Downregulation of common cytokine receptor γ chain inhibits inflammatory responses in macrophages stimulated with Riemerella anatipestifer

Developmental and Comparative Immunology 81 (2018) 225e234

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Downregulation of common cytokine receptor g chain inhibits inflammatory responses in macrophages stimulated with Riemerella anatipestifer Fahmida Afrin a, Cherry P. Fernandez a, Rochelle A. Flores a, Woo H. Kim a, c, Jipseol Jeong b, Hong H. Chang c, Suk Kim a, Hyun S. Lillehoj d, Wongi Min a, * a

College of Veterinary Medicine & Institute of Animal Medicine, Gyeongsang National University, Jinju 52828, South Korea Environmental Health Research Division, National Institute of Environmental Research, Incheon 22689, South Korea Department of Animal Science, College of Agriculture, Gyeongsang National University, Jinju 52828, South Korea d Animal Biosciences and Biotechnology Laboratory, Agricultural Research Service, United States Department of Agriculture, Beltsville, MD 20705, USA b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 October 2017 Received in revised form 9 December 2017 Accepted 9 December 2017 Available online 11 December 2017

Th17-cell-mediated inflammation is affected by the soluble form of common cytokine receptor g chain (gc). We previously suggested that inflammatory cytokines including interleukin (IL)-17A are associated with Riemerella anatipestifer infection, which a harmful bacterial pathogen in ducks. Here, the expression profiles of membrane-associated gc (dugc-a) and soluble gc (dugc-b) in R. anatipestifer-stimulated splenic lymphocytes and macrophages, and in the spleens and livers of R. anatipestifer-infected ducks, were investigated. In vitro and in vivo results indicated that the expression levels of both forms of gc were increased, showing that marked increases were detected in the expression of the dugc-b form rather than the dugc-a form. Treatment with gc-specific siRNA downregulated mRNA expression of Th17-related cytokines, including IL-17A and IL-17F, in duck splenic macrophages stimulated with R. anatipestifer, whereas the expressions of interferon (IFN)-g and IL-2 were enhanced. The results showed that the upregulation of gc, especially the dugc-b form, was associated with expression of Th17-related cytokines during R. anatipestifer infection. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Ducks Riemerella anatipestifer infection Common cytokine receptor g chain Inflammatory cytokines Small interfering RNAs

1. Introduction Riemerella anatipestifer infection is a significant disease confronting the duck industry worldwide. R. anatipestifer is a gramnegative, non-motile, and non-sporulating bacterium (Ruiz and Sandhu, 2013). To date, at least 21 serotypes of R. anatipestifer that vary in virulence both between and sometimes within a given serotype have been identified, with no significant cross-protection between these serotypes (Sandhu and Leister, 1991; Pathanasophon et al., 2002). R. anatipestifer infection causes an acute or chronic septicemia, polyserositis, fibrinous pericarditis, perihepatitis, and airsacculitis, which leads to high mortality and weight loss, and consequently to major economic losses in duck farmers (Ruiz and Sandhu, 2013). Thus, several studies have been

* Corresponding author. College of Veterinary Medicine, Gyeongsang National University, 501 Jinju-daero, Jinju, Gyeongnam 52828, South Korea. E-mail address: [email protected] (W. Min). https://doi.org/10.1016/j.dci.2017.12.009 0145-305X/© 2017 Elsevier Ltd. All rights reserved.

performed to understand the host immune responses to R. anatipestifer. Using immunoproteomics, a variety of immunogenic proteins were identified using duck or rabbit antisera to R. anatipestifer (Hu et al., 2012; Zhai et al., 2012). Host genes related to inflammatory responses were identified in the liver of R. anatipestifer-infected ducks (Zhou et al., 2013). Recently, we suggested that upregulation of interleukin (IL)-17A in ducks was strongly associated with Riemerella infection, by comparative expression analyses of immune-related genes in R. anatipestiferinfected tissues obtained from chickens and ducks (Fernandez et al., 2016, 2017; Diaz et al., 2016). The IL-17 family of cytokines consists of six members (IL-17A to IL-17F) with varying degrees of intermolecular amino acid sequence homology and related biological activities in mammals (Korn et al., 2009; Min et al., 2013). IL-17A is the best characterized family member and is produced mainly by IL-17A-producing CD4þ T helper cells, also called Th17 cells. IL-17A is produced by multiple cell types including Th17 cells, lymphoid tissue inducer-like cells, gd T cells, invariant natural killer T (iNKT) cells, NKT cells, mast cells,

226

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

and neutrophils (Pappu et al., 2011; Reynolds et al., 2010). Th17 cell development and differentiation is influenced by various cytokines, with distinct roles for IL-6, transforming growth factor beta (TGFb), IL-1b, IL-21, and IL-23 (Bhaumik and Basu, 2017; Reynolds et al., 2010). Thus, IL-17A plays a critical role in host protective immunity against various microbial pathogens and tissue inflammation, and aberrant IL-17A expression is involved in the pathogenesis of several inflammatory disorders (Pappu et al., 2011; Chen and Kolls, 2017). Recent studies suggested that exacerbation of Th17 cellmediated inflammation can be affected by the soluble form of the common cytokine receptor g chain (gc) (Hong et al., 2014; Lee and Hong, 2015). The gc, which is also known as interleukin-2 receptor (IL-2Rg) or CD132, is a subunit shared by the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21, and it is expressed on T cells, B cells, NK cells, monocytes, macrophages, granulocytes, and dendritic cells, where it mediates lymphoid development, proliferation, and homeostasis in both innate and acquired immunity (Walsh, 2012; Overwijk and Schluns, 2009). Our previous studies identified conventional and soluble forms of gc (sgc) in birds that can be generated by alternative splicing of mRNA transcripts lacking a transmembrane region (in ducks) or by proteolytic cleavage (in chickens) (Min et al., 2002; Jeong et al., 2011, 2015). Thus, we were interested in elucidating the role of the gc gene in the upregulation of IL-17A expression during R. anatipestifer infection in ducks, and we have demonstrated here that reduced expression of the gc gene by gc-specific small interfering RNA (sigc) downregulated the expression of inflammatory cytokines, including IL-17A. 2. Materials and methods 2.1. Animals and infections Peking ducklings (Anas platyrhynchos) were obtained from Joowon ASTA Ducks (Gyeongnam, Korea) and given unlimited access to antibacterial/anticoccidial-free feed and water. Constant light was provided for the duration of the experiments. Two-weekold ducks were randomly divided into two groups (infected and non-infected) with separate housing for each group. R. anatipestifer serotype 7 was grown on 5% sheep blood agar plates (Asan Pharmaceutical, Seoul, Korea) at 37  C in 5% CO2. A single colony was inoculated into tryptic soy broth (Difco, Livonia, MI, USA) and incubated in a shaking incubator at 37  C until growth phase was achieved. The final inoculum concentration was determined by plating 0.1 mL of 10-fold serial dilutions onto 5% sheep blood agar plates. Ducks were infected intramuscularly with 0.2 mL suspensions containing 5  107 colony-forming unit (CFU) R. anatipestifer. The same volume of phosphate-buffered saline (PBS) was provided to the control ducks. Spleens and livers were collected from each group of ducks at 4 and 7 days post-infection. Animal sustenance and experiments were accomplished in accordance with the Gyeongsang National University Guidelines for the Care and Use of Experimental Animals and approved by the Institutional Animal Care and Use Committee (IACUC) of Gyeongsang National University, Jinju, Korea (GNU-150504-C0026). 2.2. Bacterial recovery Bacteria were recovered from 0.1 g liver and 0.05 g duck spleen, and were aseptically collected and homogenized separately in 500 mL tryptic soy broth using tissue homogenizers. Homogenized samples were diluted serially 10- or 100-fold, plated on 5% sheep blood agar plates, and incubated at 37  C under 5% CO2. The bacterial colonies were calculated as CFU/g tissue.

2.3. In vitro stimulation of splenic lymphocytes and macrophages From two- or three-week-old healthy ducks, spleens were collected, minced, and sieved with a 40-mm nylon strainer. Splenic lymphocytes were isolated using Ficoll-Paque™ PLUS (GE Healthcare Life Sciences, Hertfordshire, UK) following the manufacturer's instructions, washed with PBS, and cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (10,000 unit/mL) (Hyclone), then incubated at 41  C in 5% CO2. Splenic lymphocytes were resuspended to 5  106 cells/mL in 6well plates, and stimulated with heat-killed R. anatipestifer (1  106 CFU/mL) for 12 h or 24 h. Spleen cells for macrophages were cultured at 106 cells/mL for approximately 3 h at 41  C in 5% CO2, as previously described (Chung et al., 2000; Kim et al., 2003). Briefly, nonadherent cells were removed by washing with DMEM until visual inspection revealed a lack of lymphocytes. The adherent cells were removed from plates by incubating for 3e5 min with icecold Accutase® Cell Detachment Solution (Innovative Cell Technologies, San Diego, CA, USA) and rinsing repeatedly. The adherent cells were incubated with heat-killed R. anatipestifer (1  106 CFU/ mL) for 12 h or 24 h. The heat-killed R. anatipestifer was prepared by heating in a water bath at 100  C for 5 min. 2.4. RNA interference Macrophages were transfected with 10 nM gc-specific small interfering RNA (sigc) using Lipofectamine® RNAiMAX (Invitrogen, Waltham, MA, USA) according to the manufacturer's instructions. Briefly, macrophages were seeded at a density of 5  105 cells per well in 6-well plates and transfected with sigc-Lipofectamine® complexes. After 24 h post-transfection, cells were stimulated with heat-killed R. anatipestifer (1  106 CFU/mL) for 24 h. Total RNA was extracted from the cultured cells using RiboEx reagent (Geneall Biotechnology, Seoul, Korea), treated with RNase-free DNase I (Fermentas, Burlington, Ontario, Canada), and used for cytokine expression analyses by quantitative reverse-transcription RT-PCR (qRT-PCR) with gene-specific primers (Table 1). A nonsense siRNA (siNC) was used as a negative control for non-sequence specific effects (Bioneer, Daejeon, Korea). 2.5. Cotransfection of sigc and gc constructs COS-7 cells were maintained in DMEM supplemented by 10% FBS and penicillin/streptomycin (10,000 unit/mL). One day before transfection, these cells were trypsinized and resuspended in DMEM, and plated onto a 6-well plate. COS-7 cells were cotransfected with sigc or siNC (Table 1) and gc constructs (dugc-a flag or dugc-b flag) (Jeong et al., 2015) using Lipofectamine® reagent (Invitrogen) according to the manufacturer's instructions. The cells were harvested for Western blot analyses 48 h of cotransfection. We used 10 nM sigc and 10 mg constructs for transfections. 2.6. Western blot analysis Cell supernatants and lysates were mixed with equal volumes of sample buffer [0.125 M Tris-HCl (pH 6.8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.004% bromophenol blue], heated for 5 min at 95  C, resolved on 10% SDS-polyacrylamide gels, and transferred to polyvinyl difluoride membranes (Bio-Rad, Hercules, CA, USA). Membranes were blocked with PBS containing 5% nonfat dry milk for 2 h at room temperature and incubated with anti-flag M2 antibody (Cell Signaling Technology, Danvers, MA, USA) at 4  C overnight. After washing three times with PBS containing 0.1% Tween 20 (PBS-T), membranes were incubated with horseradish

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

227

Table 1 Primers used for qRT-PCR and small interfering RNAs. Target (name)

Purpose

Primer and sequence (50 e30 )

References

1

dugc -a

qRT-PCR

Current study

2

dugc -b

qRT-PCR

F- CAAGGGTCTCGCGGAGGAG R- GCACCAGCAGGACGACGAG F- GCAAGGGTAGGGACGTGCC R- TGCTCCTCCGCGAGACCTG F- ATGTCTCCAACCCTTCGT R- CCGTATCACCTTCCCGTA F- CTGAGAGACTTAATGGAGACTG R- AGAATCTGAACGGCTGATG F- TTCGACGAGGAGAAATGCTT R- CCTTATCGTCGTTGCCAGAT F- TCATCTTCTACCGCCTGGAC R- GTAGGTGGCGATGTTGACCT F- CAACGCTCAACTACTCTC R- TGTGGTTAATCTGTCCTTAG F- GCCAAGAGCTGACCAACTTC R- ATCGCCCACACTAAGAGCAT F- GCTATGTCGCCCTGGATTTC R- CACAGGACTCCATACCCAAGAA Sense- UGGACAUAGGCGACGUGAU(dTdT) Antisense- AUCACGUCGCCUAUGUCCA(dTdT) Sense- GUCCUGUUCAACGAGGAGU(dTdT) Antisense- ACUCCUCGUUGAACAGGAC(dTdT) Sense- GAGAAGUACUACACCUUCU(dTdT) Antisense- AGAAGGUGUAGUACUUCUC(dTdT) Sense- CUGUUCAACGAGGAGUACA(dTdT) Antisense- UGUACUCCUCGUUGAACAG(dTdT)

IL-17A

qRT-PCR

IL-17F

qRT-PCR

IL-6

qRT-PCR

IL-1b

qRT-PCR

IFN-g

qRT-PCR

IL-2

qRT-PCR

b-actin

qRT-PCR

siNC

RNAi interference

sigc-1

RNAi interference

sigc-2

RNAi interference

sigc-3

RNAi interference

Current study Kim et al., 2015 Kim et al., 2015 Wei et al., 2014 Wei et al., 2014 Maughan et al., 2013 Maughan et al., 2013 Liu et al., 2012 Xiong et al., 2010 Current study Current study Current study

F ¼ Forward; R ¼ Reverse; 1efficiency (%) ¼ 93.7; 2efficiency (%) ¼ 108.3; dugc ¼ duck common cytokine receptor g chain; siNC ¼ nonsense siRNA; sigc, gc-specific small interfering RNA.

peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Promega, Sunnyvale, CA, USA) in PBS containing 1% nonfat dry milk for 40 min at room temperature. Membranes were washed five times with PBS-T and five times with distilled water, visualized using an enhanced chemiluminescence reagent, EZWest Lumi Plus (Atto, Tokyo, Japan), and detected using the ChemiDoc imaging system (Bio-Rad). For densitometric analysis, protein bands were quantified using ImageJ software (http://rsb.info.nih.gov) followed by densitometry reading undertaken after normalization to b-actin expression.

method using b-actin as a reference for normalization. 2.8. Statistical analysis Statistical analysis was performed using InStat® software (GraphPad, La Jolla, CA, USA). Differences in mean values were tested using Student's t-test or a one-way analysis of variance (ANOVA), followed by Dunnett's multiple comparison test. Differences were considered significant at a P < .05. The data represent the mean ± standard error (SE).

2.7. qRT-PCR

3. Results

Tissue or cell samples from five ducks infected with R. anatipestifer serotype 7 were collected and homogenized using a grinder (Dalhan Science, Seoul, Korea) for tissues or a vortex for cells. Total RNA was extracted from the homogenized samples using the RiboEx total RNA isolation solution (GeneAll, Seoul, Korea), purified with the RNeasy Mini kit (Qiagen, Hilden, Germany), and stored at 70  C. Prior to analyses, samples were treated with DNase I (Fermentas) to remove any contaminating genomic DNA, and single-stranded cDNA was synthesized using the QuantiTect reverse-transcription kit (Qiagen) with random hexamer primers. Tissue samples of the spleen or liver were pooled from five ducks. Total RNA was extracted and subjected to qRT-PCR analysis in triplicate on a CFX96 real-time PCR system (Bio-Rad) using specific primers (Table 1). The concentration of the starting tissue (~30 mg) or cell (~1.5  107) used for RNA extraction and concentration of RNA for cDNA amplification were for 1 ml (1000 ng/ml) according to the manufacturer's instruction. cDNA targets were amplified by using AccuPower® 2X GreenStar™ qPCR MasterMix (Bioneer). A melting curve was obtained at the end of each run to ensure the presence of a single amplification product without primer dimers. The relative expression levels of individual transcripts were normalized to those of b-actin with Bio-Rad CFX software. Gene expression levels were quantified with the comparative 2DDCT

3.1. Upregulation of gc mRNA expression in R. anatipestifer-infected ducks Recent reports indicated that the soluble form of gc exacerbates Th17-cell-mediated inflammation (Hong et al., 2014; Lee and Hong, 2015) and that inflammatory cytokines, including IL-17A, are strongly associated with R. anatipestifer infection in ducks (Fernandez et al., 2016, 2017). Therefore, duck gc [membraneassociated gc (dugc-a) and soluble gc (dugc-b)] and Th17 cytokine expression profiles were monitored in R. anatipestifer-infected ducks by qRT-PCR (Fig. 1). When compared with healthy controls, the dugc-a and dugc-b forms were significantly increased in the spleen and liver of R. anatipestifer-infected ducks. Interestingly, dugc-b expression on day 4 increased 10.6 and 36.7 times in the liver and spleen of infected ducks, respectively, whereas dugc-a expression increased 1.9 and 5.4 times, respectively (Fig. 1A). IL-17A and IL-17F mRNA expression was generally upregulated in both tissues of infected ducks (Fig. 1B and C). Bacterial burdens were detected in the spleen and liver of infected ducks, whereas no bacteria were detected in both tissues of the healthy controls (Fig. 1D). Given that the infections with R. anatipestifer were successful and that the samples were prepared properly, these results suggested that upregulated expression of gc transcripts was

228

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

Fig. 1. Upregulation of gc transcripts in R. anatipestifer-infected ducks. The dugc-a and dugc-b (A), IL-17A (B) and IL-17F (C) expression levels in the spleen and liver of R. anatipestifer-infected ducks. Two-week-old ducks were infected intramuscularly with 5  107 CFU of R. anatipestifer serotype 7. Tissue samples were collected on days 4 and 7 post-infection. The mRNA expression levels were normalized to b-actin and calibrated with the expression levels in uninfected ducks. Data represent the mean ± SE from two independent experiments. *P < .05 or **P < .01 was considered statistically significant compared to the uninfected ducks (NC ¼ negative control). (D) Bacterial load of R. anatipestifer in the spleen and liver. Five ducks were sacrificed at each time point and the tissues were aseptically collected for bacterial recovery. Data represent the mean ± SE of five birds and one representative of two independent experiments. D, day; h, hour. CFU ¼ colony-forming unit.

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

associated with increased expression of Th17 cytokines including IL-17A and IL-17F. 3.2. R. anatipestifer treatments significantly increased gc mRNA expression in splenic lymphocytes and macrophages The in vivo results described above indicated upregulation of gc mRNA expression. Hence, we further investigated whether gc mRNA expression could be upregulated in R. anatipestifer-stimulated cells. The mRNA expression profiles of gc and Th17-related cytokines in splenic lymphocytes (Fig. 2) and macrophages (Fig. 3) stimulated with killed R. anatipestifer were investigated by qRT-PCR. The dugc-a and dugc-b forms were significantly increased in splenic lymphocytes (Fig. 2A and B) and macrophages (Fig. 3A and B) stimulated with killed R. anatipestifer as compared with unstimulated and cultured controls. When the splenic lymphocytes and macrophages obtained from ducks were stimulated with killed R. anatipestifer, dugc-b expression showed 12.2- to 36.4-fold changes in lymphocytes and 6.8- to 23.9-fold changes in macrophages, whereas dugc-a expression showed a 1.4- to 2-fold change in lymphocytes and a 2.4- to 2.7-fold change in macrophages (Figs. 2A and 3A). The mRNA levels of Th17-related cytokines, including IL-17A, IL-17F, IL-6, and IL-1b, were markedly increased in

229

splenic lymphocytes (Fig. 2CeF) and macrophages (Fig. 3CeF) stimulated with killed R. anatipestifer compared to unstimulated and cultured controls. These results suggested that increased expression of gc transcripts was involved with overexpression of Th17-related cytokines when lymphocytes and macrophages were stimulated with R. anatipestifer. 3.3. Inhibition of Th17-related cytokines in splenic macrophages treated by gc-specific siRNA Generally, the duck gc gene codes for two protein forms, the membrane-associated gc form (dugc-a) and the soluble gc form (dugc-b). The duck dugc-b isoform harbors a fifth intron (a frameswitch 88-bp insertion) by alternative splicing of the mRNA transcript, resulting in the lack of a transmembrane region (Jeong et al., 2011, 2015). To inhibit the expression of the dugc-b form, several siRNA sequences targeting the fifth intron were synthesized and tested in COS-7 cells transfected with the dugc-b construct. However, the siRNA sequences did not function properly (data not shown). Thus, three siRNA sequences (sigc-1, sigc-2, and sigc-3) targeting genes within the extracellular region of both the dugc-a and dugc-b genes were synthesized. All siRNA sequences were evaluated for their capacity to inhibit expression of duck gc transcripts in COS-7 cells cotransfected with a dugc-a or dugc-b

Fig. 2. The mRNA expression profiles of gc and inflammatory cytokines in R. anatipestifer-stimulated lymphocytes. Splenic lymphocytes were isolated from 2-week-old healthy ducks, stimulated with killed R. anatipestifer for the indicated times and analyzed with qRT-PCR. The expression levels of dugc-a (A), dugc-b (B), IL-17A (C), IL-17F (D), IL-6 (E) and IL-1b (F) were normalized to b-actin and calibrated with the expression levels of unstimulated and cultured lymphocytes. Data represent the mean ± SE of triplicates and representative of one of two independent experiments. *P < .05, **P < .01 or ***P < .001 was considered statistically significant compared to the unstimulated and cultured lymphocytes (NC ¼ negative control). dugc-a, membrane-associated gc; dugc-b, soluble gc; h, hour.

230

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

Fig. 3. The mRNA expression profiles of gc and inflammatory cytokines in R. anatipestifer-stimulated-macrophages. Splenic macrophages were stimulated with killed R. anatipestifer for the indicated times and analyzed using qRT-PCR. Expression levels of dugc-a (A), dugc-b (B), IL-17A (C), IL-17F (D), IL-6 (E) and IL-1b (F) were normalized to b-actin and calibrated with expression levels of unstimulated and cultured macrophages. Data represent the mean ± SE of triplicates and representative of one of two independent experiments. **P < .01 was considered statistically significant compared to unstimulated and cultured macrophages (NC ¼ negative control). dugc-a, membrane-associated gc; dugc-b, soluble gc; h, hour.

construct and sigc for 48 h by Western blot analyses (Fig. 4). As shown Fig. 4A, COS-7 cells were transiently transfected with the FLAG-tagged dugc-a or dugc-b construct. Both forms were present in the cell lysate, whereas only the dugc-b from the culture supernatant was detected. All sigc sequences resulted in reduced gc expression compared with the nonsense siRNA (siNC) (negative control). Inhibition was most efficient with the sigc-1, reducing dugc-a and dugc-b expression by up to 56% and 77%, respectively (Fig. 4B and C). To determine the inhibitory effects of the sigc-1 sequence on the production of Th17-related cytokines (IL-17A, IL-17F, IL-6, and IL1b), splenic macrophages transfected with sigc-1 were stimulated with killed R. anatipestifer for 24 h (Fig. 5). Compared to macrophages transfected with siNC and then stimulated with killed R. anatipestifer, the sigc-1 in macrophages stimulated with killed R. anatipestifer significantly inhibited expression of both forms, dugc-a and dugc-b (Fig. 5A and B). Expression levels of IL-17A, IL17F, IL-6, and IL-1b were significantly reduced in sigc-1 treated and R. anatipestifer-stimulated macrophages (Fig. 5CeF). The siNCtreated and R. anatipestifer-stimulated cells showed significantly increased mRNA expression of gc (dugc-a and dugc-b) and Th17related cytokines compared to the unstimulated and cultured macrophages (NC ¼ negative control) (Fig. 5). The absence of IL-2 or disruption of its signaling by deletion of the signal transducer and

activator of transcription 5 (STAT5) resulted in enhanced Th17 cell differentiation (Laurence et al., 2007). Thus, we examined whether the expression levels of Th1-specific cytokines IFN-g and IL-2 in R. anatipestifer-stimulated macrophages could be affected by sigc-1 treatment using qRT-PCR (Fig. 6). The sigc-1 treatment enhanced expression of IFN-g and IL-2 compared with the siNC-treated and R. anatipestifer-stimulated cells (Fig. 6). 4. Discussion R. anatipestifer is one of the most economically important pathogens in the duck industry, and can cause an acute or chronic septicemic disease with 5e75% mortality, depending on the strain virulence (Pathanasophon et al., 2002; Ruiz and Sandhu, 2013). Our previous results indicated that upregulation of IL-17A and IL-17F was strongly associated with R. anatipestifer infection in ducks (Fernandez et al., 2016, 2017). A critical involvement of Th17 cells has been identified in disease pathogenesis, and neutralization or suppression of Th17 cells could therefore mitigate disease development (Solt et al., 2011; Mondal et al., 2012; Ikeda et al., 2014). Recently, the biological importance of soluble gc (sgc) has been investigated, and reports have found increased Th17 cell differentiation in vitro and increased numbers of Th-17-producing cells in sgc transgenic mice (Waickman et al., 2016; Hong et al., 2014). Here,

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

231

Fig. 4. Inhibition of gc expression by cotransfection with sigc and dugc-a or the dugc-b construct in COS-7 cells. (A) COS-7 cells were transfected with FLAG-tagged dugc-a and dugc-b constructs (Jeong et al., 2015) or empty vector pcDNA3.1 (vector) for 48 h. The supernatants and lysates of transfected cells were analyzed under reducing conditions by Western blot with anti-FLAG antibody. The data represent one representative of two independent experiments. Molecular weight markers are shown on the left side in kiloDaltons (Kda). (BeC) Inhibition of gc expression by sigc in COS-7 cells. COS-7 cells were cotransfected with sigc and FLAG-tagged dugc-a (B) or dugc-b (C) constructs for 48 h. The supernatants and lysates of transfected cells were analyzed by Western blot with anti-FLAG antibody (B and C, left figures). The data represent one representative of two or three independent experiments. Densitometric analyses (right figures of B and C) are represented as a ratio of lysate intensity to b-actin intensity. *P < .05, or **P < .01 was considered to be statistically significant compared to siNC-treated cells that were transfected with dugc-a (B) or dugc-b (C). Data represent the mean ± SE of two independent experiments. A nonsense siRNA (siNC) was used as a negative control. dugc-a, membrane-associated gc; dugc-b, soluble gc.

we described the expression profile of membrane-associated gc (dugc-a) and soluble gc (dugc-b) in R. anatipestifer-stimulated lymphoid cells and in tissues from R. anatipestifer-infected ducks. Furthermore, the inhibitory effect of gc mRNA expression by gcspecific siRNA on the mRNA expression of Th17-related cytokines in duck splenic macrophages stimulated with killed R. anatipestifer was investigated. The sgc protein from gc is generated by alternative splicing or proteolytic cleavage, and its secretion is influenced by various factors including species and treated antigens (Jeong et al., 2015).

The secreted gc protein has been detected in sera from patients with Crohn's disease (Nielsen et al., 1998), in synovial fluids of rheumatoid arthritis patients (Nishio et al., 2001), in sera from certain inbred mice, and in activated immune cells (Meissner et al., 2001). However, the sgc form was not detected in supernatants from normal and stimulated human lymphocyte cultures or in sera from healthy individuals and patients with various disorders (Lundin et al., 2002). In chickens, sgc is produced by proteolytic cleavage of isoform gc-b (chgc-b), and its expression is affected by developmental stages or stimulated antigens (Jeong et al., 2015).

232

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

Fig. 5. The mRNA expression profiles of Th17 related cytokines and gc isoform on R. anatipestifer estimulated macrophages with reduced gc expression. Splenic macrophages were transfected with siNC or sigc-1 and subjected to qRT-PCR analyses. After sigc-1 or siNC treatment, splenic macrophages were stimulated using killed R. anatipestifer for another 24 h. To measure expression levels of dugc-a (A), dugc-b (B), IL-17A (C), IL-17F (D), IL-6 (E) and IL-1b (F) transcripts were analyzed. Expression levels were normalized to b-actin and calibrated with expression levels of siNC-treated macrophages that were stimulated. Data represent the mean ± SE of four independent experiments. **P < .01 was considered to be statistically significant compared to siNC-treated macrophages that were stimulated. NC, untreated, unstimulated, and cultured macrophages; siNC, a nonsense siRNA; dugc-a, membrane-associated gc; dugc-b, soluble gc; RA, R. anatipestifer; h, hour.

Fig. 6. Enhancement of IFN-g and IL-2 mRNA expression levels on R. anatipestifer estimulated macrophages with reduced gc expression. Splenic macrophages were transfected with siNC or sigc-1 and subjected to qRT-PCR analysis. After sigc-1 or siNC treatment, splenic macrophages were stimulated using killed R. anatipestifer for another 24 h. The expression levels of IFN-g (A) and IL-2 (B) transcripts were analyzed. The expression levels were normalized to b-actin and calibrated with the expression levels of stimulated siNC macrophages. Data represent the mean ± SE of four independent experiments. **P < .01 was considered to be statistically significant compared to siNC-treated macrophages that were stimulated. NC, untreated, unstimulated and cultured macrophages; siNC, a nonsense siRNA; dugc-a, membrane-associated gc; dugc-b, soluble gc; RA, R. anatipestifer; h, hour.

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

In vivo and in vitro results indicated that the expression of dugc-a and dugc-b was significantly increased in the tissues of R. anatipestifer-infected ducks and in R. anatipestifer-stimulated lymphoid cells compared to those of uninfected ducks and unstimulated cells, respectively. It is noteworthy that the expression of dugc-b was remarkably upregulated in both in vitro and in vivo studies compared to those of the dugc-a transcript. In addition, the expression of inflammatory cytokines, including IL-17A, IL-7F, IL1b, or IL-6, was significantly increased both in splenic lymphocytes and in macrophages stimulated with R. anatipestifer, and in the spleen and liver of R. anatipestifer-infected ducks. Collectively, these results suggest that expression of gc, specifically dugc-b, is involved in the production of inflammatory cytokinedboth in R. anatipestifer-infected ducks and in R. anatipestifer-stimulated cells. To determine whether upregulated expression levels of gc were related to the production of inflammatory cytokines, the expression levels of gc were inhibited by gc-specific siRNA (sigc) in duck macrophages stimulated with R. anatipestifer. Macrophages treated with sigc and then stimulated with R. anatipestifer exhibited significantly reduced expression of dugc-a and dugc-b compared with siNC-treated cells that were stimulated (Fig. 5). Furthermore, expression of inflammatory cytokines, including IL-17A and IL-17F, were significantly reduced in sigc-treated cells. Compared to normal mice, sgc deficient mice had dramatically reduced experimental autoimmune encephalomyelitis disease progress with delayed disease onset and lower clinical scores (Hong et al., 2014). Also, the severity of Th-17-cell-mediated inflammatory diseases was dramatically decreased in mice lacking sgc (Hong et al., 2014). Similarly, anti-gc monoclonal antibody treatment of chronic graftversus-host disease (GVHD) ameliorated liver and lung fibrosis, and pulmonary dysfunction characteristic of bronchiolitis obliterans. The production of proinflammatory cytokines, such as tumor necrosis factor, interferon-g (IFN-g), IL-6, and monocyte chemoattractant protein 1, was reduced in sera of allogeneic hematopoietic cell transplanted mice treated with anti-gc monoclonal antibody compared with unspecific IgG treatment (Hechinger et al., 2015). Additionally, proinflammatory cytokines, including IL-17A produced by different myeloid cells and nonhematopoietic cells, play critical roles in the pathogenesis of GVHD (Kappel et al., 2009; MacDonald et al., 2017). Generally, ducks were more susceptible to R. anatipestifer infection than chickens (Subramaniam et al., 2000; Li et al., 2010; Fernandez et al., 2016). IFN-g and IL-2 expression levels were generally lower in the spleen and liver of R. anatipestifer-infected ducks than in the corresponding tissues of R. anatipestifer-infected chickens (Fernandez et al., 2016). In our study, the sigc-1 treatment of R. anatipestifer-stimulated macrophages enhanced the expression levels of IFN-g and IL-2 compared with the siNC-treated macrophages that were stimulated. Similarly, IL-2 inhibited in vitro differentiation of Th17 cells, whereas T cells from IL-2deficient mice had a marked increase in the percentage of IL-17producing cells compared to normal mice (Laurence et al., 2007). In conclusion, soluble gc transcript (dugc-b) expression was remarkably increased in R. anatipestifer-infected ducks and R. anatipestifer-stimulated cells compared to the membrane gc transcript (dugc-a). It is interesting to note that increased sgc expression inversely correlated with decreased membrane gc (mgc) protein expression in the same cells (Park et al., 2016). Considering that treatment with gc-specific siRNA inhibited the expression of gc and proinflammatory cytokines in duck macrophages stimulated with R. anatipestifer, this study suggested that soluble gc is one of several factors related with R. anatipestifer infection. However, in vivo studies are required to elucidate the specific function(s) of soluble gc protein during R. anatipestifer infection.

233

Competing financial interests The authors declare no competing financial interests. Acknowledgements This research was supported by the Basic Science Research Program through NRF of Korea funded by the Ministry of Education (2015R1D1A1A02059953) and the Korea IPET in Food, Agriculture, Forestry and Fisheries through the Agriculture, Food and Rural Affairs Research Center Support Program, funded by MAFRA-7160027. References Bhaumik, S., Basu, R., 2017. Cellular and molecular dynamics of Th17 differentiation and its developmental plasticity in the intestinal immune response. Front. Immunol. 8, 254. Chen, K., Kolls, J.K., 2017. Interleukin-17A (IL17A). Gene 614, 8e14. Chung, S.W., Kang, B.Y., Kim, S.H., Pak, Y.K., Cho, D., Trinchieri, G., Kim, T.S., 2000. Oxidized low density lipoprotein inhibits interleukin-12 production in lipopolysaccharide-activated mouse macrophages via direct interactions between peroxisome proliferator-activated receptor-g and nuclear factor-kB. J. Biol. Chem. 275, 32681e32687. Diaz, J.A.R., Kim, W.H., Fernandez, C.P., Jeong, J., Afrin, F., Lillehoj, H.S., Kim, S., Kim, S., Dalloul, R.A., Min, W., 2016. Identification and expression analysis of duck interleukin-17D in Riemerella anatipestifer infection. Dev. Comp. Immunol. 61, 190e197. Fernandez, C.P., Afrin, F., Flores, R.A., Kim, W.H., Jeong, J., Kim, S., Chang, H.H., Lillehoj, H.S., Min, W., 2017. Downregulation of inflammatory cytokines by berberine attenuates Riemerella anatipestifer infection in ducks. Dev. Comp. Immunol. 77, 121e127. Fernandez, C.P., Kim, W.H., Diaz, J.A.R., Jeong, J., Afrin, F., Kim, S., Jang, H.K., Lee, B.H., Yim, D., Lillehoj, H.S., Min, W., 2016. Upregulation of duck interleukin-17A during Riemerella anatipestifer infection. Dev. Comp. Immunol. 63, 36e46. Hechinger, A., Smith, B.A.H., Flynn, R., Hanke, K., McDonald-Hyman, C., Taylor, P.A., Pfeifer, D., Hackanson, B., Leonhardt, F., Prinz, G., Dierbach, H., SchmittGraeff, A., Kovarik, J., Blazar, B.R., Zeiser, R., 2015. Therapeutic activity of multiple common g-chain cytokine inhibition in acute and chronic GVHD. Blood 125, 570e580. Hong, C., Luckey, M.A., Ligons, D.L., Waickman, A.T., Park, J.Y., Kim, G.Y., et al., 2014. Activated T cells secrete an alternatively spliced form of common g-chain that inhibits cytokine signaling and exacerbates inflammation. Immunity 40, 910e923. Hu, Q., Ding, C., Tu, J., Wang, X., Han, X., Duan, Y., Yu, S., 2012. Immunoproteomics analysis of whole cell bacterial proteins of Riemerella anatipestifer. Vet. Microbiol. 157, 428e438. Ikeda, T., Hirata, S., Takamatsu, K., Haruta, M., Tsukamoto, H., Ito, T., Uchino, M., Ando, Y., Nagafuchi, S., Nishimura, Y., Senju, S., 2014. Suppression of Th1mediated autoimmunity by embryonic stem cell-derived dendritic cells. PLoS One 9, e115198. Jeong, J., Kim, W.H., Fernandez, C.P., Kim, S., et al., 2015. Different strategies for producing naturally soluble form of common cytokine receptor g chain. Dev. Comp. Immunol. 48, 13e21. Jeong, J., Lee, C., Yoo, J., Koh, P.O., Kim, Y.H., Chang, H.H., et al., 2011. Molecular identification of duck and quail common cytokine receptor g chain genes. Vet. Immunol. Immunopathol. 140, 159e165. Kappel, L.W., Goldberg, G.L., King, C.G., Suh, D.Y., Smith, O.M., Ligh, C., Holland, A.M., et al., 2009. IL-17 contributes to CD4-mediated graft-versus-host disease. Blood 113, 945e952. Kim, T.S., Kang, B.Y., Cho, D., Kim, S.H., 2003. Induction of interleukin-12 production in mouse macrophages by berberine, a benzodioxoloquinolizine alkaloid, deviates CD4þ T cells from a Th2 to a Th1 response. Immunology 109, 407e414. Kim, W.H., Fernandez, C.P., Diaz, J.A.R., Jeong, J., Kim, S., Lillehoj, H.S., et al., 2015. Molecular cloning, characterization and mRNA expression of duck interleukin17F. Vet. Immunol. Immunopathol. 164, 194e200. Korn, T., Bettelli, E., Oukka, M., Kuchroo, V.K., 2009. IL-17 and Th17 cells. Annu. Rev. Immunol. 27, 485e517. Laurence, A., Tato, C.M., Dabidson, T.S., Kanno, Y., et al., 2007. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity 26, 371e381. Lee, B., Hong, C., 2015. The role of soluble common gamma chain in autoimmune disease. Anat. Cell Biol. 48, 10e15. Li, J.X., Tang, Y., Gao, J.Y., Huang, C.H., Ding, M.J., 2010. Riemerella anatipestifer infection in chickens. Pak. Vet. J. 31, 65e69. Liu, H., Wang, X., Si, J., Jia, J., Li, L., Han, C., et al., 2012. Molecular cloning and in silico analysis of the duck (Anas platyrhynchos) MEF2A gene cDNA and its expression profile in muscle tissues during fetal development. Genet. Mol. Biol. 35, 182e190. € m, T., Lindqvist, C., 2002. No Lundin, K., Tuukkanen, A.M., Jansson, C., Nordstro soluble common cytokine receptor gamma chain (gc) in activated human

234

F. Afrin et al. / Developmental and Comparative Immunology 81 (2018) 225e234

lymphocyte cultures-comparison with soluble IL-2Ra. Immunol. Lett. 82, 235e240. MacDonald, K.P.A., Hill, G.R., Blazar, B.R., 2017. Chronic graft-versus-host disease: biological insights from preclinical and clinical studies. Blood 129, 13e21. Maughan, M.N., Dougherty, L.S., Preskenis, L.A., Ladman, B.S., Gelb Jr., J., Spackman, E.V., et al., 2013. Transcriptional analysis of the innate immune response of ducks to different species of origin low pathogenic H7 avian influenza viruses. Virol. J. 10, 94. € llinghoff, M., Gessner, A., 2001. A soluble form Meissner, U., Blum, H., Schnare, M., Ro of the murine common g chain is present at high concentrations in vivo and suppresses cytokine signaling. Blood 97, 183e191. Min, W., Kim, W.H., Lillehoj, E.P., Lillehoj, H.S., 2013. Recent progress in host immunity to avian coccidiosis: IL-17 family cytokines as sentinels of the intestinal mucosa. Dev. Comp. Immunol. 41, 418e428. Min, W., Lillehoj, H.S., Fetterer, R.H., 2002. Identification of an alternatively spliced isoform of the common cytokine receptor g chain in chickens. Biochem. Biophys. Res. Commun. 299, 321e327. Mondal, S., Martinson, J.A., Ghosh, S., Watson, R., Pahan, K., 2012. Protection of tregs, suppression of Th1 and Th17 cells, and amelioration of experimental allergic encephalomyelitis by a physically-modified saline. PLoS One 7, e51869. Nielsen, O.H., Kirman, I., Johnson, K., Giedlin, M., Ciardelli, T., 1998. The circulating common gamma chain (CD132) in inflammatory bowel disease. Am. J. Gastroenterol. 93, 323e328. Nishio, J., Kohsaka, H., Shimamura, T., Hamuro, J., Miyasaka, N., 2001. Abundant expression of common cytokine receptor g chain (CD132) in rheumatoid joints. J. Rheumatol. 28, 240e244. Overwijk, W.W., Schluns, K.S., 2009. Functions of gC cytokines in immune homeostasis: current and potential clinical applications. Clin. Immunol. 132, 153e165. Pappu, R., Ramirez-Carrozzi, V., Sambandam, A., 2011. The interleukin-17 cytokine family: critical players in host defence and inflammatory diseases. Immunology 134, 8e16. Park, J.Y., Jo, Y., Ko, E., Luckey, M.A., Park, K.Y., Park, S.H., Park, J.H., Hong, C., 2016. Soluble gc cytokine receptor suppresses IL-15 signaling and impairs iNKT cell development in the thymus. Sci. Rep. 6, 36962.

Pathanasophon, P., Phuektes, P., Tanticharoenyos, T., Narongsak, W., Sawada, T., 2002. A potential new serotype of Riemerella anatipestifer isolated from ducks in Thailand. Avian Pathol. 31, 267e270. Reynolds, J.M., Angkasekwinai, P., Dong, C., 2010. IL-17 family member cytokines: regulation and function in innate immunity. Cytokine Growth Factor Rev. 21, 413e423. Ruiz, J.A., Sandhu, T.S., 2013. Riemerella anatipestifer infection. In: Swayne, D.E., Glisson, J.R., McDougald, L.R., Nolan, L.K., Suarez, D.L., Nair, V. (Eds.), Diseases of Poultry. Wiley-Blackwell Publication, USA, pp. 823e828. Sandhu, T.S., Leister, M.L., 1991. Serotypes of ‘Pasteurella’ anatipestifer isolated from poultry in different countries. Avian Pathol. 20, 233e239. Solt, L.A., Kumar, N., Nuhant, P., Wang, Y., Lauer, J.L., Liu, J., Istrate, M.A., Kamenecka, T.M., Roush, W.R., Vidovic, D., Schurer, S.C., Xu, J., Wagoner, G., Drew, P.D., Griffin, P.R., Burris, T.P., 2011. Suppression of TH17 differentiation and autoimmunity by a synthetic ROR ligand. Nature 472, 491e494. Subramaniam, S., Huang, B., Loh, H., Kwang, J., Tan, H.M., Chua, K.L., Frey, J., 2000. Characterization of a predominant immunogenic outer membrane protein of Riemerella anatipestifer. Clin. Diagn. Lab. Immunol. 7, 168e174. Waickman, A.T., Park, J.Y., Park, J.H., 2016. The common g-chain cytokine receptor: tricks-and-treats for T cells. Cell. Mol. Life Sci. 73, 253e269. Walsh, S.T.R., 2012. Structural insights into the common g-Chain family of cytokines and receptors from the interleukin-7 pathway. Immunol. Rev. 250, 303e316. Wei, S., Liu, X., Gao, M., Zhang, W., Zhu, Y., Ma, B., et al., 2014. Cloning and characterization of goose interleukin-17A cDNA. Res. Vet. Sci. 96, 118e123. Xiong, M., Li, S., Peng, X., Feng, Y., Yu, G., Xin, Q., Gong, Y., 2010. Adipogenesis in ducks interfered by small interfering ribonucleic acids of peroxisome proliferator-activated receptor gamma gene. Poult Sci. 89, 88e95. Zhai, Z., Cheng, L., Tang, F., Lu, Y., Shao, J., Liu, G., Bao, Y., Chen, M., Shang, K., Fan, H., Yao, H., Lu, C., Zhang, W., 2012. Immunoproteomic identification of 11 novel immunoreactive proteins of Riemerella anatipestifer serotype 2. FEMS Immunol. Med. Microbiol. 65, 84e95. Zhou, Z., Li, X., Xiao, Y., Wang, X., Tian, W., Peng, X., Bi, D., Sun, M., Li, Z., 2013. Gene expression responses to Riemerella anatipestifer infection in the liver of ducks. Avian Pathol. 42, 129e136.