins appear to be promiscuous in their association with other surface markers and receptors. CD9 has been reported to be associated with CD36 in platelets (11), with ␣64 integrin in human epidermal keratinocytes (12), and with 1 integrin subunits in human HEL and NALM-6 cell lines (13). CD9 has also been observed to associate with intracellular proteins including PI 4 kinase (14), heat shock proteins (15), and with protein kinase C (PKC) isozymes upon their translocation to the plasma membrane (16). The reported association of PKC with the tetraspanins CD9, CD53, CD81, CD82, and CD151 may provide a framework for PKC association with specific integrins (16). The concept of CD9 and the other tetraspanins as scaffolds which promote interactions between surface receptors and matrix components and modulate cellular motility would suggest a fundamental role for tetraspanins on macrophage functions. In macrophages, CD9 has been reported to be associated with membrane-anchored HB-EGF and enhanced its juxtacrine mitogenic activity (17). Other evidence supporting a role for CD9 in macrophage function are studies reporting that antibody cross-linking CD9 and Fc-␥ receptor led to macrophage activation as indicated by tyrosine phosphorylation and cell aggregation (18). CD9 ligation in other cell types can also indirectly effect macrophage activation as evidenced by the report that its ligation on T cells resulted in T-cell activation (19). However, while the role for CD9 in modulating the cellular response to matrix components and motility is suggestive, regulation of CD9 expression in general and on macrophages in specific is less well understood. CD9 expression has been reported to increase in the human monocytic leukemic cell line THP-1 upon phor-
891
0006-291X/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
bol ester induced differentiation (17). In addition, increased CD9 expression was observed on macrophages from interstitial lung disease patients, and this increase was inversely correlated with disease (20). Clearly, an understanding of the regulation of CD9 expression in macrophages may provide a greater understanding of how macrophage activation results in changes in cell motility and matrix interactions. Macrophages within the microenvironment of an inflammatory locus are subjected to both macrophage activating cytokines such as IFN-␥, GM-CSF, CSF-1 as well as de-activating cytokines including IL-10 and TGF (21). The present study was designed to determine the effects of macrophage activation on CD9 expression in murine peritoneal macrophages using IFN-␥. The results of this study demonstrate that CD9 expression is down-regulated by IFN-␥ and that this effect was both concentration and time dependent. Furthermore the down-regulation of CD9 expression was apparent at both the protein and message levels and was mediated through the Stat1 signaling pathway. Macrophages from Stat1 knockout mice failed to demonstrate any reduction in CD9 expression by IFN-␥. These results demonstrate that CD9 expression is down-regulated by IFN-␥ and that this down regulation may explain in part the changes observed in matrix interaction and cell motility following macrophage activation. MATERIALS AND METHODS Cell culture. Peritoneal macrophages were obtained from thioglycolate-elicited BALB/c mice or Stat1 KO, 129S6/SvEv-Stattm1 (Taconic, Germantown, NY), and the parent line 129S6/SvEv, by lavage and cultured in RPMI 1640 medium containing 2% FCS serum (Hyclone Laboratories, Logan, UT). After adherence for at least 2 h, macrophages were washed twice and incubated with recombinant murine IFN-␥ (Biosource International, Camarillo, CA). In select experiments, kinase inhibitors including the tyrosine kinase inhibitor AG490, the MEK inhibitor PD98059, the PKA inhibitor H-89 or the P38 inhibitor SB203580 (Calbiochem, San Diego, CA) were added to evaluate their effects on inhibiting the changes in CD9 expression associated with IFN-␥ treatment. Flow cytometry. Macrophage cultures were stimulated with IFN-␥ at the indicated concentrations for 48 h prior to evaluation by flow cytometry. Cells were then washed three times with cold flow buffer (Hank’s buffer with 10 mM Hepes, 1% BSA, 0.1% azide), and incubated with monoclonal antibodies directed against CD9, CD11a, CD53, or CD81 (BD Pharmingen, San Diego, CA) at final concentrations of 4 g/ml in the same buffer on ice for at least 1 h. Following staining with PE-conjugated secondary antibody, cells were detached by a rubber policeman. All flow cytometry experiments were evaluated on 10,000 individual cells gated for macrophages, based on their forward and side light-scatter profiles. The mean fluorescence intensity, MFI, was measured using a Becton Dickinson FacSort with Cellquest software (Becton Dickinson, San Jose, CA). Northern blots. Total RNA and subsequently polyA RNA were isolated using RNA isolation kits (Qiagen, Santa Clarita, CA). PolyAenriched RNA, 0.5 g per lane, was separated by 0.7% formaldehyde agarose gels and transferred to Nytran nylon membrane over night
using the turboblotter system (Schliecher and Schuell Inc., Keene, NH). Membranes were prehybridized in hybridization buffer and hybridized with [␣- 32P]dATP DNA probes labeled by random primers (GIBCO, Grand Island, NY) in fresh hybridization buffer. CD9 probes were polymerase chain reaction-amplified using sense (ACTATGGCTCCGATTCGACTCTCA) and antisense (CCACTGCTCCAATGATGTGGAACT) primer sets. CD81 probes were amplified using sense (TGATCCACAGACCACCAGCCTGTC) and antisense (ACAGCACCATGCTCAGAATCATCT) and S29 probes were designed and amplified as previously described. Membranes were washed in 2⫻ SSC (saline-solution citrate buffer) and exposed either to Kodak Biomax-MS film or to Phosphoscreen. Quantitation was performed using a PhosphorImager (Molecular Dynamics) with normalization based on the tetraspanin signal relative to the hybridization intensity of the S29 band. Immunoblots. Untreated or macrophages after activation with IFN-␥ for 48 h were lysed in RIPA buffer and clarified lysates (50 l) were added to SDS-sample buffer and run on 12% Tris-glycine gels under reducing conditions. The proteins were transferred onto nitrocellulose membranes which were blocked with 3% BSA plus 4% dried milk in TBS buffer with 0.1% Tween-20 for at least 1 h, and subsequently incubated with antibodies against CD9 or ERKs (1:2000 dilution) overnight at 4°C. The membranes were washed extensively and incubated with peroxidase conjugated secondary antibodies for 1 h. Detection was by SuperSignal West Dura Extended Duration Substrate (Pierce).
RESULTS Macrophage activation by IFN-␥ has been demonstrated to result in changes in both surface receptor expression as well in increase macrophage effector functions (22). In the present study the effects of IFN-␥ on tetraspanin expression were evaluated with CD9 as the focus. Therefore, primary cultures of murine peritoneal macrophages from BALB/c mice were stimulated with IFN-␥, 200 units/ml, for 48 h and changes in the expression of CD9, and as a positive control, CD11a were evaluated by flow cytometry. As shown (Fig. 1), the expression of CD9 decreased by approximately 65% (with mean fluorescence intensity decreasing from 1277 to 446) whereas the expression of CD11a was increased significantly following IFN-␥ stimulation (from 153 to 1864). The down-regulation of CD9 was dependent on both the IFN-␥ concentration and the duration of exposure. Macrophages incubated with IFN-␥ for 48 h exhibited a reduction in CD9 that was apparent at five units/ml IFN-␥ and was maximal by 50 units/ml (Fig. 2A). The effects of IFN-␥, 100 units/ ml, were also detected by 24 h and maximal at 48 h with no further changes observed (Figs. 2B). This would suggest that the decrease in CD9 expression was due to changes in the levels of CD9 message or protein. The effect of IFN-␥ on CD9 expression was not generally observed with other tetraspanin members as neither CD53 nor CD81 were down-regulated to the same extent (Fig. 3). In these studies, relative to the non IFN-␥ treated controls, CD9 was down-regulated by approximately 55%, whereas CD53 and CD81 showed a 20% reduction. Therefore, the decrease in CD9 ex-
892
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Macrophage activation by IFN-␥ results in CD9 down-regulation. Macrophages from BALB/c mice were incubated in the presence (bold line) or absence (normal line) with 200 units/ml of IFN-␥ for 48 h and CD9 and CD11a was quantitated by flow cytometry. Note the minimal staining for the relevant IgG control (dotted line). Representative experiment of 5.
pression following macrophage activation was more pronounced than that observed with at least two other members of the tetraspanin family. In an attempt to determine whether the reduction in CD9 surface expression correlated with total protein and message levels, macrophages were activated with varying concentrations of IFN-␥ for 48 h and then lysed and evaluated by Western blot (Fig. 4) and Northern blot (Fig. 5) analysis. As demonstrated (Fig. 4), IFN-␥ activated macrophages exhibited reduced levels of CD9 as detected by Western blots. In distinction the level of total ERKs remained relatively constant across IFN-␥ concentrations from 0 to 500 units/ml. These results were consistent with the changes detected by flow cy-
FIG. 2. IFN-␥ down regulation of CD9 expression in macrophages was concentration and time dependent. IFN-␥ effects on CD9 down-regulation were concentration dependent following 48 h treatment, with maximal effects at 50 units/ml (A). CD9 down-regulation by 100 units/ml IFN-␥ was time dependent with maximal effects by 48 h (B). Brackets indicate the standard deviation of the mean of duplicate cultures. Differences relative to the untreated or zero time point were significant (P ⬍ 0.001) by a 2 tailed unpaired Student’s t-test.
tometry at the membrane surface. Northern blot analysis was then performed (Fig. 5) to determine whether the changes in total protein reflected similar changes in steady state levels of CD9 mRNA. The results (Fig. 5A) demonstrate that IFN-␥ activated macrophages have reduced levels of CD9 message whereas the levels of S29 message, used for normalization remained constant. Quantitation of the band intensities (Fig. 5B) suggested an approximately 2.5-fold reduction in CD9 message following 48 h incubation with IFN-␥. In distinction, IFN␥ had a more modest effect on CD81 mRNA levels (Fig. 5C), which did not achieve statistical significance (Fig. 5D). This result, consistent with the flow cytometry studies (Fig. 3), suggests that the down-regulation of CD9 expression by IFN␥ did not reflect a more general effect of IFN␥ on other members of the tetraspanin family. Transcriptional regulation by IFN-␥ occurs through both Stat1 dependent and independent pathways (22,
FIG. 3. IFN␥-mediated down-regulation of CD9 was more significant than its effects on other members of the tetraspanin family. Macrophages were treated with 200 units/ml IFN-␥ for 48 h, and surface expression of CD9, CD53, and CD81 was evaluated by flow cytometry. Brackets indicate the standard deviation of the mean from triplicate cultures. Representative experiment of 4.
893
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. IFN␥ down regulates CD9 protein levels. Macrophages were treated with IFN-␥ at the indicated concentrations for 48 h. Cells were lysed, clarified proteins were separated by SDS–PAGE, and transferred to nitrocellulose membranes. CD9 protein was detected by Western blot analysis. Immunodetection of the ERKs on the same blot was used for normalization. Representative experiment of 3.
23). In an attempt to determine whether the effects of IFN-␥ on CD9 expression were also dependent on the Stat1 pathway, macrophages from wild-type or Stat1 deficient mice were treated with IFN-␥ for 48 h and CD9 surface expression was analyzed by flow cytometry. As demonstrated (Fig. 6), whereas macrophages from the wild-type line 129S6/SvEv responded to IFN-␥ treatment with a decrease in CD9 expression, macrophages from Stat1 knockout mice did not demonstrate any reduction in CD9. This result demonstrates that the Stat1 pathway is necessary and sufficient for the ability of IFN-␥ activated macrophages to
FIG. 6. IFN-␥-mediated down-regulation of CD9 expression was dependent on the Stat1 signaling pathway. Macrophages from control or Stat1 knockout mice were treated with 200 units/ml IFN-␥ for 48 h. CD9 expression was quantified by flow cytometry, brackets indicate the standard deviation of the mean across duplicate cultures. CD9 decrease in the control macrophages by IFN-␥ was significant (P ⬍ 0.001) by a two-tailed Student’s t-test.
down-regulate CD9 expression. Finally, in an attempt to implicate the Stat1 signaling pathway in wild-type mice, macrophages from BALB/c mice were incubated with optimal concentrations of the JAK2 kinase inhibitor AG490. Cotreatment of macrophages with IFN-␥ and AG490 inhibited approximately 50% of the IFN-␥ effect on CD9 (Table 1). Similar treatments with MEK, PKA, or P38 inhibitors had modest (MEK) or no inhibitory effects (PKA, P38) on IFN-␥ signaling for CD9 down-regulation. Collectively, these results demonstrate that macrophage activation results in the downregulation of the tetraspanin CD9 and that these effects are mediated through the Stat1 pathway. DISCUSSION Tetraspanins as a family are characterized by a similarity in membrane organization with hydrophobic domains enabling these proteins to traverse the memTABLE 1
Kinase Inhibitor Effects on IFN-␥-Mediated Down Regulation of CD9 FIG. 5. IFN-␥ down regulates CD9 message without similar effects on CD81. Macrophages were treated with 200 units/ml IFN␥ for 48 h and polyA RNA was isolated and subjected to Northern blot analysis by using PCR-labeled probes for CD9, CD81, and S29 (A, C). Quantitation of the CD9 and CD81 hybridization signals were by PhosphorImager, and expression was adjusted to S29 as an internal standard (B, D). Brackets indicate the standard deviation of the mean from three separate experiments. The decrease in CD9 message relative to the control was significant (P ⬍ 0.001) by an unpaired two-tailed Student’s t-test. The decrease in CD81 message did not achieve significance.
Inhibitor a
Specificity
Concentration (M)
% Inhibition of IFN␥ effect b
AG490 PD98059 H-89 SB203580
JAK2 MEK PKA P38
50 50 10 50
53 30 0 0
a Macrophages were incubated with the designated inhibitors for 48 h in the presence of 200 units/ml IFN-␥. b CD9 expression was quantitated by flow cytometry and expressed relative to the vehicle control.
894
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
brane four times and a single major extracellular loop, presumably the recognition site for ligand binding (10). While there are many members to this family including CD9, CD53, CD63, CD81, and CD82 they all share this similar structure and are ubiquitous in their tissue distribution (10). Furthermore, the tetraspan family has been reported to associate with a variety of other cellular proteins including intracellular enzymes through integrins (14 –16) and as such, function as scaffolds to generate appropriate macromolecular complexes to respond to extracellular stimuli (10 –12). However, at present the precise ligands for any of the tetraspanin members remains unknown. Regulation of tetraspanin expression has been described in a variety of cell systems in an attempt to further understand the function of these proteins. In the present study, CD9 expression was evaluated in primary cultures of murine peritoneal macrophages and was down regulated at the message and protein levels following macrophage activation with IFN-␥. This down-regulation was not a general observation for other members of the tetraspanin family as effects on CD53 or CD81 were minimal. This represents, to the best of our knowledge, the first report demonstrating the down-regulation of CD9 expression by inflammatory stimuli such as IFN-␥. In distinction to this down-regulation associated with macrophage activation, a previous study in the human monocytic leukemic cell line THP-1 reported an up-regulation of CD9 following phorbol ester induced differentiation (17). A similar observation was reported for the human megakaryocytic line K562 (24). While the basis for these differences are not clear, the cell systems in which these observations have been made are quite distinct. THP1 and K562 are cell lines derived from primary tumors immortalized as a premonocytic or pluripotential hematopoietic line, respectively, that can be induced to terminal differentiation with phorbol esters. Therefore the increase in CD9 is consistent with a maturation of these lines to a more mature phenotype. In contrast, the present study has focused on primary cultures of mature murine peritoneal macrophages that are already differentiated and IFN-␥ results in further cellular activation. To this extent, it will be of interest to evaluate the effects of IFN-␥ on CD9 expression in phorbol ester differentiated THP1 cells. Regulation of other members of the tetraspanin family have been investigated in primary human blood cells. CD53 and CD63 for example have been reported to be up-regulated in human neutrophils undergoing apoptosis (25). In distinction, incubation of human neutrophils with either TNF, platelet activating actor, or the chemotactic peptide formyl-methionine-leucinephenylalanine resulted in a rapid decrease in CD53 expression due to the posttranslational activation of a
membrane protease responsible for cleaving CD53 (26). While the present study cannot exclude a contributing role for such a process in CD9 regulation the kinetics for this down-regulation (apparent at 24 h and maximal by 48 h) versus the neutrophil study which was maximal by 1 h and insensitive to actinomycin D suggests a different level of regulation. Whereas the precise mechanism by which CD9 is down-regulated by IFN-␥ remains unclear there are cis-acting sites within the CD9 and CD53 promoters which could regulate tetraspanin expression at the transcriptional level (24, 27). The human CD9 promoter for example, is characterized by having a 120 bp GC rich region containing multiple Sp1 binding sites and a consensus sequence for binding of zinc finger proteins (27). Evidence for both positive and negative regulatory sites have been reported within the CD53 promoter between ⫺266 and ⫹84 nucleotides including Sp1 and ets-1 sites (28). Mutational analysis revealed PuF and E4BP4 elements that function as negative regulators in select cell lines. Interestingly, these sites as well as others can function in a positive, neutral, or negative regulatory mode depending on the cell line for which the promoter studies were evaluated. These cellrelated differences in the function of cis-acting sites could also potentially explain the differences in CD9 expression between transformed human monocytic lines and murine peritoneal macrophages. Recent studies have demonstrated that IFN-␥ signaling can occur through Stat1 dependent as well as Stat1 independent pathways (22, 23). These studies reported that both fibroblasts and bone marrow derived macrophages from Stat1 KO mice are capable of responding to IFN-␥ with the induction of genes seen in both wild-type and Stat1 KO mice. Examples include osteopontin, c-Jun, and suppressors of cytokine signaling, SOCS-2 and 3 in fibroblasts, and both chemokines and the chemokine receptor CXCR4 in macrophages (23). These studies raised the question as to whether the effects of IFN-␥ on down-regulating CD9 expression may have been mediated in part or completely independent of the Stat1 pathway. As the present study demonstrates, the down-regulation of CD9 expression following macrophage activation with IFN-␥ was dependent on the Stat1 pathway as similar effects were not apparent in macrophages from Stat1 KO mice. A similar, although less significant inhibition of the IFN-␥ effect was demonstrated with the JAK2 kinase inhibitor AG490 in BALB/c macrophages. This partial inhibition may be related either to an inability to completely inhibit JAK2 activity or that Stat1 phosphorylation can occur by other kinases (29). The precise mechanism(s) by which Stat1 activation in these elicited macrophages leads to a reduction in CD9 expression remains to be defined. Transcriptional repression by IFN-␥ has been reported for other genes related
895
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
to inflammation. IFN-␥-activated macrophages in one study for example, had 40 – 60% lower levels of COX-2 mRNA, protein expression, and PGE2 production as compared with untreated macrophages (30). Moreover, IFN-␥ inhibited mRNA expression for the chemokines MIP-1␣, MIP-1, MCP-1, and KC in macrophages (29). Similar to these observations, IFN-␥ has been reported to reduce perlecan promoter activity (31). In the perlecan promoter analysis, multiple GAS elements were shown to be necessary for the inhibitory effect of IFN-␥. Therefore, while IFN-␥ mediated macrophage activation is generally viewed as a process increasing macrophage effector functions it is also associated with a down-regulation of many genes including, as demonstrated in the present study, the tetraspanin CD9. Both the precise mechanism by which this occurs as well as determining whether this down-regulation is associated with changes in the macromolecular complexes for which CD9 serves as a potential scaffold for, are areas currently under investigation.
10. 11.
12.
13.
14.
15.
16.
ACKNOWLEDGMENT The authors wish to acknowledge Dr. Chandrasekhar (Lilly Research Labs) for his review of our manuscript.
17.
REFERENCES 1. Boucheix, C., Perrot, J. Y., Mirshahi, M., Giannoni, F., Billard, M., Bernadou, A., and Rosenfeld, C. (1985) A new set of monoclonal antibodies against acute lymphoblastic leukemia. Leuk. Res. 9(5), 597– 604. 2. Hadjiargyrou, M., and Patterson, P. H. (1995) An anti-CD9 monoclonal antibody promotes adhesion and induces proliferation of Schwann cells in vitro. J. Neurosci. 15(1), 574 –583. 3. Cook, G. A., Wilkinson, D. A., Crossno, J. T., Jr., Raghow, R., and Jennings, L. K. (1999) The tetranspanin CD9 influences the adhesion, spreading, and pericellular fibronectin matrix assembly of Chinese hamster ovary cells on human plasma fibronectin. Exp. Cell Res. 251, 356 –371. 4. Clay, D., Rubinstein, E., Mishal, Z., Anjo, A., Prenant, M., Jasmin, C., Boucheix, C., and Bousse-Kerdies, M. L. (2001) CD9 and megakaryocyte differentiation. Blood 97(7), 1982–1989. 5. Anton, E. S., Hadjiargyrou, M., Patterson, P. H., and Matthew, W. D. (1995) CD9 plays a role in Schwann cell migration in vitro. J. Neurosci. 15(1), 584 –595. 6. Ikeyama, S., Koyama, M., Yamaoko, M., Sasada, R., and Miyake, M. (1993) Suppression of cell motility and metastasis by transfection with human moyility-related protein (MRP-1/CD9) DNA. J. Exp. Med. 177, 1231–1237. 7. Miyake, M., Inufusa, H., Adachi, M., Ishida, H., Hashida, H., Tokuhara, T., and Kakehi, Y. (2000) Suppression of pulmonary metastasis using adenovirally motility related protein-1 (MRP1/CD9) gene delivery. Oncogene 19, 5221–5226. 8. Higashiyama, M., Taki, T., Ieki, Y., Adachi, M., Huang, C. L., Koh, T., Kodama, K., Doi, O., and Miyake, M. (1995) Reduced motility related protein-1 (MRP-1/CD9) gene expression as a factor of poor prognosis in non-small cell lung cancer. Cancer Res. 55(24), 6040 – 6044. 9. Cajot, J. F., Sordat, I., Silvestre, T., and Sordat, B. (1997) Dif-
18.
19.
20.
21. 22.
23.
24.
25.
26.
896
ferential display cloning identifies motility-related protein (MRP1/CD9) as highly expressed in primary compared to metastatic human colon carcinoma cells. Cancer Res. 57(13), 2593– 2597. Maecker, H. T., Todd, S. C., and Levy, S. (1997) The tetraspanin superfamily: Molecular facilitators. FASEB J. 11(6), 428 – 442. Miao, W. M., Vasile, E., Lane, W. S., and Lawler, J. (2001) CD36 associates with CD9 and integrins on human blood platelets. Blood 97(6), 1689 –1696. Baudoux, B., Castanares-Zapatero, D., Leclercq-Smekens, M., Berna, N., and Poumay, Y. (2000) The tetraspanin CD9 associates with the integrin alpha6beta4 in cultured human epidermal keratinocytes and is involved in cell motility. Eur. J. Cell Biol. 79(1), 41–51. Rubinstein, E., Poindessous-Jazat, V., Le Naour, F., Billard, M., and Boucheix, C. (1997) CD9, but not other tetraspans, associate with the 1 integrin precursor. Eur. J. Immunol. 27, 1919 –1927. Yauch, R. L., and Hemler, M. E. (2000) Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem. J. 351, 629 – 637. Hebert, C., Norris, K., Della Coletta, R., Reynolds, M., Ordonez, J., and Sauk, J. J. (1999) Cell surface colligin/Hsp47 associates with tetraspanin protein CD9 in epidermoid carcinoma cell lines. J. Cell Biochem. 73(2), 248 –258. Zhang, X. A., Bontrager, A. L., and Hemler, M. E. (2001) Transmembrane-4 superfamily proteins associate with activated protein kinase C (PKC) and link PKC to specific b1 integrins. J. Biol. Chem. 276(27), 25005–25013. Ouchi, N., Kihara, S., Yamashita, S., Higashiyama, S., Nakagawa, T., Shimomura, I., Funahashi, T., Kameda-Takemura, K., Kawata, S., Taniguchi, N., and Matsuzawa, Y. (1997) Role of membrane-anched heparin-binding epidermal growth factor-like growth factor and CD9 on macrophages. Biochem. J. 328, 923– 928. Kaji, K., Takeshita, S., Miyake, K., Takai, T., and Kudo, A. (2001) Functional association of CD9 with the Fc␥ receptors in macrophages. J. Immunol. 166, 3256 –3265. Tai, X. G., Yashiro, Y., Abe, R., Toyooka, K., Wood, C. R., Morris, J., Long, A., Ono, S., Kobayashi, M., Hamaoka, T., Neben, S., and Fujiwara, H. (1996) A role for CD9 molecules in T cell activation. J. Exp. Med. 184(2), 753–758. Taylor, M. L., Noble, P. W., White, B., Wise, R., Liu, M. C., and Bochner, B. S. (2000) Extensive surface phenotyping of alveolar macrophages in interstitial lung disease. Clin. Immunol. 94(1), 33– 41. Baggiolini, M. (2001) Chemokines in pathology and medicine. J. Intern. Med. 250(2), 91–104. Stark, G. R., Kerr, I. M., Williams, B. R. G., Silverman, R. H., and Schreiber, R. D. (1998) How cells respond to interferons. Annu. Rev. Biochem. 67, 227–264. Ramana, C. V., Gil, M. P., Han, Y., Ransohoff, R. M., and Schreiber, R. D. (2001) Stat1-independent regulation of gene expression in response to IFN-␥. Proc. Natl. Acad. Sci. USA 98(12), 6674 – 6679. Le Naour, F., Francastel, C., Prenant, M., Lantz, O., Boucheix, C., and Rubinstein, E. (1997) Upregulation of CD9 expression during TPA treatment of K562 cells. Leukemia 11, 1290 –1297. Beinert, T., Munzing, S., Possinger, K., and Krombach, F. (2000) Increased expression of the tetraspanins CD53 and CD63 on apoptotic human neutrophils. J. Leuk. Biol. 67(3), 369 –373. Mollinedo, F., Martin-Martin, B., Gajate, C., and Lazo, P. A. (1998) Physiological activation of human neutrophils downregulates CD53 cell surface antigen. J. Leukoc. Biol. 63, 699 – 706.
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
27. Rubinstein, E., Benoit, P., Billard, M., Plaisance, S., Prenant, M., Uzan, G., and Boucheix, C. (1993) Organization of the human CD9 gene. Genomics 16(1), 132–138. 28. Hernandez-Torres, J., Yunta, M., and Lazo, P. A. (2001) Differential cooperation between regulatory sequences required for human CD53 gene expression. J. Biol. Chem. 276(38), 35405– 35413. 29. Ala-aho, H., Johansson, N., Grenman, R., Fusenig, N. E., LopezOtin, C., and Kahari, V. (2001) Inhibition of collagenase-3
(MMP-13) expression in transformed human keratinocytes by interferon-␥ is associated with activation of extracellular signalregulated kinase-1,2 and Stat1. Oncogene 19, 248 –257. 30. Barrios-Rodiles, M., and Chadee, K. (1998) Novel regulation of cyclooxygenase-2 expression and prostaglandin E2 production by IFN␥ in human macrophages. J. Immunol. 161, 2441–2448. 31. Sharma, B., and Iozzo, R. V. (1998) Transcriptional silencing of perlecan gene expression by interferon-␥. J. Biol. Chem. 273(8), 4642– 4646.
897
Down-Regulation of Macrophage CD9 Expression by Interferon-␥ Xue-Qing Wang,* Glenn F. Evans,* M. Leticia Alfaro,† and Steven H. Zuckerman* ,1 *Division of Cardiovascular Research, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285; and †Universidad Auto´noma Metropolitana-Xochimilco, Mexico
Received December 12, 2001
CD9, a member of the tetraspanin family is a cell surface marker expressed on myeloid and nonmyeloid as well as on neoplastic cells. The present study has focused on the role of inflammation and macrophage activation in the regulation of CD9 expression. We report that the expression of CD9 on primary cultures of murine peritoneal macrophages was down regulated by Interferon-␥, IFN-␥. This down regulation was concentration-dependent and maximal by 48 h. The changes in surface expression were consistent with similar reductions in CD9 protein and message levels by Western and Northern blot analyses. The mechanism by which IFN-␥ decreases CD9 expression appears to be through the Stat1 signaling pathway as Stat1 knockout mice did not demonstrate any reduction in CD9 expression by IFN-␥ treatment. These results represent the first evidence for the down regulation of CD9 expression with macrophage activation. © 2002 Elsevier Science (USA)
Key Words: tetraspanin; macrophage; inflammation; Stat1.
CD9 is a member of the tetraspanin family and is expressed on both hematopoietic and nonhematopoietic cells (1). Tetraspanins in general and CD9 in specific have been implicated in the regulation of cell motility, differentiation, proliferation, and signaling (2– 5). CD9 transfection into CHO, MHO10, ARH77, and MAC 10 cells for example, inhibited cell motility with inhibition proportional to the amount of CD9 expressed (6). Consistent with these studies, in vivo observations on CD9 expression in various neoplasias have reported an inverse correlation between the amount of CD9 expressed and the extent of tumor metastasis and malignancy in human breast cancer, colon carcinoma, and melanomas (7–9). In distinction, an antibody against 1 To whom correspondence should be addressed. Fax: 317-4332815. E-mail: [email protected].
CD9 enhanced Schwann cell migration among a panel of antibodies to Schwann cell surface antigens (5). In addition to a potential role in modulating cell motility, CD9 may also serve as a cell surface molecular organizer to facilitate cross-talk between different surface receptors (10). CD9 as well as the other tetraspanins appear to be promiscuous in their association with other surface markers and receptors. CD9 has been reported to be associated with CD36 in platelets (11), with ␣64 integrin in human epidermal keratinocytes (12), and with 1 integrin subunits in human HEL and NALM-6 cell lines (13). CD9 has also been observed to associate with intracellular proteins including PI 4 kinase (14), heat shock proteins (15), and with protein kinase C (PKC) isozymes upon their translocation to the plasma membrane (16). The reported association of PKC with the tetraspanins CD9, CD53, CD81, CD82, and CD151 may provide a framework for PKC association with specific integrins (16). The concept of CD9 and the other tetraspanins as scaffolds which promote interactions between surface receptors and matrix components and modulate cellular motility would suggest a fundamental role for tetraspanins on macrophage functions. In macrophages, CD9 has been reported to be associated with membrane-anchored HB-EGF and enhanced its juxtacrine mitogenic activity (17). Other evidence supporting a role for CD9 in macrophage function are studies reporting that antibody cross-linking CD9 and Fc-␥ receptor led to macrophage activation as indicated by tyrosine phosphorylation and cell aggregation (18). CD9 ligation in other cell types can also indirectly effect macrophage activation as evidenced by the report that its ligation on T cells resulted in T-cell activation (19). However, while the role for CD9 in modulating the cellular response to matrix components and motility is suggestive, regulation of CD9 expression in general and on macrophages in specific is less well understood. CD9 expression has been reported to increase in the human monocytic leukemic cell line THP-1 upon phor-
891
0006-291X/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
bol ester induced differentiation (17). In addition, increased CD9 expression was observed on macrophages from interstitial lung disease patients, and this increase was inversely correlated with disease (20). Clearly, an understanding of the regulation of CD9 expression in macrophages may provide a greater understanding of how macrophage activation results in changes in cell motility and matrix interactions. Macrophages within the microenvironment of an inflammatory locus are subjected to both macrophage activating cytokines such as IFN-␥, GM-CSF, CSF-1 as well as de-activating cytokines including IL-10 and TGF (21). The present study was designed to determine the effects of macrophage activation on CD9 expression in murine peritoneal macrophages using IFN-␥. The results of this study demonstrate that CD9 expression is down-regulated by IFN-␥ and that this effect was both concentration and time dependent. Furthermore the down-regulation of CD9 expression was apparent at both the protein and message levels and was mediated through the Stat1 signaling pathway. Macrophages from Stat1 knockout mice failed to demonstrate any reduction in CD9 expression by IFN-␥. These results demonstrate that CD9 expression is down-regulated by IFN-␥ and that this down regulation may explain in part the changes observed in matrix interaction and cell motility following macrophage activation. MATERIALS AND METHODS Cell culture. Peritoneal macrophages were obtained from thioglycolate-elicited BALB/c mice or Stat1 KO, 129S6/SvEv-Stattm1 (Taconic, Germantown, NY), and the parent line 129S6/SvEv, by lavage and cultured in RPMI 1640 medium containing 2% FCS serum (Hyclone Laboratories, Logan, UT). After adherence for at least 2 h, macrophages were washed twice and incubated with recombinant murine IFN-␥ (Biosource International, Camarillo, CA). In select experiments, kinase inhibitors including the tyrosine kinase inhibitor AG490, the MEK inhibitor PD98059, the PKA inhibitor H-89 or the P38 inhibitor SB203580 (Calbiochem, San Diego, CA) were added to evaluate their effects on inhibiting the changes in CD9 expression associated with IFN-␥ treatment. Flow cytometry. Macrophage cultures were stimulated with IFN-␥ at the indicated concentrations for 48 h prior to evaluation by flow cytometry. Cells were then washed three times with cold flow buffer (Hank’s buffer with 10 mM Hepes, 1% BSA, 0.1% azide), and incubated with monoclonal antibodies directed against CD9, CD11a, CD53, or CD81 (BD Pharmingen, San Diego, CA) at final concentrations of 4 g/ml in the same buffer on ice for at least 1 h. Following staining with PE-conjugated secondary antibody, cells were detached by a rubber policeman. All flow cytometry experiments were evaluated on 10,000 individual cells gated for macrophages, based on their forward and side light-scatter profiles. The mean fluorescence intensity, MFI, was measured using a Becton Dickinson FacSort with Cellquest software (Becton Dickinson, San Jose, CA). Northern blots. Total RNA and subsequently polyA RNA were isolated using RNA isolation kits (Qiagen, Santa Clarita, CA). PolyAenriched RNA, 0.5 g per lane, was separated by 0.7% formaldehyde agarose gels and transferred to Nytran nylon membrane over night
using the turboblotter system (Schliecher and Schuell Inc., Keene, NH). Membranes were prehybridized in hybridization buffer and hybridized with [␣- 32P]dATP DNA probes labeled by random primers (GIBCO, Grand Island, NY) in fresh hybridization buffer. CD9 probes were polymerase chain reaction-amplified using sense (ACTATGGCTCCGATTCGACTCTCA) and antisense (CCACTGCTCCAATGATGTGGAACT) primer sets. CD81 probes were amplified using sense (TGATCCACAGACCACCAGCCTGTC) and antisense (ACAGCACCATGCTCAGAATCATCT) and S29 probes were designed and amplified as previously described. Membranes were washed in 2⫻ SSC (saline-solution citrate buffer) and exposed either to Kodak Biomax-MS film or to Phosphoscreen. Quantitation was performed using a PhosphorImager (Molecular Dynamics) with normalization based on the tetraspanin signal relative to the hybridization intensity of the S29 band. Immunoblots. Untreated or macrophages after activation with IFN-␥ for 48 h were lysed in RIPA buffer and clarified lysates (50 l) were added to SDS-sample buffer and run on 12% Tris-glycine gels under reducing conditions. The proteins were transferred onto nitrocellulose membranes which were blocked with 3% BSA plus 4% dried milk in TBS buffer with 0.1% Tween-20 for at least 1 h, and subsequently incubated with antibodies against CD9 or ERKs (1:2000 dilution) overnight at 4°C. The membranes were washed extensively and incubated with peroxidase conjugated secondary antibodies for 1 h. Detection was by SuperSignal West Dura Extended Duration Substrate (Pierce).
RESULTS Macrophage activation by IFN-␥ has been demonstrated to result in changes in both surface receptor expression as well in increase macrophage effector functions (22). In the present study the effects of IFN-␥ on tetraspanin expression were evaluated with CD9 as the focus. Therefore, primary cultures of murine peritoneal macrophages from BALB/c mice were stimulated with IFN-␥, 200 units/ml, for 48 h and changes in the expression of CD9, and as a positive control, CD11a were evaluated by flow cytometry. As shown (Fig. 1), the expression of CD9 decreased by approximately 65% (with mean fluorescence intensity decreasing from 1277 to 446) whereas the expression of CD11a was increased significantly following IFN-␥ stimulation (from 153 to 1864). The down-regulation of CD9 was dependent on both the IFN-␥ concentration and the duration of exposure. Macrophages incubated with IFN-␥ for 48 h exhibited a reduction in CD9 that was apparent at five units/ml IFN-␥ and was maximal by 50 units/ml (Fig. 2A). The effects of IFN-␥, 100 units/ ml, were also detected by 24 h and maximal at 48 h with no further changes observed (Figs. 2B). This would suggest that the decrease in CD9 expression was due to changes in the levels of CD9 message or protein. The effect of IFN-␥ on CD9 expression was not generally observed with other tetraspanin members as neither CD53 nor CD81 were down-regulated to the same extent (Fig. 3). In these studies, relative to the non IFN-␥ treated controls, CD9 was down-regulated by approximately 55%, whereas CD53 and CD81 showed a 20% reduction. Therefore, the decrease in CD9 ex-
892
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Macrophage activation by IFN-␥ results in CD9 down-regulation. Macrophages from BALB/c mice were incubated in the presence (bold line) or absence (normal line) with 200 units/ml of IFN-␥ for 48 h and CD9 and CD11a was quantitated by flow cytometry. Note the minimal staining for the relevant IgG control (dotted line). Representative experiment of 5.
pression following macrophage activation was more pronounced than that observed with at least two other members of the tetraspanin family. In an attempt to determine whether the reduction in CD9 surface expression correlated with total protein and message levels, macrophages were activated with varying concentrations of IFN-␥ for 48 h and then lysed and evaluated by Western blot (Fig. 4) and Northern blot (Fig. 5) analysis. As demonstrated (Fig. 4), IFN-␥ activated macrophages exhibited reduced levels of CD9 as detected by Western blots. In distinction the level of total ERKs remained relatively constant across IFN-␥ concentrations from 0 to 500 units/ml. These results were consistent with the changes detected by flow cy-
FIG. 2. IFN-␥ down regulation of CD9 expression in macrophages was concentration and time dependent. IFN-␥ effects on CD9 down-regulation were concentration dependent following 48 h treatment, with maximal effects at 50 units/ml (A). CD9 down-regulation by 100 units/ml IFN-␥ was time dependent with maximal effects by 48 h (B). Brackets indicate the standard deviation of the mean of duplicate cultures. Differences relative to the untreated or zero time point were significant (P ⬍ 0.001) by a 2 tailed unpaired Student’s t-test.
tometry at the membrane surface. Northern blot analysis was then performed (Fig. 5) to determine whether the changes in total protein reflected similar changes in steady state levels of CD9 mRNA. The results (Fig. 5A) demonstrate that IFN-␥ activated macrophages have reduced levels of CD9 message whereas the levels of S29 message, used for normalization remained constant. Quantitation of the band intensities (Fig. 5B) suggested an approximately 2.5-fold reduction in CD9 message following 48 h incubation with IFN-␥. In distinction, IFN␥ had a more modest effect on CD81 mRNA levels (Fig. 5C), which did not achieve statistical significance (Fig. 5D). This result, consistent with the flow cytometry studies (Fig. 3), suggests that the down-regulation of CD9 expression by IFN␥ did not reflect a more general effect of IFN␥ on other members of the tetraspanin family. Transcriptional regulation by IFN-␥ occurs through both Stat1 dependent and independent pathways (22,
FIG. 3. IFN␥-mediated down-regulation of CD9 was more significant than its effects on other members of the tetraspanin family. Macrophages were treated with 200 units/ml IFN-␥ for 48 h, and surface expression of CD9, CD53, and CD81 was evaluated by flow cytometry. Brackets indicate the standard deviation of the mean from triplicate cultures. Representative experiment of 4.
893
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. IFN␥ down regulates CD9 protein levels. Macrophages were treated with IFN-␥ at the indicated concentrations for 48 h. Cells were lysed, clarified proteins were separated by SDS–PAGE, and transferred to nitrocellulose membranes. CD9 protein was detected by Western blot analysis. Immunodetection of the ERKs on the same blot was used for normalization. Representative experiment of 3.
23). In an attempt to determine whether the effects of IFN-␥ on CD9 expression were also dependent on the Stat1 pathway, macrophages from wild-type or Stat1 deficient mice were treated with IFN-␥ for 48 h and CD9 surface expression was analyzed by flow cytometry. As demonstrated (Fig. 6), whereas macrophages from the wild-type line 129S6/SvEv responded to IFN-␥ treatment with a decrease in CD9 expression, macrophages from Stat1 knockout mice did not demonstrate any reduction in CD9. This result demonstrates that the Stat1 pathway is necessary and sufficient for the ability of IFN-␥ activated macrophages to
FIG. 6. IFN-␥-mediated down-regulation of CD9 expression was dependent on the Stat1 signaling pathway. Macrophages from control or Stat1 knockout mice were treated with 200 units/ml IFN-␥ for 48 h. CD9 expression was quantified by flow cytometry, brackets indicate the standard deviation of the mean across duplicate cultures. CD9 decrease in the control macrophages by IFN-␥ was significant (P ⬍ 0.001) by a two-tailed Student’s t-test.
down-regulate CD9 expression. Finally, in an attempt to implicate the Stat1 signaling pathway in wild-type mice, macrophages from BALB/c mice were incubated with optimal concentrations of the JAK2 kinase inhibitor AG490. Cotreatment of macrophages with IFN-␥ and AG490 inhibited approximately 50% of the IFN-␥ effect on CD9 (Table 1). Similar treatments with MEK, PKA, or P38 inhibitors had modest (MEK) or no inhibitory effects (PKA, P38) on IFN-␥ signaling for CD9 down-regulation. Collectively, these results demonstrate that macrophage activation results in the downregulation of the tetraspanin CD9 and that these effects are mediated through the Stat1 pathway. DISCUSSION Tetraspanins as a family are characterized by a similarity in membrane organization with hydrophobic domains enabling these proteins to traverse the memTABLE 1
Kinase Inhibitor Effects on IFN-␥-Mediated Down Regulation of CD9 FIG. 5. IFN-␥ down regulates CD9 message without similar effects on CD81. Macrophages were treated with 200 units/ml IFN␥ for 48 h and polyA RNA was isolated and subjected to Northern blot analysis by using PCR-labeled probes for CD9, CD81, and S29 (A, C). Quantitation of the CD9 and CD81 hybridization signals were by PhosphorImager, and expression was adjusted to S29 as an internal standard (B, D). Brackets indicate the standard deviation of the mean from three separate experiments. The decrease in CD9 message relative to the control was significant (P ⬍ 0.001) by an unpaired two-tailed Student’s t-test. The decrease in CD81 message did not achieve significance.
Inhibitor a
Specificity
Concentration (M)
% Inhibition of IFN␥ effect b
AG490 PD98059 H-89 SB203580
JAK2 MEK PKA P38
50 50 10 50
53 30 0 0
a Macrophages were incubated with the designated inhibitors for 48 h in the presence of 200 units/ml IFN-␥. b CD9 expression was quantitated by flow cytometry and expressed relative to the vehicle control.
894
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
brane four times and a single major extracellular loop, presumably the recognition site for ligand binding (10). While there are many members to this family including CD9, CD53, CD63, CD81, and CD82 they all share this similar structure and are ubiquitous in their tissue distribution (10). Furthermore, the tetraspan family has been reported to associate with a variety of other cellular proteins including intracellular enzymes through integrins (14 –16) and as such, function as scaffolds to generate appropriate macromolecular complexes to respond to extracellular stimuli (10 –12). However, at present the precise ligands for any of the tetraspanin members remains unknown. Regulation of tetraspanin expression has been described in a variety of cell systems in an attempt to further understand the function of these proteins. In the present study, CD9 expression was evaluated in primary cultures of murine peritoneal macrophages and was down regulated at the message and protein levels following macrophage activation with IFN-␥. This down-regulation was not a general observation for other members of the tetraspanin family as effects on CD53 or CD81 were minimal. This represents, to the best of our knowledge, the first report demonstrating the down-regulation of CD9 expression by inflammatory stimuli such as IFN-␥. In distinction to this down-regulation associated with macrophage activation, a previous study in the human monocytic leukemic cell line THP-1 reported an up-regulation of CD9 following phorbol ester induced differentiation (17). A similar observation was reported for the human megakaryocytic line K562 (24). While the basis for these differences are not clear, the cell systems in which these observations have been made are quite distinct. THP1 and K562 are cell lines derived from primary tumors immortalized as a premonocytic or pluripotential hematopoietic line, respectively, that can be induced to terminal differentiation with phorbol esters. Therefore the increase in CD9 is consistent with a maturation of these lines to a more mature phenotype. In contrast, the present study has focused on primary cultures of mature murine peritoneal macrophages that are already differentiated and IFN-␥ results in further cellular activation. To this extent, it will be of interest to evaluate the effects of IFN-␥ on CD9 expression in phorbol ester differentiated THP1 cells. Regulation of other members of the tetraspanin family have been investigated in primary human blood cells. CD53 and CD63 for example have been reported to be up-regulated in human neutrophils undergoing apoptosis (25). In distinction, incubation of human neutrophils with either TNF, platelet activating actor, or the chemotactic peptide formyl-methionine-leucinephenylalanine resulted in a rapid decrease in CD53 expression due to the posttranslational activation of a
membrane protease responsible for cleaving CD53 (26). While the present study cannot exclude a contributing role for such a process in CD9 regulation the kinetics for this down-regulation (apparent at 24 h and maximal by 48 h) versus the neutrophil study which was maximal by 1 h and insensitive to actinomycin D suggests a different level of regulation. Whereas the precise mechanism by which CD9 is down-regulated by IFN-␥ remains unclear there are cis-acting sites within the CD9 and CD53 promoters which could regulate tetraspanin expression at the transcriptional level (24, 27). The human CD9 promoter for example, is characterized by having a 120 bp GC rich region containing multiple Sp1 binding sites and a consensus sequence for binding of zinc finger proteins (27). Evidence for both positive and negative regulatory sites have been reported within the CD53 promoter between ⫺266 and ⫹84 nucleotides including Sp1 and ets-1 sites (28). Mutational analysis revealed PuF and E4BP4 elements that function as negative regulators in select cell lines. Interestingly, these sites as well as others can function in a positive, neutral, or negative regulatory mode depending on the cell line for which the promoter studies were evaluated. These cellrelated differences in the function of cis-acting sites could also potentially explain the differences in CD9 expression between transformed human monocytic lines and murine peritoneal macrophages. Recent studies have demonstrated that IFN-␥ signaling can occur through Stat1 dependent as well as Stat1 independent pathways (22, 23). These studies reported that both fibroblasts and bone marrow derived macrophages from Stat1 KO mice are capable of responding to IFN-␥ with the induction of genes seen in both wild-type and Stat1 KO mice. Examples include osteopontin, c-Jun, and suppressors of cytokine signaling, SOCS-2 and 3 in fibroblasts, and both chemokines and the chemokine receptor CXCR4 in macrophages (23). These studies raised the question as to whether the effects of IFN-␥ on down-regulating CD9 expression may have been mediated in part or completely independent of the Stat1 pathway. As the present study demonstrates, the down-regulation of CD9 expression following macrophage activation with IFN-␥ was dependent on the Stat1 pathway as similar effects were not apparent in macrophages from Stat1 KO mice. A similar, although less significant inhibition of the IFN-␥ effect was demonstrated with the JAK2 kinase inhibitor AG490 in BALB/c macrophages. This partial inhibition may be related either to an inability to completely inhibit JAK2 activity or that Stat1 phosphorylation can occur by other kinases (29). The precise mechanism(s) by which Stat1 activation in these elicited macrophages leads to a reduction in CD9 expression remains to be defined. Transcriptional repression by IFN-␥ has been reported for other genes related
895
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
to inflammation. IFN-␥-activated macrophages in one study for example, had 40 – 60% lower levels of COX-2 mRNA, protein expression, and PGE2 production as compared with untreated macrophages (30). Moreover, IFN-␥ inhibited mRNA expression for the chemokines MIP-1␣, MIP-1, MCP-1, and KC in macrophages (29). Similar to these observations, IFN-␥ has been reported to reduce perlecan promoter activity (31). In the perlecan promoter analysis, multiple GAS elements were shown to be necessary for the inhibitory effect of IFN-␥. Therefore, while IFN-␥ mediated macrophage activation is generally viewed as a process increasing macrophage effector functions it is also associated with a down-regulation of many genes including, as demonstrated in the present study, the tetraspanin CD9. Both the precise mechanism by which this occurs as well as determining whether this down-regulation is associated with changes in the macromolecular complexes for which CD9 serves as a potential scaffold for, are areas currently under investigation.
10. 11.
12.
13.
14.
15.
16.
ACKNOWLEDGMENT The authors wish to acknowledge Dr. Chandrasekhar (Lilly Research Labs) for his review of our manuscript.
17.
REFERENCES 1. Boucheix, C., Perrot, J. Y., Mirshahi, M., Giannoni, F., Billard, M., Bernadou, A., and Rosenfeld, C. (1985) A new set of monoclonal antibodies against acute lymphoblastic leukemia. Leuk. Res. 9(5), 597– 604. 2. Hadjiargyrou, M., and Patterson, P. H. (1995) An anti-CD9 monoclonal antibody promotes adhesion and induces proliferation of Schwann cells in vitro. J. Neurosci. 15(1), 574 –583. 3. Cook, G. A., Wilkinson, D. A., Crossno, J. T., Jr., Raghow, R., and Jennings, L. K. (1999) The tetranspanin CD9 influences the adhesion, spreading, and pericellular fibronectin matrix assembly of Chinese hamster ovary cells on human plasma fibronectin. Exp. Cell Res. 251, 356 –371. 4. Clay, D., Rubinstein, E., Mishal, Z., Anjo, A., Prenant, M., Jasmin, C., Boucheix, C., and Bousse-Kerdies, M. L. (2001) CD9 and megakaryocyte differentiation. Blood 97(7), 1982–1989. 5. Anton, E. S., Hadjiargyrou, M., Patterson, P. H., and Matthew, W. D. (1995) CD9 plays a role in Schwann cell migration in vitro. J. Neurosci. 15(1), 584 –595. 6. Ikeyama, S., Koyama, M., Yamaoko, M., Sasada, R., and Miyake, M. (1993) Suppression of cell motility and metastasis by transfection with human moyility-related protein (MRP-1/CD9) DNA. J. Exp. Med. 177, 1231–1237. 7. Miyake, M., Inufusa, H., Adachi, M., Ishida, H., Hashida, H., Tokuhara, T., and Kakehi, Y. (2000) Suppression of pulmonary metastasis using adenovirally motility related protein-1 (MRP1/CD9) gene delivery. Oncogene 19, 5221–5226. 8. Higashiyama, M., Taki, T., Ieki, Y., Adachi, M., Huang, C. L., Koh, T., Kodama, K., Doi, O., and Miyake, M. (1995) Reduced motility related protein-1 (MRP-1/CD9) gene expression as a factor of poor prognosis in non-small cell lung cancer. Cancer Res. 55(24), 6040 – 6044. 9. Cajot, J. F., Sordat, I., Silvestre, T., and Sordat, B. (1997) Dif-
18.
19.
20.
21. 22.
23.
24.
25.
26.
896
ferential display cloning identifies motility-related protein (MRP1/CD9) as highly expressed in primary compared to metastatic human colon carcinoma cells. Cancer Res. 57(13), 2593– 2597. Maecker, H. T., Todd, S. C., and Levy, S. (1997) The tetraspanin superfamily: Molecular facilitators. FASEB J. 11(6), 428 – 442. Miao, W. M., Vasile, E., Lane, W. S., and Lawler, J. (2001) CD36 associates with CD9 and integrins on human blood platelets. Blood 97(6), 1689 –1696. Baudoux, B., Castanares-Zapatero, D., Leclercq-Smekens, M., Berna, N., and Poumay, Y. (2000) The tetraspanin CD9 associates with the integrin alpha6beta4 in cultured human epidermal keratinocytes and is involved in cell motility. Eur. J. Cell Biol. 79(1), 41–51. Rubinstein, E., Poindessous-Jazat, V., Le Naour, F., Billard, M., and Boucheix, C. (1997) CD9, but not other tetraspans, associate with the 1 integrin precursor. Eur. J. Immunol. 27, 1919 –1927. Yauch, R. L., and Hemler, M. E. (2000) Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem. J. 351, 629 – 637. Hebert, C., Norris, K., Della Coletta, R., Reynolds, M., Ordonez, J., and Sauk, J. J. (1999) Cell surface colligin/Hsp47 associates with tetraspanin protein CD9 in epidermoid carcinoma cell lines. J. Cell Biochem. 73(2), 248 –258. Zhang, X. A., Bontrager, A. L., and Hemler, M. E. (2001) Transmembrane-4 superfamily proteins associate with activated protein kinase C (PKC) and link PKC to specific b1 integrins. J. Biol. Chem. 276(27), 25005–25013. Ouchi, N., Kihara, S., Yamashita, S., Higashiyama, S., Nakagawa, T., Shimomura, I., Funahashi, T., Kameda-Takemura, K., Kawata, S., Taniguchi, N., and Matsuzawa, Y. (1997) Role of membrane-anched heparin-binding epidermal growth factor-like growth factor and CD9 on macrophages. Biochem. J. 328, 923– 928. Kaji, K., Takeshita, S., Miyake, K., Takai, T., and Kudo, A. (2001) Functional association of CD9 with the Fc␥ receptors in macrophages. J. Immunol. 166, 3256 –3265. Tai, X. G., Yashiro, Y., Abe, R., Toyooka, K., Wood, C. R., Morris, J., Long, A., Ono, S., Kobayashi, M., Hamaoka, T., Neben, S., and Fujiwara, H. (1996) A role for CD9 molecules in T cell activation. J. Exp. Med. 184(2), 753–758. Taylor, M. L., Noble, P. W., White, B., Wise, R., Liu, M. C., and Bochner, B. S. (2000) Extensive surface phenotyping of alveolar macrophages in interstitial lung disease. Clin. Immunol. 94(1), 33– 41. Baggiolini, M. (2001) Chemokines in pathology and medicine. J. Intern. Med. 250(2), 91–104. Stark, G. R., Kerr, I. M., Williams, B. R. G., Silverman, R. H., and Schreiber, R. D. (1998) How cells respond to interferons. Annu. Rev. Biochem. 67, 227–264. Ramana, C. V., Gil, M. P., Han, Y., Ransohoff, R. M., and Schreiber, R. D. (2001) Stat1-independent regulation of gene expression in response to IFN-␥. Proc. Natl. Acad. Sci. USA 98(12), 6674 – 6679. Le Naour, F., Francastel, C., Prenant, M., Lantz, O., Boucheix, C., and Rubinstein, E. (1997) Upregulation of CD9 expression during TPA treatment of K562 cells. Leukemia 11, 1290 –1297. Beinert, T., Munzing, S., Possinger, K., and Krombach, F. (2000) Increased expression of the tetraspanins CD53 and CD63 on apoptotic human neutrophils. J. Leuk. Biol. 67(3), 369 –373. Mollinedo, F., Martin-Martin, B., Gajate, C., and Lazo, P. A. (1998) Physiological activation of human neutrophils downregulates CD53 cell surface antigen. J. Leukoc. Biol. 63, 699 – 706.
Vol. 290, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
27. Rubinstein, E., Benoit, P., Billard, M., Plaisance, S., Prenant, M., Uzan, G., and Boucheix, C. (1993) Organization of the human CD9 gene. Genomics 16(1), 132–138. 28. Hernandez-Torres, J., Yunta, M., and Lazo, P. A. (2001) Differential cooperation between regulatory sequences required for human CD53 gene expression. J. Biol. Chem. 276(38), 35405– 35413. 29. Ala-aho, H., Johansson, N., Grenman, R., Fusenig, N. E., LopezOtin, C., and Kahari, V. (2001) Inhibition of collagenase-3
(MMP-13) expression in transformed human keratinocytes by interferon-␥ is associated with activation of extracellular signalregulated kinase-1,2 and Stat1. Oncogene 19, 248 –257. 30. Barrios-Rodiles, M., and Chadee, K. (1998) Novel regulation of cyclooxygenase-2 expression and prostaglandin E2 production by IFN␥ in human macrophages. J. Immunol. 161, 2441–2448. 31. Sharma, B., and Iozzo, R. V. (1998) Transcriptional silencing of perlecan gene expression by interferon-␥. J. Biol. Chem. 273(8), 4642– 4646.
897