Downregulation of IL-17 and IL-6 in the central nervous system by glatiramer acetate in experimental autoimmune encephalomyelitis

Journal of Neuroimmunology 204 (2008) 58–65

Contents lists available at ScienceDirect

Journal of Neuroimmunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / j n e u r o i m

Downregulation of IL-17 and IL-6 in the central nervous system by glatiramer acetate in experimental autoimmune encephalomyelitis Sakhina Begum-Haque a,b,⁎, Alok Sharma a,b, Isaac R. Kasper a,b, David M. Foureau a,b, Daniel W. Mielcarz a,b, Azizul Haque a,b,c, Lloyd H. Kasper a,b a b c

Department of Medicine, Dartmouth Medical School, Lebanon, NH 03756, USA Multiple Sclerosis Center @ Dartmouth College, Hanover, NH 03755, USA Chercheur au CNRS, UPRES EA 3610, Faculté de Médecine de Lille, 59037 Lille, France

a r t i c l e

i n f o

Article history: Received 9 May 2008 Received in revised form 17 July 2008 Accepted 23 July 2008 Keywords: Animals-rodent Diseases-EAE/MS Molecules-cytokine receptors Transcription factors

a b s t r a c t T helper 17 (Th17) cells are pivotal in the immune pathogenesis of EAE. Glatiramer acetate (GA) can enhance Treg FOXp3 expression. We demonstrate that GA downregulates the expression of both IL-17 and IL-6 in two different EAE models. Increased mRNA expression in CNS for RORγt, IL-17, IL-12/ IL-23, IL-6, TNF-α, STAT4 and Th1 cytokines were significantly reduced by GA with a concomitant rise in SMAD3. The increased expression of TNF-α, IL-6, and IL-17 in CNS of CD25+ depleted animals was suppressed by GA treatment. This study demonstrates that both Th1 polarization and Th17 expression are modulated by GA. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS) that appears to be mediated in part by T cells (Hohlfeld and Wekerle, 2004). Previous studies have shown that regulatory T cells (Treg) play a critical role in the progression of the disease (Kasper et al., 2007). T helper cells (Th) are also believed to contribute to pathogenesis, but the specific cell types involved are not well understood. The recent observations demonstrating a role for IL-17 expressing T cells (Th17) in EAE (Schreiner et al., 2007; Bettelli, 2007; Gold and Luhder, 2008; Kawanokuchi et al., 2008), an animal model of human multiple sclerosis, implicates this effector T cell subpopulation in disease pathogenesis. Previous studies have shown that glatiramer acetate (GA) relieves symptoms of MS in EAE animal models (Aharoni et al., 1997, 2000, 2003) as well as in human clinical studies (Johnson et al.,1995), by mechanisms that are not fully understood. It has been suggested that GA can bind to an HLA class II molecule, leading to the induction of GA-reactive T cells with a Th2 anti-inflammatory phenotype (Chen et al., 2001). These GA-

Abbreviations: GA, glatiramer acetate; EAE, experimental autoimmune encephalomyelitis; MOG, myelin oligodendrocyte glycoprotein; Th, T helper; Th17, T helper 17; 2D2Tg, MOG35–55-specific T-cell receptor transgenic mice; Treg, regulatory T cell. ⁎ Corresponding author. Department of Medicine, 1 Medical Center Drive, Rubin Bldg 710, Lebanon, NH 03756, USA. E-mail address: [email protected] (S. Begum-Haque). 0165-5728/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jneuroim.2008.07.018

reactive T cells are thought to enter the CNS where they exert their protective effects by producing anti-inflammatory cytokines in response to cross-recognition of myelin basic protein (MBP), and brain derived neurotrophic factor (BDNF; Aharoni et al., 2003; Ziemssen and Schrempf, 2007). Recent studies have demonstrated that the effect of GA on CD11b + monocytes results in the increased expression of antigen non-specific functionally active Treg that are involved in disease amelioration (Weber et al., 2007). GA can enhance the number and functional activity of Treg (Kasper et al., 2007; Jee et al., 2007). Recent observations would suggest that Th17 polarized effector cells are of significant importance in experimental autoimmune diseases such as EAE (Weaver et al., 2006) and in patients with multiple sclerosis (Kebir et al., 2007). T cells that produce proinflammatory cytokines, in particular IL-17 producing CD4+ cells (Th17), are a major contributor to autoimmune pathogenesis in EAE, whereas CD4+CD25+ Treg cells play a major role in suppression of autoimmunity (Kasper et al., 2007). Studies in our laboratory and those of others have demonstrated that GA administration results in an increase in the number and function of CD4+CD25+ FOXp3+ Treg cells (Jee et al., 2007). These Treg are believed to be critical for the suppression of disease progression (McGeachy et al., 2005). Activation and proliferation of proinflammatory Th1 and Th17 cells is reciprocally related to the immunosuppressive effects of Treg cells, both of which are contingent upon the cytokine environment, in particular IL-6, TGF-β, IL-12 and IL-23 (Mangan et al., 2006; McGeachy et al., 2007). In this study we investigated the effect of GA on the IL-17 response in two murine

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

models of EAE, C57BL/6 mice and 2D2 MOG transgenic (2D2Tg) mice (Hohlfeld and Wekerle, 2004; Kasper et al., 2007). The study described here provides evidence for the role of Th17 in induction of EAE disease and the effect of GA in the suppression of this distinct population and its transcription factor RORγt, associated with the activation of SMAD3, transcription factor of TGF-β. 2. Materials and methods 2.1. Materials Glatiramer acetate (GA) from batch 28704270 and 147245929 was a generous gift from Teva Pharmaceutical Industries (Petach Tikva, Israel). GA was reconstituted at 10 mg/ml in PBS and kept at −80 °C until used. Pertussis Toxin (PT), MOG35–55 peptide, Mycobacterium tuberculosis, Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). For depletion of CD25+ cells, rat-anti-mouse CD25 mAb (PC61) was purchased from BD Biosciences (San Jose, CA, USA). Control mice were injected with rat Ig from the same supplier. For stimulation of spleen cells, purified antibody against CD3 was purchased from eBioscience (San Diego, CA, USA). For real-time PCR (RT-PCR), all primers and probes were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA). β-actin was used as a control and was purchased from Invitrogen. For Luminex immunoassays, antibodies against IL-6, IL-17, TNF-α, and IL-12 (p40) were purchased from Bio-Rad (Hercules, CA, USA). 2.2. Mouse C57BL/6/EAE and 2D2/EAE transgenic models of multiple sclerosis Female 6–7 weeks old C57BL/6) mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and C57BL/6 MOG35–55-specific T-cell receptor (TCR) transgenic mice (2D2Tg mice) (Bettelli et al., 2003) were provided by Vijay Kuchroo (Harvard Medical School, Boston, USA) and maintained in the specific pathogen-free animal facility at Dartmouth Medical School. All animal study procedures were approved by the Dartmouth Institutional Animal Care Review Committee. 2.3. CD25 depletion, induction of EAE, and GA treatment in mouse models The sequence of events in the treatment of C57BL/6 and 2D2Tg mice (2D2 mice) was as follows. There were 5–8 animals per group in all cases. Depletion of CD4 + CD25 + cells, C57BL/6 mice was done as described (Quezada et al., 2005). It has been previously shown that 4 days after administration of anti-CD25 (250 μg/mouse), N90% of the CD4 + CD25 + cells are eliminated from peripheral blood and secondary lymphoid organs (Jarvinen et al., 2003). CD25 + T cells were depleted with 100 µg/mouse rat-anti-mouse CD25 mAb (PC61; BD Biosciences) administered (day −4, −2 and +5) by intraperitoneal (i.p.) injection prior to injection with MOG35–55 peptide. Control mice were injected with rat Ig from the same supplier. Depletion of Treg cells was confirmed by staining peripheral blood lymphocytes for CD4 and CD25 markers on day 4 after injection of the anti-CD25 antibody and analyzed by FACS (data not shown). Wild type C57BL/6 mice, CD25+ depleted mice, and 2D2 mice were injected in the back flank with 250 µg MOG35–55 peptide per mouse emulsified in CFA supplemented with 2 mg/ml of Mycobacterium tuberculosis. The mice received i.p. injection with 250 ng PT (per mouse) at the time of immunization and 48 h later. After 7 days, the mice received an identical booster immunization with MOG35–55 peptide in IFA without PT. Clinical disease usually commences between day 10 and day 15 after immunization. GA treatment (150 µg/mouse by subcutaneous injection) started at day 1 after injection of MOG35–55 peptide. Daily injection of GA continued until the end of the experiment (day 21). Mice were examined daily and scored for disability using a standard scale as follows: 0, no disease; 1, limp tail; 2, hind limb weakness

59

or paralysis; 3, paralysis of two hind limbs; 4, moribund condition; and 5, death. 2.4. Collection and processing of brain, spleen, lymph node, and plasma samples Mice were perfused via heart/aortic root with Dulbeccos' calcium/ magnesium-free PBS. Brain, spleen, and lymph node tissues were collected and suspended in RNA Stabilization Reagent (Invitrogen Life Technologies) and kept at −80 °C until further processing for extraction of RNA. Mouse whole blood was collected in a heparinized tube on ice. Plasma was separated from whole blood by centrifugation and kept at −20 °C until use in the Luminex assay. 2.5. Purification of mRNA and real-time PCR (RT-PCR) Total RNA was extracted from tissues using an RNA isolation kit (Applied Biosystems, Foster City CA, USA). Complementary DNA was prepared as recommended and used as the template for quantitative PCR. Levels of mRNA for IL-6, IL-17, IL-12 (p40)/IL-23, TNF-α, SMAD3, STAT4, and RORγt from brain and FOXp3 from spleen from all groups of mice were analyzed by RT-PCR as described elsewhere (Aharoni et al., 2005). Real-time PCR was performed according to the manufacturer's instructions on each cDNA in duplicate using specific primers and probes. Briefly, 25 µl of reaction volume contained SYBR Green PCR Master mix (Applied Biosystems), specific primer pairs, and 0.2 µg of cDNA. PCR cycling conditions were 8 min at 95 °C followed by 45 cycles of 94 °C for 15 s, 63 °C for 45 s and 72 °C for 15 s. The expression of all primers was evaluated using specific primers on a MyIQ Sequence Detection System (Bio-Rad). Expression was normalized to the expression of the housekeeping gene β-actin as described previously (Minns et al., 2006) and was expressed using the ΔCT method, where relative expression = 2− (exp-actin) ⁎ 1000. Primers

Forward

Reverse

IL-6 IL-17 IL-12 (p40) TNF-α SMAD3 STAT4 FOXp3 RORγt

GAGGATACCACTCCCAACAGACC TCCAGAAGGCCCTCAGACTA GGAAGCACGGCAGCAGAATA CATCTTCTCAAAATTCGAGTGACAA CACAGCCACCATGAATTACG CCCCTCTGGATTGATGGGTACAT CCCAGGAAAGACAGCAACCTT GGAGCTCTGCCAGAATGACC

AAGTGCATCATCGTTGTTCATACA AGC ATC TTC TCG ACC CTG AA AAC TTG AGGGAGAAGTAGGAATGG TGGGAGTAGACAAGGTACAACCC TGGAGGTAGAACTGGCGTCT GGTCCACCCAGGTGAATTATC TTCTCACAACCAGGCCAC TTG CAAGGCTCGAAACAGCTCCAC

2.6. Immunohistochemistry To prepare tissues for immunohistochemistry, tissues were processed and fixed as described elsewhere (Tran et al., 2000). The samples were stored at −80 °C till sectioning. Frozen sections (12 μm) of fixed tissues were processed for immunohistochemistry using directly conjugated anti CD4 (Apc-red) and anti Foxp3 (FITC-green) (ebioscience). 2.7. Statistical analysis Clinical score, cumulative clinical score, cytokine assays and realtime expression between the various treatments groups were analyzed by 2-tailed, paired Student's t test. Probability values of P b 0.05 or less were considered significant. Statistical significance of GA treatment is indicated in figures by asterisks (⁎ or ⁎⁎). 3. Results 3.1. GA prevents onset and delays progression of EAE in mouse models Clinical assessment of EAE was performed daily. The onset of EAE typically occurred after day 12.4 in both mouse models, with

60

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

C57BL/6 mice having a later onset than 2D2 mice (Fig. 1). Our results confirm earlier report (Bettelli et al., 2003) that demonstrated 2D2 transgenic mice develop more severe EAE compared with the nontransgenic littermates. GA completely blocked the onset of EAE in the C57BL/6 model and reduced the severity of clinical symptoms of EAE in the 2D2Tg model. Depletion of the CD25+ population exacerbated disease, which was reduced by GA treatment. 3.2. GA suppresses expression of mRNA for IL-6, IL-17, TNF-α, and IL-12/IL23 in brain Expression of mRNA for IL-6, IL-17, RORγt, TNF-α, and IL-12 (p40) in brain tissue was measured with real-time PCR (RT-PCR). The effect of GA on expression of IL-6 and IL-17 in brain was evaluated in EAE induced C57BL/6 mice, before and after depletion of CD25+ cells (Fig. 2a and c, respectively) and in 2D2Tg mice (Fig. 2b). Induction of EAE in C57BL/6 mice resulted in N10-fold increase in expression of IL-6 and IL-17 in brain tissue, as shown in Fig. 2a. GA caused a significant decrease in mRNA expression in brain for IL-6 and IL-17 in EAE induced C57BL/6 mice, with and without CD25+ depletion (Fig. 2a and c). GA also suppressed the expression of IL-6 and IL-17 in brain tissue from 2D2Tg mice (Fig. 2b), although the magnitude of the effect was not as robust as in the C57BL/6 mice and failed to reach statistical significance. To determine the effect of GA on Th1 polarization in C57BL/6/EAE animals with or without Treg, the expression of TNF-α and IL-12/IL-23 cytokines in the brain of EAE induced C57BL/6 mice, before and after CD25+ depletion, was measured with RT-PCR (Fig. 3). CD25 + cell depletion in the C57BL/6/EAE model caused a substantial increase in TNF-α mRNA expression over that caused by EAE induction alone. This

increase was not seen for IL-12(p40) in CD25+ depleted mice. GA caused significant decreases (P b 0.001) in mRNA expression of both TNF-α and IL-12 (p40) in EAE induced C57BL/6 mice (Fig. 3a). GA also caused a statistically significant decrease in TNF-α in CD25 + T cell depleted EAE induced C57BL/6 mice; however, the effect of GA on expression of IL-12 (p40) in CD25 + depleted mice was not statistically significant (Fig. 3b). 3.3. GA suppresses expression of mRNA for RORγt in brain, lymph node, and spleen RORγt expression was assessed to confirm the effect of GA on IL-17 expression in vivo (McGeachy et al., 2007). GA caused a significant decrease (P b 0.001) in the expression of RORγt mRNA in the brain, lymph node and spleen of EAE induced C57BL/6 mice (Fig. 4) that corresponded to the decline observed in expression of IL-17 in response to GA treatment. An increased in the expression of RORγt in the brain, lymph nodes and spleen of EAE induced CD25+ depleted and EAE induced 2D2Tg mice was observed and GA caused a decrease in the expression of RORγt mRNA in the spleen of EAE induced CD25+ depleted mice compared to EAE induced 2D2Tg mice (data not shown). 3.4. Effect of GA on plasma concentration of IL-6, IL-17, TNF-α, and IL-12 (p40) The effect of GA on Th1/Th17 polarization in the peripheral immune system was analyzed by measuring the concentration of IL-6, IL-17, TNF-α, and IL-12 (p40) cytokines in plasma from EAE induced C57BL/6 and 2D2Tg mice with the Luminex immunoassay. Both IL-6 and IL-17 were below the limit of quantitation in plasma samples from EAE induced C57BL/6 mice (data not shown).

Fig. 1. Effect of GA on progression of EAE in C57BL/6 and 2D2 transgenic (Tg) mice. Clinical assessment of EAE was performed daily and mice were scored for disease according to the following criteria: 0, no disease; 1, decreased tail tone; 2, hind limb weakness or partial paralysis; 3, complete hind limb paralysis; 4, front and hind limb paralysis; 5, moribund state. All experiments were performed when diseased animal reached score 3. The results are expressed as the mean daily clinical score of each experimental group (left panel) or mean cumulative clinical score of each experimental group (right panel, a–c). Results represent the pooled data of three independent experiments for a total of 14 mice/group. Left panel: ⁎, P b 0.05; ⁎⁎, P b 0.01, for EAE (EAE induced C57BL/6) vs EAE/GA (EAE induced mice treated with GA); 25−/EAE (CD25+ depleted EAE induced C57BL/6) vs 25−/EAE/GA (CD25+ depleted EAE induced treated with GA); 2D2/EAE (EAE induced 2D2Tg mice vs 2D2/EAE/GA (EAE induced 2D2Tg mice treated with GA). The right panel (a–c) depicts the cumulative scores of each experimental group (EAE induced and EAE induced GA treated C57BL/6, CD25+ depleted and 2D2Tg groups). DCumulative scores were calculated as the sum of all scores from disease onset to day 21 and divided by the number of mice in each group; ⁎⁎, P b 0.001 for GA treated groups. N1, Number of mice/group.

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

61

Fig. 2. Expression of IL-6 and IL-17 mRNA in brain. Brain tissue was harvested from mice for measurement of IL-6 and IL-17 mRNA by RT-PCR. Data shown is one experiment that represents the results seen in 5 independent experiments. Data depict the mean of 4–6 different mice ± SEM. a, C57BL/6 mice; b), 2D2 Transgenic mice; c,) CD25+ depleted C57BL/6 mice. NM (naïve mice); EAE (EAE induced mice); EAE/GA (EAE induced mice treated mice with GA). Data are given as relative mRNA expression. Asterisks (⁎ P b 0.05, ⁎⁎ P b 0.01) indicate statistical significance of GA treatments. N1, Number of mice/group.

As shown in Fig. 5a, EAE induction caused a substantial increase in plasma concentration of IL-12 (p40) and TNF-α in C57BL/6 mice, which was almost completely blocked by treatment with GA (P b 0.001). The concentration of IL-12 (p40) in plasma from EAE induced 2D2Tg mice was lower (P N 0.05) than in naïve 2D2 animals, and was below the limit of quantitation (BLQ) in GA treated animals (Fig. 5b).

3.5. GA induces expression of SMAD3 and FOXp3, but suppresses STAT4 in brain The effect of GA on expression of mRNA in signal transduction pathways associated with TGF-β and Th2 polarization was evaluated under the condition of Treg induction. Expression of mRNA for SMAD3

Fig. 3. Expression of TNF-α and IL-12/IL-23 mRNA in brain. Brain tissues were harvested from mice for measurement of TNF-α and IL-12 (p40) mRNA by RT-PCR. a, C57BL/6 mice; b, CD25 + depleted C57BL/6 mice. NM (naïve mice); EAE (EAE induced mice); EAE/GA (EAE induced mice treated with GA). Data are given as relative mRNA expression. Results are representative of four independent experiments and data depict the mean of 4–6 different mice ± SEM. Asterisks (⁎⁎ P b 0.001) indicate statistical significance of GA treatments. N1, Number of mice/group.

62

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

EAE induction caused N7-fold increase of mRNA for STAT4, a component of the signaling pathway associated with Th1 polarization, in brain tissue from C57BL/6 mice (Fig. 6b). Note that unlike the observations with SMAD3, the induction of STAT-4 in EAE induced C57BL/6 mice was almost completely blocked by GA. Simultaneous to the increase in SMAD3 and the decrease in STAT4 expression, GA caused a statistically significant (P b 0.001) increase in the expression of FOXp3 mRNA in spleen from EAE induced C57BL/6 mice (Fig. 6c). CD25+-depleted C57BL/6 mice following EAE induction had significantly lower expression of FOXp3 in spleen than mice without CD25+ depletion, which was not significantly changed by GA treatment (Fig. 6c). Further, histochemical analysis for the expression of FOXp3 (Fig. 6, d–e) in brain from EAE induced C57BL/6 mice shows that GA treatment increased CD4 + FOXp3 cells in the brain. 4. Discussion

Fig. 4. Expression of RORγt mRNA in brain, lymph node, and spleen. Brain, lymph node, and spleen tissues were harvested from C57BL/6 mice for measurement of RORγt mRNA by RTPCR. a) brain; b) lymph node; c) spleen. NM (naïve mice); EAE (EAE induced mice); EAE/GA (EAE induced mice treated with GA). The data are given as relative mRNA expression RORγt. Data are one representative of 5 independent experiments and depict the mean of 4–6 different mice± SEM. Asterisks (⁎⁎ P b 0.001) indicate statistical significance of GA treatments. N1, Number of mice/group.

and STAT-4 in brain from EAE induced C57BL/6 and 2D2Tg mice was determined by RT-PCR. FOXp3 expression in spleen was analyzed in EAE induced C57BL/6 and CD25+ depleted mice. GA caused a statistically significant increase (P b 0.001) in mRNA expression of the TGF-β signaling molecule, SMAD3, in brain tissue from EAE induced C57BL/6 and from 2D2Tg mice (Fig. 6a).

Recent studies have demonstrated the potential importance of IL17 secreting T cells and the IL-17 receptor in multiple sclerosis (Martin-Saaveda et al., 2007) and the Th17:Th1 ratio of infiltrating T cells determines where inflammation occurs in the CNS (Stromnes et al., 2008). In these studies we extend previous reports and demonstrate that GA has a profound effect on disease reduction in experimental models of MS as mediated through a reduction in the expression of IL-17 secreting T cells. We and others have demonstrated that GA has a profound effect on controlling EAE in C57BL/6 mice. Daily evaluation of clinical signs demonstrated that the MOG immunization protocol induced EAE as expected. GA had a particularly dramatic effect in wild type C57BL/6 mice, where it completely blocked onset of disease symptoms, as shown in previous studies (Teitelbaum et al., 1971; Gilgun-Sherki et al., 2003). We further demonstrate that GA is also able to control disease severity in the 2D2 TCR transgenic mouse. It has been reported that 2D2 TCR transgenic mice develop severe EAE that was immunologically indistinguishable from the nontransgenic control mice. Transgenic mice had typical EAE inflammatory/demyelinating changes and edema in their brains and spinal cords (Bettelli et al., 2003). This is perhaps due to the high frequency of myelin specific T cells that traffic into the CNS. GA appeared to be effective at reducing

Fig. 5. Concentrations of IL-12 (p40) and TNF-α in plasma from EAE induced and GA treated mice. Plasma samples were collected for measurement of TNF-α and IL-12 (p40) levels by the Luminex assay. a) C57BL/6 mice; b) 2D2 Transgenic mice. NM (naïve mice); EAE (EAE induced mice); EAE/GA (EAE induced mice treated with GA). Data are shown as pg/ml and depict the mean of four different experiments ± SEM. The following samples were below the limit of quantitation (BLQ) and appear as zero values: IL-12 (p40) in plasma from 2D2/ EAE/GA mice; TNF-α in naïve C57BL/6 and in 2D2/EAE/GA mice. Asterisks (⁎⁎ P b 0.001) indicate statistical significance of GA treatments.

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

63

Fig. 6. Expression of SMAD3, STAT-4, and FOXp3 mRNA in brain and spleen. Brains and spleens from mice were harvested and RNA was extracted for SMAD3, STAT-4, and FOXp3 mRNA expression by RT-PCR. a) Brain from C57BL/6 and 2D2 Transgenic mice; b) Brain from C57BL/6 mice; c) Spleen from C57BL/6 and CD25+ cell depleted C57BL/6 mice; d) Brain from C57BL/6 mice. Treatment groups: NM (Naïve C57BL/6); EAE (/EAE induced C57BL/6); EAE/GA (EAE induced C57BL/6 treated with GA); 2D2/NM (naïve 2D2Tg); 2D2/EAE (EAE induced 2D2Tg); 2D2/EAE/GA (EAE induced 2D2Tg treated with GA); CD25−/EAE (CD25+ depleted EAE induced C57BL/6); CD25−/EAE/GA (CD25+ depleted EAE induced C57BL/6 treated with GA). Data shown is one experiment that represents results seen in 3 independent experiments and depict the mean of 4–6 different mice ± SEM. Asterisks indicate statistical significance (⁎⁎, P b 0.001) of GA treatments. a and b) Expression of mRNA for SMAD3 and STAT-4 in brain; c) Expression of mRNA for FOXp3 in spleen; d–e) Immunohistochemical analysis of FOXp3 expression (green) by CD4+ cells (red) in the brains of EAE induced and EAE induced C57BL/6 mice treated with GA, respectively; merged image of GA treated brain (arrow shows CD4 + FOXp3+ cells); merged image of brain from EAE induced mice, (CD4+ cells with low FOXp3 expression) stained with same molecules as GA treated brain. Representative images (20×) from 3 experiments.

the severity of disease in these TCR MBP transgenic mice. Although the effect of GA on disease in this model is reduced compared to primary disease in B6 mice, we have observed that GA can reduce mRNA expression of IFNγ and increase Foxp3 from GA treated 2D2 mice (data not shown). In order to evaluate the effect of GA on T cell differentiation, key cytokines and mediators were selected from the Th1, Th17, and Treg pathways. The differentiation of a CD4+ effector cell to either a Th17 inflammatory cell or a FOXp3 regulatory cell is dependent upon the cytokine environment as well as other intrinsically expressed molecules (Bettelli et al., 2007). 4.1. GA inhibits Th1 pathway This current study demonstrated that GA caused a reduction in IL12/IL-23 mRNA in the brain, and also caused decreased plasma levels of TNF-α in EAE induced wild type and 2D2 transgenic mice, and decreased IL-12/IL-23 in wild type EAE induced C57BL/6 mice 2D2 mice. GA reduced STAT-4 mRNA production in brain, which is a key transcription factor in the Th1 pathway (Szabo et al., 2003; Park et al., 2005). This would result in less differentiation and fewer Th1 cells to migrate from the periphery to the brain. A considerable increase in the mRNA expression of the cytokines TNF-α and IL-12/IL-23 occurred in animals that were depleted of Treg cells with anti-CD25 treatment, which is consistent with previous research on Treg-mediated suppression of Th cell proliferation (Jee et al., 2007). GA reduced the increase in TNF-α mRNA in brain, but had no effect on IL-12/IL-23 mRNA suggesting that GA's effects on IL-12/IL-23 may be partially mediated by the effect on Treg activity. Treg cells are important in the recovery from EAE and GA treated CD25+ depleted mice express considerably

lower FOXp3, which may restrain proinflamatory cells like Th17 which are maintained by IL-23 (Ivanov et al., 2006). 4.2. GA inhibits Th17 pathway and stimulates adaptive Treg pathway Induction of EAE in wild type C57BL/6 mice caused a marked increase in mRNA in the CNS for the proinflammatory cytokines, IL-6, IL-17, and also increased RORγt, a factor, involved in differentiation of the Th17 cell lineage. Both of these cytokines as well as RORγt, which is required for IL-17 activity, were reduced significantly in the CNS of EAE C57BL/6 mice in response to therapy with GA. GA may have a direct effect on disease progression by either mediating inhibition of the Th17 pathway, which would reduce proinflammatory mediators and ameliorate disease activity, or a direct enhancement by increasing TGF-β (as determined by SMAD3 expression) and a corresponding increase in Treg function that may indirectly reduce either IL-6 or IL-17 expression and polarization. TGF-β directs the differentiation of Treg and proinflamatory Th17 cells, by facilitating IL-17 production early after exposure to IL-6 and in retarding further Th17 differentiation (Yang et al., 2008). GA caused an increase in FOXp3 in spleen and SMAD3 mRNA in brain tissues. Since FOXp3 is a marker for Treg cells (Kasper et al., 2007), and SMAD3 is necessary for activation by TGF-β (Xiao et al., 2000; Zhou et al., 2007) this correlates with previous findings that GA stimulates differentiation of Treg cells (Haque et al., 2006). As expected, we have found that GA has little effect on FOXp3 expression in animals that had been depleted of CD25+ cells. However, we observed that EAE induction in CD25+ depleted C57BL/6 animals caused a substantial increase in IL-6 and IL-17, as expected when Tregmediated suppression of Th17 activation is removed. Of interest, GA caused a statistically significant reduction in mRNA for these cytokines

64

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65

in the CD25 depleted model, suggesting that the effects of GA on the Th17 pathway may not be dependent upon Treg cell activation. A recent study has found that the secretion of cytokines varies from the CD25 + FOXp3 + Treg cells and CD25 + Treg cells that do not express FOXp3. These CD25 + Treg cells without FOXp3 expression have been shown to proliferate in response to stimulation by GA and other amino acid copolymers (Stern et al., 2008).

Pharmaceuticals, LTD, Petah Tiqva, Israel, NIAID AI061938 and National Multiple Sclerosis Society CA1027A1/3.

4.3. Overall effects of GA on EAE disease progression

References

The regulatory effect of GA on the control of human multiple sclerosis has been focused previously on its effect on Th2 polarization. In this study, we report that GA has a significant downregulatory effect on IL-17, IL-6, as well as IL-12/IL-23 expression within the CNS that may be responsible for mediating the anti-inflammatory effect in EAE induced mice. GA treatment also decreased RORγt expression in the CNS, further supporting a role for the effect of GA on the inhibition of a distinct IL-17 secreting CD4+ cell population. Although we observed a reduction in the expression of RORγt there did not appear to be any substantial impact on IL17 protein secretion by splenocytes following 3 days of in vitro stimulation of the whole splenocyte population with anti CD3 (data not shown). This may be explained by the poor translation efficiency and protein turn over under the culture conditions. Other intrinsic factors may include strains of mice from which cells were obtained or perhaps the stimulus used for activating protein secretion. RT-PCR analysis on IL6 and IL-17 from spleen tissues demonstrated a trend toward diminished RNA expression of IL-6 and IL-17 cytokines although it did not reach a statistical significance (data not shown). However, it is important to emphasize that there is a demonstrable biologic effect of GA on immunologic changes within the CNS the site of disease activity in both EAE and human multiple sclerosis. The observation that GA decreased IL-6 and IL-17 mRNA expression in CNS from CD25 depleted, C57BL/6/EAE induced mice suggests that GA may also mediate Treg-independent cellular mechanisms distinct from those observed in GA treated C57BL/6/EAE mice without CD25 depletion. This effect on IL-17 and IL-6 expression could be at the level of the antigen presenting cells such as CD11c + monocytes in which GA treatment primes this population so that there is a decreased secretion of IL-6 (Weber et al., 2007). Observations from our laboratory have reported the effect of GA on the downregulation of important pattern recognition molecules, in particular TLR9 (toll-like receptor 9), by GA (Begum-Haque et al., 2007). This regulatory effect on TLR activation could in turn lead to an inactivated antigen presenting cell that would not favor Th17 polarization. Moreover, the corresponding effect of GA on SMAD3 and subsequent increased expression of TGF-β without IL-6 lead to an expansion of the Treg population. This could be further explained by the effect of GA on the Th17 pathway, and the substantial reduction of STAT-4 mRNA in brain. These findings support the concept that GA can affect multiple immune mediated pathways involved in the pathogenesis of EAE. This includes a skewing toward Treg cells that are involved in the reduction of disease progression as well as a Treg-independent reduction of proinflammatory cytokines generated through the Th1 and Th17 pathways. How these two processes are linked is currently under investigation in our laboratory. Together these two effects have a regulatory impact on maintaining immune homeostasis in this experimental model of human MS.

Aharoni, R., Teitelbaum, D., Sela, M., Arnon, R., 1997. Copolymer 1 induces T cells of the T helper type 2 that crossreact with myelin basic protein and suppress experimental autoimmune encephalitis. Proc. Natl. Acad. Sci. U. S. A. 94, 10821–10826. Aharoni, R., Teitelbaum, D., Leitner, O., Meshorer, A., Sela, M., Arnon, R., 2000. Specific Th2 cells accumulate in the central nervous system of mice protected against experimental autoimmune encephalomyelitis by copolymer 1. Proc. Natl. Acad. Sci. U. S. A. 97, 11472–11477. Aharoni, R., Kayhan, B., Eilam, R., Sela, M., Arnon, R., 2003. Glatiramer acetate-specific T cells in the brain express T helper 2/3 cytokines and brain-derived neurotrophic factor in situ. Proc. Natl. Acad. Sci. U. S. A. 100, 14157–14162. Aharoni, R., Eilam, R., Domev, H., Labunskay, G., Sela, M., Arnon, R., 2005. The immunomodulator glatiramer acetate augments the expression of neurotrophic factors in brains of experimental autoimmune encephalomyelitis mice. Proc. Natl. Acad. Sci. U. S. A. 102, 19045–19050. Begum-Haque, S., Sharma, A., Foureau, D., Haque, A., Kasper, L.H., 2007. Downregulation of Toll-receptor mediated chemotaxis factors by glatiramer acetate and migration of regulatory T-cells into CNS. Mult. Scler. 13, S160 2007. Bettelli, E., 2007. Building different mouse models for human MS. Ann. N.Y. Acad. Sci. 1103, 11–18. Bettelli, E., Pagany, M., Weiner, H.L., Linington, C., Sobel, R.A., Kuchroo, V.K., 2003. Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J. Exp. Med. 197, 1073–1081. Bettelli, E., Korn, T., Kuchroo, V.K., 2007. Th17: the third member of the effector T cell trilogy. Curr. Opin. Immunol. 19, 652–657. Chen, M., Gran, B., Costello, K., Johnson, K., Martin, R., Dhib-Jalbut, S., 2001. Glatiramer acetate induces a Th2-biased response and cross reactivity with myelin basic protein in patients with MS. Mult. Scler. 7, 209–219. Gilgun-Sherki, Y., Panet, H., Holdengreber, V., Mosberg-Galili, R., Offen, D., 2003. Axonal damage is reduced following glatiramer acetate treatment in C57/bl mice with chronic-induced experimental autoimmune encephalomyelitis. Neurosci. Res. 47, 201–207. Gold, R., Luhder, F., 2008. Commentary: interleukin 17-extended features of a key player in multiple sclerosis. Am. J. Pathol. 172 (1), 8–10. Haque, S., Gondek, D., Kasper, L.H., 2006. Glatiramer acetate induces a CD4 + CD25 + T regulatory cell subset that is associated with low level alpha4beta1 (a4b1) expression ex vivo. J. Neurol. 253 (Suppl 2), 102. Hohlfeld, R., Wekerle, H., 2004. Autoimmune concepts of multiple sclerosis as a basis for selective immunotherapy: from pipe dreams to (therapeutic) pipelines. Proc. Natl. Acad. Sci. U. S. A. 101, 14599–14606. Ivanov, I.I., McKenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua, D.J., Littman, D.R., 2006. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17 + T helper cells. Cell 126, 1121–1133. Jarvinen, L.Z., Blazar, B.R., Adeyi, O.A., Strom, T.B., Noelle, R.J., 2003. CD154 on the surface of CD4 + CD25 + regulatory T cells contributes to skin transplant tolerance. Transplantation 76, 1375–1379. Jee, Y., Piao, W.H., Liu, R., Bai, X.F., Rhodes, S., Rodebaugh, R., Campagnolo, D.I., Shi, F.D., Vollmer, T.L., 2007. CD4 + CD25 + regulatory T cells contribute to the therapeutic effects of glatiramer acetate in experimental autoimmune encephalomyelitis. Clin. Immunol. 125, 34–42. Johnson, K.P., Brooks, B.R., Cohen, J.A., Ford, C.C., Goldstein, J., Lisak, R.P., Myers, L.W., Panitch, H.S., Rose, J.W., Schiffer, R.B., 1995. Copolymer 1 reduces relapse rate and improves disability in relapsing-remitting multiple sclerosis; results of a phase III multicenter, double-blind, placebo-controlled trial. The Copolymer 1 Multiple Sclerosis Study Group. Neurology 45, 1268–1276. Kasper, L.H., Haque, A., Haque, S., 2007. Regulatory mechanisms of the immune system in multiple sclerosis. T regulatory cells: turned on to turn off. J. Neurol. 254S, 10–14. Kawanokuchi, J., Shimizu, K., Nitta, A., Yamada, K., Mizuno, T., Takeuchi, H., Suzumura, A., 2008. Production and functions of IL-17 in microglia. J. Neuroimmunol. 194 (1–2), 54–61. Kebir, H., Kreymborg, K., Ifergan, I., Dodelet-Devillers, A., Cayrol, R., Bernard, M., Giuliani, F., Arbour, N., Becher, B., Prat, A., 2007. Human TH17 lymphocytes promote blood–brain barrier disruption and central nervous system inflammation. Nat. Med. 13, 1173–1175. Mangan, P.R., Harrington, L.E., O'Quinn, D.B., Helms, W.S., Bullard, D.C., Elson, C.O., Hatton, R.D., Wahl, S.M., Schoeb, T.R., Weaver, C.T., 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441, 231–234. Martin-Saaveda, F.M., Flores, N., Dorado, B., Eguiluz, C., Bravo, B., Garcia-Merino, A., Ballester, S., 2007. Beta-interferon unbalances the peripheral T cell proinflammatory response in experimental autoimmune encephalomyelitis. Mol. Immunol. 44, 3597–3607. McGeachy, M.J., Stephens, L.A., Anderton, S.M., 2005. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4 + CD25 + regulatory cells within the central nervous system. J. Immunol. 175, 3025–3032.

Acknowledgments We thank Dr Vijay Kuchroo (Harvard Medical School, Boston, MA) for providing the transgenic 2D2 mice, Drs Jacqueline Channon-Smith and Javier Ochoa-Reparaz (Dartmouth Medical School, Hanover, NH) for helpful discussions and Kathy Smith (Dartmouth Medical School, Hanover, NH) for Luminex assay. Nita Cogburn, PhD (Overland Park KS) and Pippa Loupe, PhD, (Teva Neuroscience, Kansas City MO) for manuscript assistance. Work was supported by a grant from Teva

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jneuroim.2008.07.018.

S. Begum-Haque et al. / Journal of Neuroimmunology 204 (2008) 58–65 McGeachy, M.J., Bak-Jensen, K.S., Chen, Y., Tato, C.M., Blumenschein, W., 2007. TGF-β and IL-6 drive the production of IL-17 and IL-10 by T cells and restrain T(H)-17 cellmediated pathology. Nat. Immunol. 12, 1390–1397. Minns, L.A., Menard, L.C., Foureau, D.M., Darche, S., Ronet, C., Mielcarz, D.W., BuzoniGatel, D., Kasper, L.H., 2006. TLR9 is required for the gut-associated lymphoid tissue response following oral infection of Toxoplasma gondii. J. Immunol. 17, 7589–7597. Park, H., Li, Z., Yang, X.O., Chang, S.H., Nurieva, R., Wang, Y.H., Wang, Y., Hood, L., Zhu, Z., Tian, Q., Dong, C., 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 11, 1133–1141. Quezada, S.A., Bennett, K., Blazar, B.R., Rudensky, A.Y., Sakaguchi, S., Noelle, R.J., 2005. Analysis of the underlying cellular mechanisms of anti-CD154-induced graft tolerance: the interplay of clonal anergy and immune regulation. J. Immunol. 175, 771–779. Schreiner, B., Bailey, S.L., Miller, S.D., 2007. T-cell response dynamics in animal models of multiple sclerosis: implications for immunotherapies. Expert Rev. Clin. Immunol. 3, 75-72. Stern, J.N., Keskin, D.B., Zhang, H., Lv, H., Kato, Z., Strominger, J.L., 2008. Amino acid copolymer-specific IL-10-secreting regulatory T cells that ameliorate autoimmune diseases in mice. Proc. Natl. Acad. Sci. U. S. A. 105, 5172–5176. Stromnes, I.M., Cerretti, L.M., Liggitt, D., Harris, R.A., Goverman, J.M., 2008. Differential regulation of central nervous system autoimmunity by TH1 and TH17 cells. Nat. Med. 14, 337–342. Szabo, S.J., Sullivan, B.M., Peng, S.L., Glimcher, L.H., 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21, 713–758.

65

Teitelbaum, D., Meshorer, A., Hirshfeld, T., Arnon, R., Sela, M., 1971. Suppression of experimental allergic encephalomyelitis by a synthetic polypeptide. Eur. J. Immunol. 1, 242–248. Tran, M.T., Ritchie, M.H., Lausch, R.N., Oakes, J.E., 2000. Calcitonin gene-related peptide induces IL-8 synthesis in human corneal epithelial cells. J. Immunol. 164, 4307–4312. Weaver, C.T., Harrington, L.E., Mangan, P.R., Gavrieli, M., Murphy, K.M., 2006. Th17: an effector CD4 T cell lineage with regulatory T cell ties. Immunity 24, 677–688. Weber, M.S., Prod'homme, T., Youssef, S., Dunn, S.E., Rundle, C.D., Lee, L., Patarroyo, J.C., Stuve, O., Sobel, R.A., Steinman, L., Zamvil, S.S., 2007. Type II monocytes modulate T cell-mediated central nervous system autoimmune disease. Nat. Med. 13, 935–943. Xiao, Z., Liu, X., Henis, Y.I., Lodish, H.F., 2000. A distinct nuclear localization signal in the N terminus of Smad3 determines its ligand-induced nuclear translocation. Proc. Natl. Acad. Sci. U. S. A. 97, 7853–7858. Yang, X.O., Pappu, B.P., Nurieva, R., Akimzhanov, A., Kang, H.S., Chung, Y., Ma, L., Shah, B., Panopoulos, A., Schluns, K.S., Watowich, S.S., Tian, Q., Jetten, A.M., Dong, C., 2008. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity 28, 29–39. Zhou, L., Ivanov, I.I., Spolski, R., Min, R., Shenderov, K., Egawa, T., Levy, D.E., Leonard, W.J., Littman, D.R., 2007. IL-6 program T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat. Immunol. 8 (9), 967–974. Ziemssen, T., Schrempf, W., 2007. Glatiramer acetate: mechanisms of action in multiple sclerosis. Int. Rev. Neurobiol. 79, 537–570.