Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System

Article

Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System Graphical Abstract

Authors Hyo Min Cho, Jae Ryun Ryu, Youhwa Jo, ..., Soon Ji Yoo, Hyun Kim, Woong Sun

Correspondence [email protected]

In Brief Cho et al. report that Drp1 that is the executioner for mitochondrial fission can reduce the mitochondrial membrane potential (MMP) during the mitochondrial division, and this new action helps identify bad sectors in the interconnected mitochondria.

Highlights d

Drp1 reduces MMP via interaction with mitochondrial Zn2+ transporter Zip1

d

Drp1-Zip1 interaction promotes the elimination of bad mitochondrial parts by mitophagy

d

Drp1-dependent MMP reduction is for the selective removal of dysfunctional mitochondria

Cho et al., 2019, Molecular Cell 73, 1–13 January 17, 2019 ª 2018 Elsevier Inc. https://doi.org/10.1016/j.molcel.2018.11.009

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Molecular Cell

Article Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System Hyo Min Cho,1 Jae Ryun Ryu,1 Youhwa Jo,1 Tae Woong Seo,2 Ye Na Choi,2 June Hoan Kim,1 Jee Min Chung,3 Bongki Cho,4 Ho Chul Kang,3 Seong-Woon Yu,4 Soon Ji Yoo,2 Hyun Kim,1 and Woong Sun1,5,* 1Department

of Anatomy, Korea University College of Medicine, Brain Korea 21 plus, Seoul 02841, Republic of Korea of Biology, Kyung Hee University, Seoul 02447, Republic of Korea 3Department of Physiology, Ajou University School of Medicine, Suwon, Gyeonggi-do, Republic of Korea 4Department of Brain & Cognitive Sciences, Daegu Gyeongbuk Institute of Science and Technology, 333 Techno Jungang-daero, Hyeonpung-myeon, Dalseong-gun, Daegu 42988, Republic of Korea 5Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.molcel.2018.11.009 2Department

SUMMARY

Mitophagy, a mitochondrial quality control process for eliminating dysfunctional mitochondria, can be induced by a response of dynamin-related protein 1 (Drp1) to a reduction in mitochondrial membrane potential (MMP) and mitochondrial division. However, the coordination between MMP and mitochondrial division for selecting the damaged portion of the mitochondrial network is less understood. Here, we found that MMP is reduced focally at a fission site by the Drp1 recruitment, which is initiated by the interaction of Drp1 with mitochondrial zinc transporter Zip1 and Zn2+ entry through the Zip1-MCU complex. After division, healthy mitochondria restore MMP levels and participate in the fusion-fission cycle again, but mitochondria that fail to restore MMP undergo mitophagy. Thus, interfering with the interaction between Drp1 and Zip1 blocks the reduction of MMP and the subsequent mitophagic selection of damaged mitochondria. These results suggest that Drp1-dependent fission provides selective pressure for eliminating ‘‘bad sectors’’ in the mitochondrial network, serving as a mitochondrial quality surveillance system. INTRODUCTION Mitochondria comprise a double-membrane organelle that plays a fundamental role in ATP synthesis, calcium homeostasis, and apoptosis (Nunnari and Suomalainen, 2012). These mitochondrial functions are dependent on the mitochondrial membrane potential (MMP) that develops during oxidative phosphorylation (OXPHOS) at the inner mitochondrial membrane (IMM). OXPHOS produces reactive oxygen species (ROS) as a by-product. Dysfunctional mitochondria usually have low MMP levels and generate excess amounts of ROS, which can cause inflammation, DNA mutation, and apoptosis; low MMP is often implicated in several types of diseases, such as neurodegenerative and

metabolic diseases and cancer (Boveris et al., 1972; Schieber and Chandel, 2014; Sorrentino et al., 2018). Therefore, mitochondrial quality control is a crucial process for maintaining cellular homeostasis. A major mitochondrial quality control system is the selective clearance of mitochondria by autophagy, hereafter called ‘‘mitophagy.’’ PTEN-induced putative protein kinase 1 (PINK1) and E3 ubiquitin ligases, such as parkin and Arih1, recognize damaged mitochondria in the mitophagy pathway. More specifically, PINK1 is cleaved and rapidly cleared by mitochondrial inner-membrane proteases, such as PARL, under normal MMP conditions (Narendra et al., 2010; Pickrell and Youle, 2015). On the other hand, depolarization of mitochondria causes inactivation of PARL, which in turn promotes the accumulation of PINK1 at the mitochondrial outer membrane, where PINK1 phosphorylates ubiquitin and E3 ubiquitin ligases, such as parkin and Arih1 (Geisler et al., 2010; Jin et al., 2010; Villa et al., 2017). These changes ultimately recruit autophagy receptors, mediating autophagosome formation and leading to mitophagy (Lazarou et al., 2015). Another important factor affecting mitophagy is the morphological change that mitochondria undergo via the fission-fusion process (Ashrafi and Schwarz, 2013). As autophagosomes have a limited size, chopping mitochondria into small pieces should promote mitophagy (Takeshige et al., 1992). Accordingly, mitochondrial fission is needed for the execution of mitophagy, whereas suppression of the fission-promoting molecule dynamin-related protein Drp1 impairs the execution of mitophagy (Gomes et al., 2011; Rambold et al., 2011). Conversely, mitochondrial fusion permits the repair of mitochondria by the exchange of mitochondrial components and impedes the induction of mitophagy (Nakada et al., 2001). Activated Drp1 moves to mitochondria via recognizing their receptors Mff and divides mitochondria through oligomerization and guanosine triphosphate (GTP)-hydrolysis (Hoppins et al., 2007; Otera et al., 2010). Several studies have demonstrated that a reduction in MMP activates Drp1, thereby promoting mitochondrial fission (Cereghetti et al., 2008; Taguchi et al., 2007; Wang et al., 2012). Various mitochondrial stressors, such as oligomycin and antimycin a, which are inhibitors of OXPHOS activity, induce Drp1dependent mitochondrial fragmentation and promote mitophagy (Guillery et al., 2008). Collectively, these studies propose a model stipulating that mitophagic-stress-mediated reduction of MMP Molecular Cell 73, 1–13, January 17, 2019 ª 2018 Elsevier Inc. 1

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 1. MMP Is Focally Reduced at the Site of Drp1-Mediated Mitochondrial Fission (A) Time-lapse images of MOM (green) and MMP using TMRM (red) during mitochondrial fission (0 s) in HeLa cells. Arrowheads indicate the site of MMP reduction prior to mitochondrial fission. (B) Quantification data of change in mitochondrial area (MOM) and MMP within a defined region of interest (ROI) (arrowheads in A). (C) Quantification graph of t (Tau) value difference of mitochondrial area and TMRM in graph (n = 10 cells). (D) Time-lapse images of mitochondrial inner compartment (green) and MMP (red) during mitochondrial fission. (E) Quantification graph of t (Tau) value difference of mitochondrial inner compartment and TMRM in graph (n = 7 cells). (F) Time-lapse images of YFP-Drp1 (green) and MMP (red) in mitochondria. (G) Graph for mean fluorescence intensity at a defined ROI (arrowheads in F). 0 s indicates the time at which YFP-Drp1 puncta formed in the mitochondria.

promotes Drp1-dependent mitochondrial fission as well as induction of depolarization-mediated mitophagy. However, a recent study demonstrated that treatment with purified Drp1 to mitochondria decreases MMP (Bras et al., 2007). Furthermore, suppression of mitophagy pathways paradoxically prevents mitochondrial fragmentation (Yu et al., 2011). These studies indicate that the interplay between mitochondrial fission and MMP regulation for mitophagy is not yet clearly understood. Specifically, the current model is based primarily on experimental observations after massive induction of mitophagy by treatment with strong stressors, and it is not known how the damaged mitochondrial component is selected under the normal physiological conditions when most mitochondria form an interconnected network. Here, we found that Drp1 interacts with mitochondrial Zip1 and thereby regulates MMP. Interestingly, the GTPase activity of Drp1 was dispensable for the interaction of Drp1 with Zip1. The Drp1-Zip1 interaction occurred at a mitochondrial fission site, where reduction in MMP occurred several seconds prior to the completion of mitochondrial division. Furthermore, inhibition of the Drp1-Zip1 interaction decreased the population of short mitochondria with low MMP levels, and these mitochondria were destined to be removed by mitophagy. Taken together, these results suggest that the interaction between Drp1 and Zip1 regulates MMP and allows for testing for the potential restoration of MMP levels in mitochondria and thus assessing the general health of mitochondria. Therefore, we propose a novel

2 Molecular Cell 73, 1–13, January 17, 2019

model of mitochondrial quality surveillance that involves the selection of damaged mitochondria for mitophagy. RESULTS Reduction of MMP at the Mitochondrial Fission Site Occurs prior to Mitochondrial Division To assess the relationship between mitochondrial morphology and MMP levels during the mitochondrial fission process, we performed time-lapse imaging of mitochondria after dual labeling the mitochondria with TOM20-GFP for the mitochondrial outer membrane (MOM) and visualization of mitochondrial fission and with tetramethylrhodamine (TMRM) for MMP. Interestingly, we noticed that MMP levels were transiently reduced at fission sites several seconds prior to the completion of mitochondrial division (Figure 1A). To quantitatively examine whether the TMRM signals disappear before the mitochondrial fission has been completed, we analyzed the rate of disappearance (t) by fitting the disappearance curve to one-phase decay function. In support of this notion, the t value of MMP reduction was significantly smaller than the t of TOM20-GFP signal reduction (Figures 1B and 1C). Previously, we reported that there is constriction of mitochondrial inner compartments (CoMIC) without mitochondrial fission (Cho et al., 2017), raising the possibility that reduction of TMRM signals is not associated with mitochondrial fission but rather is caused by CoMIC. However, time-lapse imaging using blue fluorescent protein (BFP)-mito,

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 2. Drp1 Regulates MMP and Mitochondrial Fission Separately and Interacts with Zip1 in Mitochondria (A) Schematic illustration of Drp1-mediated mitochondrial fission. A395D, a middle domain mutant of Drp1, has a dominant negative effect on Drp1 recruitment to mitochondria. K38A, a GTPase-activity-defective mutant, prevents constriction of the Drp1 oligomer. S35A, another mutant, exhibits enhanced GTPase activity. (B) Representative images of MMP and mitochondrial morphology in cells expressing YFP-Drp1 WT or YFP-Drp1 mutants. To show mitochondrial morphology, cells were fixed with 4% paraformaldehyde (PFA) after live imaging and stained with specific antibody raised against cytochrome c (grayscale). (C) Average TMRM intensity in each group of live cells. Data represent mean ± SEM (**p < 0.01; n = 30). (D) Quantification data of mitochondrial morphology in WT-Drp1- or mutant-Drp1-expressing cells (n > 100). The numbers of cells with normal mitochondrial morphology (‘‘intermediate’’), fragmented mitochondria (‘‘fragment’’), and network mitochondria (‘‘elongate’’) were counted. (E) Immunoblotting of Zip1 in cytosolic and mitochondrial fractions. VDAC, Gaq, and tubulin were used as markers for mitochondria, cell membrane, and loading control, respectively. (F) Representative Airyscan images of cells immunostained with specific antibodies raised against Zip1 and TOM20. (G) Immunoprecipitation analysis to verify the interaction between Drp1 and Zip1. The input lane contained 10% of the total amount of cell lysate. (H) Binding of Drp1 to Zip1 was visualized by Duolink analysis. To show the mitochondria, cells were transfected with GFP-mito. (I) Myc pull-down analysis demonstrating the interaction between Zip1 and Drp1 K38A. The input lane contained 5% of the total amount of cell lysate. See also Figures S1, S2, and S3.

which labeled mitochondrial inner compartments, clearly demonstrated that the reduction of MMP occurred prior to the fission of both the outer and inner mitochondrial membranes (Figure 1D). Consistently, the TMRM t value was also smaller than the reduction of BFP-mito (Figure 1E). Drp1 is translocated from the cytosol to the mitochondrial fission site, where it oligomerizes to mediate mitochondrial division (Legesse-Miller et al., 2003; Smirnova et al., 1998; Figure 2A). Therefore, there is a time gap (mean 45 ± 104.8 s) between initial Drp1 translocation and mitochondrial division (Ji et al., 2015). Interestingly, this time interval is similar to that between MMP reduction and mitochondrial division, and we found that the formation of the mitochon-

drial yellow fluorescent protein (YFP)-Drp1 puncta and the reduction of MMP levels co-occurred at the site of MMP reduction (Figures 1F and 1G). These results suggest that mitochondrial translocation of Drp1 causes focal MMP reduction. Drp1 without GTPase Activity Regulates MMP To assess the molecular mechanism underlying Drp1-dependent MMP reduction, we examined the effects of overexpression of Drp1 mutants on MMP. Drp1 translocates from the cytosol to the MOM and forms a ring structure through oligomerization, which can be prevented by Drp1 A395D, a mitochondrial-targeting-defective Drp1 (Chang et al., 2010; Smirnova et al., 1998).

Molecular Cell 73, 1–13, January 17, 2019 3

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

GTP hydrolysis drives the constriction of the mitochondrial fission site, and this step is prevented by Drp1 K38A, a GTPase-activity-defective mutant (Chang et al., 2010; Smirnova et al., 2001). On the other hand, the S35A mutation is known to enhance Drp1 GTPase activity by 2-fold compared with wildtype (WT) Drp1 (Smirnova et al., 2001; Wenger et al., 2013; Figure 2A). As previously reported, overexpression of WT Drp1 promoted robust reduction of MMP as well as mitochondrial fragmentation (Sarin et al., 2013). MMP reduction appears to be dependent on the Drp1 expression level, as we found that the rate of MMP reduction correlated with the initial amount of Drp1 plasmid transfected into the cells (Figures S1A and S1B). Interestingly, overexpression of Drp1 K38A or S35A markedly reduced MMP levels, and these two mutants exhibited opposing effects on the mitochondrial fragment according to their GTPase activity (Figures 2B–2D). These results indicate that the GTPase activity of Drp1 is dispensable for Drp1-dependent MMP reduction. This finding was further confirmed by demonstrating that there is no significant correlation between the GTPase activity of various Drp1 mutants and their MMP-reducing activity (Figures S1C and S1D). On the other hand, Drp1 A395D, which cannot translocate to the MOM, failed to modify MMP levels (Figures 2B and 2C). Collectively, these data suggest that MMP reduction and mitochondrial fragmentation are two separable events mediated by Drp1 and that mitochondrial recruitment of Drp1 is necessary for suppression of MMP. Therefore, we hypothesized that Drp1 regulates MMP through interaction(s) with its binding partners at a fission site.

precipitate with Drp1 or Myc-Drp1, but not in controls (Figures 2G and S3C). Furthermore, we also demonstrated that Drp1 K38A interacts with Zip1 in the Myc pull-down analysis, consistent with our hypothesis that MMP reduction is not dependent on GTPase activity (Figure 2I). The in situ protein interaction assay revealed that Drp1-Zip1 interactions occurred in the mitochondria (Figure 2H). The physical interaction between Drp1 and Zip1 was also confirmed by the presence of GFP signals that had assembled, as seen in bimolecular fluorescence complement (BiFC) assay (Figure S3G); the N terminus of Drp1 and Zip1 was shown to have fused with Z-Nsp and Z-Csp, with GFP fluorescence indicating the assembly between non-fluorescent BiFC tags, Z-Nsp, and Z-Csp (Blakeley et al., 2012). These GFP signals reflecting the physical interaction between Z-Nsp and Z-Csp also suggest that the N terminus of mitochondrial Zip1 faces the cytoplasm, where Drp1 proteins localize (Figure 3H). The topology of mitochondrial Zip1 was also verified by the fluorescence protein protection (FPP) assay; YFP-Zip1 signals were found to disappear gradually after treatment with protease K, and vesicular Zip1 signals were spared (Figures S4A–S4C). This topology cannot be achieved by membrane fusion, and we favor the idea that Zip1 is translated from free cytosolic ribosome and targeted to the mitochondria via the traditional HSP70/HSP90- and TOM70-dependent mechanism (Becker et al., 2012). Supporting this idea is the finding that treatment with 17-AAG, which can block HSP90-dependent mitochondrial outer membrane protein transport, suppresses mitochondrial Zip1 levels (Figure S4D).

Mitochondrial Zip1 Interacts with Drp1 at the Mitochondrial Outer Membrane To identify molecules responsible for Drp1-dependent loss of MMP, we employed a 1.3-K human protein chip binding assay (Jeong et al., 2012). Recombinant V5-Drp1 was purified from Escherichia coli and used for the protein chip assay. We identified 15 interacting proteins exhibiting a signal-to-noise ratio (SNR) above 1.0 (Figure S2A; Table S1). To screen candidate proteins that have activity to regulate MMP, we explored the mitochondrial morphology and MMP levels of cells expressing these proteins (Figures S2B and S2C). By using these assays, we chose the Zip1 protein, a Zn2+ transporter, as a suitable candidate. As Zn2+ is a divalent cation, mitochondrial zinc uptake can immediately depolarize the mitochondrial membrane by reducing the proton electrochemical gradient. In addition, Zn2+ binds to complex I and permanently inhibits MMP formation and mitochondrial function (Faxe´n et al., 2006; Sharpley and Hirst, 2006). Although Zip1 is known as a cell membrane or vesicular protein (Gaither and Eide, 2001; Milon et al., 2001), subcellular fractionation demonstrated that Zip1 was also localized in the mitochondria (Figures 2E and S3A). Immunofluorescent staining images obtained using Airyscan also showed the punctiform localization of Zip1 in the mitochondria (Figure 2F). Punctiform localization of Zip1 in the mitochondria was also confirmed by mCherry-Zip1 expression (Figures S3B and S3D), and these Zip1 puncta were found at the putative fission sites marked by the presence of Twinkle-GFP, Drp1, and Mff (Figures S3E and S3F). Next, we sought to verify the physical interaction between Drp1 and Zip1 in cells. Zip1 or YFP-Zip1 was found to

Domains Responsible for the Drp1 and Zip1 Interaction Next, we determined the binding sites of Drp1 and Zip1. Drp1 consists of an N-terminal GTPase domain, a middle domain (MD), and a GTPase effector domain (GED). Various deletion mutants of Drp1 lacking MD and/or GED domain fused with glutathione S-transferase (GST)-tag were generated and subsequently purified using GST columns (Figure 3A; van der Bliek, 1999). GST pull-down assays from cell lysates demonstrated that the GTPase domain of Drp1 (D3) was needed to pull down Zip1 (Figure 3B). In addition, results of Myc pull-down and Duolink analysis showed that D3 interacts with Zip1 in mitochondria (Figures 3C and 3D). Overexpression of D3 alone reduced MMP levels without affecting mitochondrial fragmentation, indicating that the GTPase domain is also required for MMP reduction (Figures 3E–3G). Based on the topology of Zip1, cytosolic regions of Zip1 should interact with Drp1 (Figure 3H). Therefore, cytosolic stretching of a 28-amino-acid hydrophilic sequence at the N terminus (Zip1 1–28) of Zip1 is the primary candidate region for the interaction with Drp1. Accordingly, overexpression of the Zip1 1–28 fragment was found to efficiently interfere with the interaction between Drp1 and Zip1 (Figure 3I), suggesting that the GTPase domain of Drp1 interacts with the N terminus cytosolic domain of Zip1 on mitochondria.

4 Molecular Cell 73, 1–13, January 17, 2019

The Drp1-Zip1 Interaction Regulates MMP via Control of Mitochondrial Zn2+ Next, we examined the molecular mechanism underlying Drp1dependent MMP regulation by Zip1. Similarly to overexpression

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 3. GTPase Domain of Drp1 Interacts with the N Terminus of Zip1 and Regulates MMP without Affecting Morphology (A) Schematic illustration of Drp1 and Drp1-deletion mutants. Drp1 consists of GTPase domain, middle domain (MD), and GTPase effector domain (GED). Each domain of the Drp1 WT construct was serially deleted, and the remaining parts were fused with GST-tag. (B) GST pull-down of Drp1 WT and Drp1-deletion mutants with Zip1. (C) Myc pull-down analysis to verify the interaction between Zip1 and the GTPase domain of Drp1. The input lane contained 5% of the total amount of cell lysate. (D) Duolink assay was used for the visualization of the interaction between the GTPase domain of Drp1 and Zip1. TOM20 antibody was used as a marker for mitochondria. (E) Representative images of MMP in WT or D3-Drp1-expressing cells. (F) Average TMRM intensity in each group of live cells. Data represent mean ± SEM (*p < 0.05; **p < 0.01; n = 25). (G) Quantification data of mitochondrial morphology in cells expressing the indicated proteins (n = 50). (H) Topological illustration of mitochondrial Zip1 based on results from Figures S3G and S4. (I) Based on the topology in (H), we generated a DNA construct expressing the N-terminal cytoplasmic domain of Zip1 (red, 28 amino acids; Zip1 1–28) and assessed whether the expression of Zip1 1–28 inhibited the interaction between Drp1 and Zip1 through immunoprecipitation. The input lane contained 10% of the total amount of cell lysate. See also Figure S4.

of Drp1, overexpression of Zip1 was found to reduce MMP levels (Figures 4A and 4B), although it had no effect on mitochondrial morphology (Figure 4D). Conversely, suppression of Zip1 expression by short hairpin RNA (shRNA) prevented Drp1induced reduction of MMP without affecting mitochondrial fission induced by Drp1 (Figures 4A, 4C, and 4E). In addition, Zip1 1–28 also prevented Drp1-induced MMP reduction (Figures 4A and 4C). Collectively, these findings indicate that Drp1 interacts with mitochondrial Zip1 to reduce MMP levels, although the fission-promoting activity of Drp1 is independent of Zip1.

As Zip1 localizes at the outer membrane of the mitochondria (OMM), we further explored whether IMM molecules mediate Zip1-mediated MMP reduction. Mitochondrial calcium uniporter (MCU) is located at the IMM and transports divalent ions, such as calcium and zinc, into the mitochondria (Malaiyandi et al., 2005; Medvedeva and Weiss, 2014). Interestingly, we found that the MCU forms a complex with Zip1 (Figures 4H and S5E) and that MCU blockade by the inhibitor RU360 or by knockdown completely abolished Drp1-induced MMP reduction (Figures 4F, 4G, S5B, S5D, and S5F). Although MCU is also associated

Molecular Cell 73, 1–13, January 17, 2019 5

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 4. Drp1-Dependent Reduction of MMP Is Mediated by Changes of Mitochondrial Zn2+ via the Drp1-Zip1 Interaction (A) Representative images of MMP in cells expressing the indicated constructs. (B and C) Average TMRM intensity in YFP-, YFP-Zip1-, and YFP-Drp1-expressing cells (B) and in YFP- and YFP-Drp1-expressing cells transfected with shCTL, shZip1, or Zip1 1-28 (C). Data represent mean ± SEM (**p < 0.01; n = 30). (D and E) Quantification data of mitochondrial morphology in YFP-, YFP-Zip1-, and YFP-Drop1-expressing cells (D) and in YFP- and YFP-Drp1-expressing cells transfected with shCTL, shZip1, or Zip1 1-28 overexpression (E). (n = 100). (F) Representative images of MMP in cells expressing the indicated constructs. (G) Average TMRM intensity in cells. Data represent mean ± SEM (**p < 0.01; n = 30). (H) Myc pull-down analysis to demonstrate the interaction between Drp1 and MCU. The input lane contained 5% of the total amount of cell lysate. (I) Time-lapse images of BFP-mito (green) and MMP in Zip1 1–28-expressing cells during mitochondrial fission. (J and K) Kymographs of MMP (red) and pseudo-colored mitochondrial [Zn2+] in the Zip1 1–28-treated (K) or non-treated (J) condition. Marks indicate the site where mitochondria were undergoing division. (legend continued on next page)

6 Molecular Cell 73, 1–13, January 17, 2019

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

with the non-specific cation channel voltage-dependent anion channel (VDAC), its inhibition by S18-NN-randomer (Stein and Colombini, 2008; Tan et al., 2007) failed to alter Drp1- or Zip1induced MMP reduction (Figures S5A and S5C). Taken together, these results suggest that Drp1-dependent Zn2+ entry into the intermembrane space (IMS) is specifically mediated by the coupling of Zip1 and MCU. Time-lapse imaging demonstrated that expression of Zip1 1–28 prevented the focal reduction of MMP during mitochondrial fission (Figure 4I), confirming that the interaction between Zip1 and Drp1 is responsible for the transient and focal reduction of MMP. As we hypothesized that Drp1 can induce an increase in mitochondrial Zn2+ via Zip1 activation, mitochondrial Zn2+ was directly measured by Mito-ZapCY1, a fluorescence resonance energy transfer (FRET)-based imaging sensor (Park et al., 2012). As expected, FRET signals focally increased with MMP reduction at fission sites, and the changes of FRET and TMRM signals were blocked by Zip1 1–28 treatment (Figures 4J and 4K). Quantitative analysis showed a strong negative correlation between mitochondrial Zn2+ increase and MMP reduction at fission sites (Figure 4L). However, the overall correlation between TMRM and Zn signals was relatively weak, and Zip1 1–28 did not alter this relationship, indicating that zinc and MMP changes in non-fission areas are not controlled by the interaction between Drp1 and Zip1 (Figure S5I). Moreover, a Drp1-induced mitochondrial Zn2+ increase was inhibited by shZip1 (Figures S5G and S5H), and chelation of Zn2+ by treatment with N,N,N’,N’-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) efficiently blocked MMP reduction in Drp1- or Zip1expressing cells (Figures S5J and S5K). We verified that Drp1 and Zip1 1–28 did not alter cytosolic Zn2+ levels and Zn2+dependent downstream gene expression (Chu et al., 2015) or subcellular localization of Zip1 (Figures S6A–S6K), ruling out the possibility that Drp1 and Zip1 1–28 exert their action indirectly via cytosolic Zn modification. Taken together, these data indicate that Drp1 can regulate MMP through modulation of mitochondrial Zn2+ via an interaction with Zip1 and the MCU. Drp1-Zip1 Interaction Is Important for HyperglycemiaInduced Mitophagy It has been reported that Drp1-dependent mitochondrial fragmentation occurs at an early stage in mitophagy (Chang and Blackstone, 2010). Furthermore, Drp1-dependent mitochondrial fission and MMP reduction are required for mitophagy (Lo et al., 2010), raising the possibility that the Drp1-Zip1 interaction can regulate mitophagy. As previously published (Huang et al., 2003), hyperglycemic conditions progressively reduced MMP levels and mitochondrial content. On the other hand, expression of Zip1 1–28 blunted hyperglycemia-induced mitophagy (Figure 5A). Also, another mitophagy sensor, Cox8-EGFP-mCherry, revealed that addition of the Zip1 1–28 peptide prevented mitophagy under hyperglycemic conditions (Figure 5B). As parkin recruitment is critical for activation of the PINK1/parkin pathway,

we also monitored GFP-parkin puncta under hyperglycemic conditions. As expected, GFP-parkin was recruited to mitochondria under hyperglycemic conditions, but it was partially blocked in Zip1-1–28-treated cells (Figures 5C and 5D). Similarly, the number of Dsred-LC3 puncta was significantly increased in the hyperglycemic condition and reduced dramatically in Zip11–28-expressing cells (Figures 5E and 5F). Importantly, hyperglycemia also induced MMP reduction, and Zip1 1–28 substantially attenuated loss of MMP (Figure 5G). Indeed, chelation of Zn2+ by TPEN completely blocked reduction of MMP (Figure 5H). Taken together, these results suggest that the increase in mitochondrial Zn2+ mediated by the Drp1-Zip1 interaction is important for hyperglycemia-induced reduction of MMP and subsequent mitophagy. Inhibition of Drp1-Zip1 Interaction Prevents Accumulation of Short Mitochondria with Low MMP As we found that the interaction of Drp1 and Zip1 induces focal MMP reduction during normal mitochondrial division, we decided to further address the significance of the Drp1-Zip1 interaction under normal conditions. We found that a small population (approximately 10%; Figure 5D) of cells exhibited spontaneous formation of mitophagic parkin puncta. About 76.2% of these parkin-associated mitochondria completely lost their MMP, and the rest exhibited a normal MMP level, indicating that the majority of Parkin recruitment is associated with MMP loss, although there is also MMP-independent mitophagy (Figure 6A; Burman et al., 2017). On the other hand, most parkin-associated mitochondria exhibited a noticeable MMP level in cells expressing Zip1 1–28 (Figure 6A). Quantification of parkin+ mitophagic puncta suggests that the number of puncta was reduced in the Zip1 1–28 group, owing to the selective elimination of MMP-dependent parkin puncta, indicating that the interaction between Zip1 and Drp1 is required for MMPdependent mitophagy (Figure 6B). It was recently found that Arih1 can also mediate mitophagy via interaction with Pink1, independently of Parkin (Villa et al., 2017). Considering that mitochondrial depolarization by the interaction of Drp1 with Zip1 is required for Pink1 stabilization at the MOM, we speculate that Arih1-dependent mitophagy is also dependent on the Drp1-Zip1 interaction. Accordingly, a subset of punctiform Arih1 signals were colocalized with LC3, and their numbers were reduced after Zip1 1–28 treatment (Figures 6C and S7A), suggesting that Drp1-Zip1-dependent MMP reduction plays a role in depolarization-induced parkin- or Arih1-dependent mitophagy. Correlational analysis of MMP level and mitochondria length further revealed that short mitochondria (<5 mm) tended to show lower MMP levels and that these short mitochondria with low MMP were associated with parkin, indicating that they would eventually be eliminated by parkin-dependent mitophagy (Figure 6D). On the other hand, Zip1 1–28 prevented MMP loss in these short mitochondrial populations (Figure 6D),

(L) Quantification data of cross-correlation analysis between TMRM and FRET signals at the future fission site. Cross-correlation values indicate that the closer the value is to +1, the more the TMRM and FRET signals change in the same direction, and the closer the value is to 1, the more the signals change in the opposite direction (***p < 0.001; n = 7). See also Figures S5 and S6.

Molecular Cell 73, 1–13, January 17, 2019 7

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 5. Perturbation of the Interaction between Drp1 and Zip1 Inhibits Mitophagy by Preventing Recruitment of Mitochondrial Parkin under Hyperglycemic Conditions (A) Immunoblotting analysis to confirm the contribution of the interaction between Drp1 and Zip1 to mitophagy under hyperglycemic conditions. VDAC and actin were used as markers for mitochondrial content and loading control, respectively. (B) Representative images of Cox8-EGFP-mCherry-expressing cell to examine mitophagy under hyperglycemic conditions. Red puncta were observed under hyperglycemic conditions (HG, ), indicating the presence of mitochondria in the lysosome. (C) Representative images of GFP-parkin under hyperglycemic conditions. DsRed-mito construct was used to show mitochondria. (D) Percentage of cells that exhibit parkin puncta colocalizing with the mitochondrial marker DsRed-mito. Data represent mean ± SEM (***p < 0.001; n = 150). (E) Cells were transfected with DsRed-LC3 to express a mitophagy marker, as LC3 accumulation in mitochondria indicates that the damaged mitochondria are going to be selectively removed by mitophagy. Mitochondria were labeled with specific antibody raised against cytochrome c. (F) Average number of LC3 puncta on mitochondrial marker DsRed-mito. Data represent mean ± SEM (*p < 0.5; n = 50). (G) Quantification data of average TMRM intensity in live cells. Data represent mean ± SEM (*p < 0.5; n = 18). (H) To examine whether reduction of MMP was mediated by Zn2+ under HG conditions, we treated cells with TPEN, a Zn2+ chelator, and then measured the TMRM intensity (n = 18).

thereby selectively eliminating parkin-dependent mitophagy. We wondered whether focal MMP loss promotes the generation of mitochondria that are susceptible to mitophagy, and so we extended our time-lapse imaging after fission to monitor the restoration of MMP level. After fission, all long (>5 mm) mitochondria had restored MMP to the initial level within 3 s (Figures 6H and 6I). Interestingly, however, a subset (13.8%) of short mitochondria (<5 mm) failed to restore MMP but rather progressively lost MMP (Figures 6E–6G). We assumed that these short mitochondrial populations that failed to restore MMP were ‘‘damaged’’ mitochondria that should be removed by mitophagy. Thus, long-term inhibition of the interaction between Drp1 and Zip1 should cause long-term accumulation of dysfunctional mitochondria. This assumption was supported by the observation that expression of Zip1 1–28 for 2 days led to a significant increase in MitoSOX, an indicator of ROS production and mitochondrial dysfunction (Figure 7A; Mukhopadhyay et al., 2007; Nishikawa et al., 2000). Furthermore, the ADP:ATP ratio was increased in Zip1-1–28expressing cells, indicating the inefficient production of ATP (Figure 7B). Thus, in primary cortical neurons that use primarily mitochondrial energy metabolism, prolonged expression of Zip1 1–28 was shown to retard neurite growth in vitro (Figures 7C and 7D).

8 Molecular Cell 73, 1–13, January 17, 2019

DISCUSSION In this study, we identified a transient and focal reduction of MMP prior to mitochondrial fission, which is mediated by an interaction between Drp1 and Zip1. We propose that this event is a part of a routine surveillance mechanism for maintaining mitochondrial quality. To maintain high quality and integrity, mitochondria constantly undergo changes to their morphology via fusion and fission. Following the recruitment of Drp1, Drp1 interacts with Zip1-MCU complex, which promotes the Zn2+ passing into the mitochondrial matrix and subsequently leading to the focal MMP reduction. Upon fission by Drp1, the fate of fragmented mitochondria is determined by their capability to restore MMP levels; healthy mitochondria can restore MMP levels and thus remain in the mitochondrial pool for fusion, whereas mitochondria that fail to do so are marked and eliminated by mitophagy (Figure 7E). Several reports have proposed that mitochondrial length is closely associated with mitochondrial function. For instance, induction of Drp1 activation often causes MMP reduction as well as mitochondrial fission, and conversely, MMP reduction activates Drp1-dependent mitochondrial fission (Cereghetti et al., 2008; Sarin et al., 2013; Taguchi et al., 2007; Wang et al., 2012). Likewise, promotion of mitochondrial fusion increases

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 6. The Interaction of Drp1 and Zip1 Is Essential for Maintaining Mitochondrial Integrity via Surveillance of Mitochondrial Quality (A) Representative images of association between fragmented mitochondria with normal or low MMP level and parkin under Zip1 1–28 treatment conditions. Arrowheads indicate parkin-associated mitochondria with normal MMP levels, and arrows indicate parkin-associated mitochondria with low MMP levels. Although parkin puncta (green) were colocalized with short mitochondria with normal (1) or low (2) MMP level without Zip1 1–28 (top), only short mitochondria with low MMP level (3) were found in Zip1 1–28-treated condition (bottom). (B) Quantification of total parkin puncta in Zip1-1–28-treated cells. Data represent mean ± SEM (*p < 0.5; n = 20). (C) Quantification of total Arih1 puncta in Zip1-1–28-treated cells. Data represent mean ± SEM (*p < 0.5; n = 18). (D) TMRM intensity of individual mitochondria was plotted against mitochondrial length to examine the correlation. (E and F) Time-lapse images of BFP-mito (green) and MMP. MMP levels were not restored in some fragmented mitochondria after fission (F), although they were restored rapidly in other fragmented mitochondria (E). (G) TMRM intensity of mitochondria after mitochondrial fission. Bold line indicates mean value of MMP. (H) Time-lapse images of BFP-mito (green) and MMP. MMP restored in long mitochondria (>5 mm) after fission. (I) TMRM intensity of mitochondria after mitochondrial fission (n = 10). Bold line indicates mean value of MMP. Bold line indicates mean value of MMP. See also Figure S7.

Molecular Cell 73, 1–13, January 17, 2019 9

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Figure 7. Long-Term Disruption of Drp1-Zip1 Interaction Weakens Mitochondrial Quality (A) Average intensity of MitoSOX in cells expressing GFP and Zip1 1–28. Data represent mean ± SEM (*p < 0.5; n = 33). (B) ADP:ATP ratio in cells expressing GFP and Zip1 1–28. Data represent mean ± SEM (*p < 0.5; n = 4). (C) Primary cortical neurons were isolated from rat embryo cortex, and the indicated GFP constructs were transfected into cells by electroporation before plating. Representative images of primary cortical neurons expressing GFP and Zip1 1–28 at 7 days in vitro are shown. (D) Quantification of total neurite length in primary cortical neurons expressing GFP and Zip1 1–28. Data represent mean ± SEM (n = 28). (E) Proposed model of Drp1-dependent MMP reduction providing selective pressure in the mitochondrial network for routine mitochondrial quality surveillance.

MMP levels, and enhanced MMP levels often promote mitochondrial fusion, suggesting that morphological changes to mitochondria and regulation of MMP are closely coupled (Pich et al., 2005; Tondera et al., 2009). However, the molecular mechanisms underlying how mitochondrial function and structure are linked are poorly understood.

10 Molecular Cell 73, 1–13, January 17, 2019

Here, we clearly demonstrated that MMP reduction and mitochondrial fission are separately controlled by Drp1, with two independent mechanisms involving the interaction of Drp1 with different proteins: self-organization for mitochondrial fission and an interaction with Zip1 for MMP loss. Although Zip1 has been known to be localized on the cell membrane and intracellular vesicles, we found that Zip1 also localizes at the mitochondrial membrane with a topology that promotes influx of Zn2+ into the mitochondria. We found that mitochondrial Zip1 can interact with Drp1 at the cytosol through its N terminus, although the N terminus of vesicular Zip1 resides in the lumen of the vesicles, allowing for the selective interaction of Drp1 with Zip1 on the mitochondria. It appears that Zip1 cannot recruit Drp1 on mitochondria, necessitating the mitochondrial translocation of Drp1 via other mechanisms. Thus, Drp1 A395D, which fails to translocate into the mitochondria, did not exhibit activity for Zip1 interaction and MMP reduction (Figure 2). Therefore, Drp1 needs to be recruited to interact with Zip1 and subsequently reduce MMP level. Once transported to the intermembrane spaces by Zip1, Zn2+ appear to be further transported to the mitochondrial matrix by the coupled mitochondrial cation uniporter, MCU (Figures 4H and S5E). Thus, the prevention of MCU completely abolished the Drp1-induced MMP reduction (Figures 4F, 4G, S5B, and S5D). It is not rare that mitochondrial outer and inner membrane proteins are coupled for the transportation of biomolecules. For example, VDAC and adenine nucleotide translocase (ANT) complex serves for the mitochondrial metabolite transport (Brdiczka et al., 1998). Yet it is unclear how interaction of Drp1 with Zip1 regulates the activity of Zip1-MCU complex, and further study is required. Mitochondrial Zn2+ regulates mitochondrial function. For example, accumulation of Zn2+ into the mitochondria induces MMP loss, mitochondrial dysfunction, and cell death in neuronal ischemia (Faxe´n et al., 2006; Jiang et al., 2001). Similarly, increased mitochondrial Zn2+ promotes PINK/parkin-mediated mitophagy to prevent accumulation of dysfunctional mitochondria under hypoxia-reoxygenation conditions (Bian et al., 2018). The interaction between Drp1 and Zip1 promotes the influx of Zn2+ into the mitochondria (Figures 4J–4L), with an increase in mitochondrial Zn2+ being responsible for MMP reduction. Supporting this, mitochondrial Zn2+ was increased in Drp1-overexpressing cells, and chelation of Zn2+ efficiently suppressed MMP reduction (Figures S5G, S5H, S5J, and S5K). Mitochondrial Zn2+ may play two roles in the regulation of MMP. As Zn2+ is a cation, its entry into mitochondria induces reversible depolarization (Devinney et al., 2009). In addition, prolonged exposure of mitochondria to Zn2+ inhibits the activity of the electron transfer chain system via interaction with complex I, which is an irreversible process (Faxe´n et al., 2006; Sharpley and Hirst, 2006). Collectively, these findings suggest that the consequence of (1) Drp1 recruitment to mitochondria, (2) Drp1Zip1 interaction on mitochondria, (3) activation of Zip1, and (4) an increase in mitochondrial Zn2+ causes MMP reduction. Interestingly, the correlation of TMRM and the Zn2+ level was relatively weak in the non-fission sites, and Zip1 1–28 did not alter this relationship, indicating that the changes of Zn2+ and MMP in the non-fission area are mostly not controlled by the Drp1Zip1 interaction (Figures 4L and S5I). There are several studies

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

reporting dynamic changes of MMP named ‘‘mitoflash’’ (Wang et al., 2008). Mitoflash is regulated by many factors, including transient alkalization of the mitochondrial inner membrane, bursting of reactive oxygen species and reversible oxidation of NADH and FADH2 (Wang et al., 2008, 2016). In addition, inhibition of ATP synthase or treatment with adenine nucleotide also reduces transient MMP fluctuation (Buckman and Reynolds, 2001; Vergun and Reynolds, 2004). Thus, these are the candidates contributing to the MMP changes independent of the Zn2+ level in non-fission areas. Our current observations propose that recruitment of Drp1 to the mitochondrial surface activates Zip1 to induce MMP reduction. Conversely, other studies have proposed that mitochondrial depolarization is required to recruit Drp1 for inducing subsequent mitochondrial fission (Toyama et al., 2016). For example, carbonyl cyanide m-chlorophenylhydrazone (CCCP), a mitochondrial uncoupler, instantly induces overall mitochondrial depolarization, which causes activation of mitochondrial fission by recruitment of Drp1, resulting in mitophagy throughout the cell (Geisler et al., 2010). It has been reported that mitochondrial depolarization raises cytosolic Ca2+ levels to promote calcineurin activity on mitochondria, thereby inducing dephosphorylation of Drp1 S637 and inducing Drp1 fission activity (Cereghetti et al., 2008). However, such a strong stimulus often directly damages mitochondria and causes MMP reduction, which can trigger both Drp1-dependent and -independent modes of fission. Thus, these experimental conditions represent the catastrophic situation that develops postmitophagic stimulation, and they do not represent mitophagy under normal conditions. The model that we propose in this study is particularly useful for explaining how spontaneously generated ‘‘bad sectors’’ in the mitochondrial network are selectively eliminated to maintain cell homeostasis. Mitochondria that are interconnected have electrochemical gradients that are rapidly balanced by the diffusion of ions, and PINK/parkin or PINK/Arih1 systems cannot easily identify dysfunctional organelles. However, during the routine fission of mitochondria mediated by Drp1, transient lowering of MMP may serve as a negative selection pressure; mitochondria that efficiently restore MMP levels would survive and stay in the mitochondrial pool, exhibiting spontaneous fission-fusion cycle, but mitochondria that fail to do so could be negatively selected for mitophagy. Lowering of MMP levels at the fission spots differentially affects the fate of resultant mitochondria after fission, as damaged short mitochondria fail to restore MMP to the initial level and thus undergo mitophagy. In addition, reciprocal interaction between Drp1 activity and MMP level can form a positive feedback loop: depolarization can trigger Drp1 recruitment, and recruited Drp1 can trigger further depolarization, which might be useful for segregating dysfunctional mitochondrial regions from the entire mitochondrial network for selective mitophagic removal. Negative selection pressure is a widely used strategy found in many biological processes, including evolution and synaptic pruning (Frade and Barde, 1999), and we propose that such mitochondrial morphological dynamics regulated by Drp1 contributes to cell homeostasis and quality control in mitochondria.

STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell lines, cell culture, and primary culture B Bacterial Strains METHOD DETAILS B Site-directed mutagenesis and PCR B Quantitative RT- PCR B Transfection B Cell staining and Live imaging B Image analysis of MMP reduction during the mitochondria fission B Protein microarray B Immunocytochemistry and measurement of mitochondrial morphology B Western blot B Immunoprecipitation B Mitochondrial fractionation B Proximity ligation assay B BiFC assay B Fluorescence protease protection assay (FPP assay) B Protein purification 2+ B Analysis of mitochondrial Zn using FRET imaging B Measurement of cellular ADP:ATP ratio QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures and one table and can be found with this article online at https://doi.org/10.1016/j.molcel.2018.11.009. ACKNOWLEDGMENTS This research was supported by the Brain Research Program through the National Research Foundation (NRF) funded by the Korean Ministry of Science, ICT & Future Planning (NRF-2012M3A9C6049933, NRF-2015M3C7A1028790, NRF-2017M3A9B3061308, and NRF-2018R1A2A3075271). AUTHOR CONTRIBUTIONS H.M.C. designed and performed the experiments, analyzed the data, and wrote the manuscript. J.R.R. interpreted the data and wrote the manuscript. Y.J. contributed to mutating the Drp1 constructs. T.W.S. and Y.N.C. performed the GST pull-down experiments. J.M.C. performed the protein chip binding assay. J.H.K. analyzed data. J.R.R., B.C., H.K., S.J.Y., H.C.K., and S.-W.Y. contributed to interpreting the experimental data and editing the manuscript. W.S. supervised H.M.C., designed the experiments, and wrote the final version of the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. Received: February 21, 2018 Revised: September 11, 2018 Accepted: November 7, 2018 Published: December 20, 2018

Molecular Cell 73, 1–13, January 17, 2019 11

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

REFERENCES Ashrafi, G., and Schwarz, T.L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ. 20, 31–42. Becker, T., Bo¨ttinger, L., and Pfanner, N. (2012). Mitochondrial protein import: from transport pathways to an integrated network. Trends Biochem. Sci. 37, 85–91. Bian, X., Teng, T., Zhao, H., Qin, J., Qiao, Z., Sun, Y., Liun, Z., and Xu, Z. (2018). Zinc prevents mitochondrial superoxide generation by inducing mitophagy in the setting of hypoxia/reoxygenation in cardiac cells. Free Radic. Res. 52, 80–91. Blakeley, B.D., Chapman, A.M., and McNaughton, B.R. (2012). Split-superpositive GFP reassembly is a fast, efficient, and robust method for detecting protein-protein interactions in vivo. Mol. Biosyst. 8, 2036–2040. Boveris, A., Oshino, N., and Chance, B. (1972). The cellular production of hydrogen peroxide. Biochem. J. 128, 617–630. Bras, M., Yuste, V.J., Roue´, G., Barbier, S., Sancho, P., Virely, C., Rubio, M., Baudet, S., Esquerda, J.E., Merle-Be´ral, H., et al. (2007). Drp1 mediates caspase-independent type III cell death in normal and leukemic cells. Mol. Cell. Biol. 27, 7073–7088. €ck, A., Dolder, M., and Wallimann, T. (1998). The Brdiczka, D., Beutner, G., Ru molecular structure of mitochondrial contact sites. Their role in regulation of energy metabolism and permeability transition. Biofactors 8, 235–242. Buckman, J.F., and Reynolds, I.J. (2001). Spontaneous changes in mitochondrial membrane potential in cultured neurons. J. Neurosci. 21, 5054–5065. Burman, J.L., Pickles, S., Wang, C., Sekine, S., Vargas, J.N.S., Zhang, Z., Youle, A.M., Nezich, C.L., Wu, X., Hammer, J.A., and Youle, R.J. (2017). Mitochondrial fission facilitates the selective mitophagy of protein aggregates. J. Cell Biol. 216, 3231–3247. Cereghetti, G.M., Stangherlin, A., Martins de Brito, O., Chang, C.R., Blackstone, C., Bernardi, P., and Scorrano, L. (2008). Dephosphorylation by calcineurin regulates translocation of Drp1 to mitochondria. Proc. Natl. Acad. Sci. USA 105, 15803–15808. Chang, C.R., and Blackstone, C. (2010). Dynamic regulation of mitochondrial fission through modification of the dynamin-related protein Drp1. Ann. N Y Acad. Sci. 1201, 34–39. Chang, C.R., Manlandro, C.M., Arnoult, D., Stadler, J., Posey, A.E., Hill, R.B., and Blackstone, C. (2010). A lethal de novo mutation in the middle domain of the dynamin-related GTPase Drp1 impairs higher order assembly and mitochondrial division. J. Biol. Chem. 285, 32494–32503. Cho, B., Cho, H.M., Jo, Y., Kim, H.D., Song, M., Moon, C., Kim, H., Kim, K., Sesaki, H., Rhyu, I.J., et al. (2017). Constriction of the mitochondrial inner compartment is a priming event for mitochondrial division. Nat. Commun. 8, 15754. Chu, A., Foster, M., Ward, S., Zaman, K., Hancock, D., Petocz, P., and Samman, S. (2015). Zinc-induced upregulation of metallothionein (MT)-2A is predicted by gene expression of zinc transporters in healthy adults. Genes Nutr. 10, 44. Devinney, M.J., Malaiyandi, L.M., Vergun, O., DeFranco, D.B., Hastings, T.G., and Dineley, K.E. (2009). A comparison of Zn2+- and Ca2+-triggered depolarization of liver mitochondria reveals no evidence of Zn2+-induced permeability transition. Cell Calcium 45, 447–455. Faxe´n, K., Salomonsson, L., Adelroth, P., and Brzezinski, P. (2006). Inhibition of proton pumping by zinc ions during specific reaction steps in cytochrome c oxidase. Biochim. Biophys. Acta 1757, 388–394. Frade, J.M., and Barde, Y.A. (1999). Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord. Development 126, 683–690. Frank, S., Gaume, B., Bergmann-Leitner, E.S., Leitner, W.W., Robert, E.G., Catez, F., Smith, C.L., and Youle, R.J. (2001). The role of dynamin-related protein 1, a mediator of mitochondrial fission, in apoptosis. Dev. Cell 1, 515–525.

12 Molecular Cell 73, 1–13, January 17, 2019

Gaither, L.A., and Eide, D.J. (2001). The human ZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells. J. Biol. Chem. 276, 22258–22264. Geisler, S., Holmstro¨m, K.M., Skujat, D., Fiesel, F.C., Rothfuss, O.C., Kahle, P.J., and Springer, W. (2010). PINK1/parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nat. Cell Biol. 12, 119–131. Gomes, L.C., Di Benedetto, G., and Scorrano, L. (2011). During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol. 13, 589–598. Guillery, O., Malka, F., Frachon, P., Milea, D., Rojo, M., and Lombe`s, A. (2008). Modulation of mitochondrial morphology by bioenergetics defects in primary human fibroblasts. Neuromuscul. Disord. 18, 319–330. Hoppins, S., Lackner, L., and Nunnari, J. (2007). The machines that divide and fuse mitochondria. Annu. Rev. Biochem. 76, 751–780. Huang, T.J., Price, S.A., Chilton, L., Calcutt, N.A., Tomlinson, D.R., Verkhratsky, A., and Fernyhough, P. (2003). Insulin prevents depolarization of the mitochondrial inner membrane in sensory neurons of type 1 diabetic rats in the presence of sustained hyperglycemia. Diabetes 52, 2129–2136. Jeong, J.S., Jiang, L., Albino, E., Marrero, J., Rho, H.S., Hu, J., Hu, S., Vera, C., Bayron-Poueymiroy, D., Rivera-Pacheco, Z.A., et al. (2012). Rapid identification of monospecific monoclonal antibodies using a human proteome microarray. Mol. Cell. Proteomics 11, O111.016253. Ji, W.K., Hatch, A.L., Merrill, R.A., Strack, S., and Higgs, H.N. (2015). Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites. eLife 4, e11553. Jiang, D., Sullivan, P.G., Sensi, S.L., Steward, O., and Weiss, J.H. (2001). Zn(2+) induces permeability transition pore opening and release of proapoptotic peptides from neuronal mitochondria. J. Biol. Chem. 276, 47524–47529. Jin, S.M., Lazarou, M., Wang, C., Kane, L.A., Narendra, D.P., and Youle, R.J. (2010). Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J. Cell Biol. 191, 933–942. Lazarou, M., Sliter, D.A., Kane, L.A., Sarraf, S.A., Wang, C., Burman, J.L., Sideris, D.P., Fogel, A.I., and Youle, R.J. (2015). The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314. Legesse-Miller, A., Massol, R.H., and Kirchhausen, T. (2003). Constriction and Dnm1p recruitment are distinct processes in mitochondrial fission. Mol. Biol. Cell 14, 1953–1963. Lo, M.C., Lu, C.I., Chen, M.H., Chen, C.D., Lee, H.M., and Kao, S.H. (2010). Glycoxidative stress-induced mitophagy modulates mitochondrial fates. Ann. N Y Acad. Sci. 1201, 1–7. Malaiyandi, L.M., Vergun, O., Dineley, K.E., and Reynolds, I.J. (2005). Direct visualization of mitochondrial zinc accumulation reveals uniporter-dependent and -independent transport mechanisms. J. Neurochem. 93, 1242–1250. Medvedeva, Y.V., and Weiss, J.H. (2014). Intramitochondrial Zn2+ accumulation via the Ca2+ uniporter contributes to acute ischemic neurodegeneration. Neurobiol. Dis. 68, 137–144. Milon, B., Dhermy, D., Pountney, D., Bourgeois, M., and Beaumont, C. (2001). Differential subcellular localization of hZip1 in adherent and non-adherent cells. FEBS Lett. 507, 241–246. Mukhopadhyay, P., Rajesh, M., Yoshihiro, K., Hasko´, G., and Pacher, P. (2007). Simple quantitative detection of mitochondrial superoxide production in live cells. Biochem. Biophys. Res. Commun. 358, 203–208. Nakada, K., Inoue, K., Ono, T., Isobe, K., Ogura, A., Goto, Y.I., Nonaka, I., and Hayashi, J.I. (2001). Inter-mitochondrial complementation: mitochondria-specific system preventing mice from expression of disease phenotypes by mutant mtDNA. Nat. Med. 7, 934–940. Narendra, D.P., Jin, S.M., Tanaka, A., Suen, D.F., Gautier, C.A., Shen, J., Cookson, M.R., and Youle, R.J. (2010). PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 8, e1000298. Nishikawa, T., Edelstein, D., Du, X.L., Yamagishi, S., Matsumura, T., Kaneda, Y., Yorek, M.A., Beebe, D., Oates, P.J., Hammes, H.P., et al. (2000). Normalizing

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature 404, 787–790.

nuclear cells of individuals with high serum ceruloplasmin concentration. J. Nutr. Biochem 19, 269–274.

Nunnari, J., and Suomalainen, A. (2012). Mitochondria: in sickness and in health. Cell 148, 1145–1159.

Taguchi, N., Ishihara, N., Jofuku, A., Oka, T., and Mihara, K. (2007). Mitotic phosphorylation of dynamin-related GTPase Drp1 participates in mitochondrial fission. J. Biol. Chem. 282, 11521–11529.

Otera, H., Wang, C., Cleland, M.M., Setoguchi, K., Yokota, S., Youle, R.J., and Mihara, K. (2010). Mff is an essential factor for mitochondrial recruitment of Drp1 during mitochondrial fission in mammalian cells. J. Cell Biol. 191, 1141–1158. Park, J.G., Qin, Y., Galati, D.F., and Palmer, A.E. (2012). New sensors for quantitative measurement of mitochondrial Zn(2+). ACS Chem. Biol. 7, 1636–1640. Pich, S., Bach, D., Briones, P., Liesa, M., Camps, M., Testar, X., Palacı´n, M., and Zorzano, A. (2005). The Charcot-Marie-Tooth type 2A gene product, Mfn2, up-regulates fuel oxidation through expression of OXPHOS system. Hum. Mol. Genet. 14, 1405–1415. Pickrell, A.M., and Youle, R.J. (2015). The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease. Neuron 85, 257–273. Rambold, A.S., Kostelecky, B., Elia, N., and Lippincott-Schwartz, J. (2011). Tubular network formation protects mitochondria from autophagosomal degradation during nutrient starvation. Proc. Natl. Acad. Sci. USA 108, 10190–10195. Sarin, M., Wang, Y., Zhang, F., Rothermund, K., Zhang, Y., Lu, J., Sims-Lucas, S., Beer-Stolz, D., Van Houten, B.E., Vockley, J., et al. (2013). Alterations in cMyc phenotypes resulting from dynamin-related protein 1 (Drp1)-mediated mitochondrial fission. Cell Death Dis. 4, e670. Schieber, M., and Chandel, N.S. (2014). ROS function in redox signaling and oxidative stress. Curr. Biol. 24, R453–R462.

Takeshige, K., Baba, M., Tsuboi, S., Noda, T., and Ohsumi, Y. (1992). Autophagy in yeast demonstrated with proteinase-deficient mutants and conditions for its induction. J. Cell Biol. 119, 301–311. Tan, W., Lai, J.C., Miller, P., Stein, C.A., and Colombini, M. (2007). Phosphorothioate oligonucleotides reduce mitochondrial outer membrane permeability to ADP. Am. J. Physiol. Cell Physiol. 292, C1388–C1397. Tondera, D., Grandemange, S., Jourdain, A., Karbowski, M., Mattenberger, Y., Herzig, S., Da Cruz, S., Clerc, P., Raschke, I., Merkwirth, C., et al. (2009). SLP-2 is required for stress-induced mitochondrial hyperfusion. EMBO J. 28, 1589–1600. Toyama, E.Q., Herzig, S., Courchet, J., Lewis, T.L., Jr., Loso´n, O.C., Hellberg, K., Young, N.P., Chen, H., Polleux, F., Chan, D.C., and Shaw, R.J. (2016). Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science 351, 275–281. van der Bliek, A.M. (1999). Functional diversity in the dynamin family. Trends Cell Biol. 9, 96–102. Vergun, O., and Reynolds, I.J. (2004). Fluctuations in mitochondrial membrane potential in single isolated brain mitochondria: modulation by adenine nucleotides and Ca2+. Biophys. J. 87, 3585–3593.

Sharpley, M.S., and Hirst, J. (2006). The inhibition of mitochondrial complex I (NADH:ubiquinone oxidoreductase) by Zn2+. J. Biol. Chem. 281, 34803–34809.

Villa, E., Proı¨cs, E., Rubio-Patin˜o, C., Obba, S., Zunino, B., Bossowski, J.P., Rozier, R.M., Chiche, J., Mondrago´n, L., Riley, J.S., et al. (2017). Parkin-independent mitophagy controls chemotherapeutic response in cancer cells. Cell Rep. 20, 2846–2859.

Smirnova, E., Shurland, D.L., Ryazantsev, S.N., and van der Bliek, A.M. (1998). A human dynamin-related protein controls the distribution of mitochondria. J. Cell Biol. 143, 351–358.

Wang, W., Fang, H., Groom, L., Cheng, A., Zhang, W., Liu, J., Wang, X., Li, K., Han, P., Zheng, M., et al. (2008). Superoxide flashes in single mitochondria. Cell 134, 279–290.

Smirnova, E., Griparic, L., Shurland, D.L., and van der Bliek, A.M. (2001). Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol. Biol. Cell 12, 2245–2256.

Wang, Y., Nartiss, Y., Steipe, B., McQuibban, G.A., and Kim, P.K. (2012). ROSinduced mitochondrial depolarization initiates PARK2/PARKIN-dependent mitochondrial degradation by autophagy. Autophagy 8, 1462–1476.

So¨derberg, O., Leuchowius, K.J., Gullberg, M., Jarvius, M., Weibrecht, I., Larsson, L.G., and Landegren, U. (2008). Characterizing proteins and their interactions in cells and tissues using the in situ proximity ligation assay. Methods 45, 227–232.

Wang, W., Gong, G., Wang, X., Wei-LaPierre, L., Cheng, H., Dirksen, R., and Sheu, S.S. (2016). Mitochondrial Flash: Integrative Reactive Oxygen Species and pH Signals in Cell and Organelle Biology. Antioxid. Redox Signal. 25, 534–549.

Sorrentino, V., Menzies, K.J., and Auwerx, J. (2018). Repairing mitochondrial dysfunction in disease. Annu. Rev. Pharmacol. Toxicol. 58, 353–389. Stein, C.A., and Colombini, M. (2008). Specific VDAC inhibitors: phosphorothioate oligonucleotides. J. Bioenerg. Biomembr. 40, 157–162.

Wenger, J., Klinglmayr, E., Fro¨hlich, C., Eibl, C., Gimeno, A., Hessenberger, M., Puehringer, S., Daumke, O., and Goettig, P. (2013). Functional mapping of human dynamin-1-like GTPase domain based on X-ray structure analyses. PLoS ONE 8, e71835.

Suazo, M., Olivares, F., Mendez, M.A., Pulgar, R., Prohaska, J.R., Arredondo, M., Pizarro, F., Olivares, M., Araya, M., and Gonzalez, M. (2008). CCS and SOD1 mRNA are reduced after copper supplementation in peripheral mono-

Yu, W., Sun, Y., Guo, S., and Lu, B. (2011). The PINK1/parkin pathway regulates mitochondrial dynamics and function in mammalian hippocampal and dopaminergic neurons. Hum. Mol. Genet. 20, 3227–3240.

Molecular Cell 73, 1–13, January 17, 2019 13

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Cytochrome c monoclonal anti-mouse

BD bioscience

Cat# 556432; RRID:AB_396416

Dlp1 monoclonal anti-mouse

BD bioscience

Cat# 611112; RRID:AB_398423

Gaq/11 polyclonal anti-rabbit

Santacruz

Cat# sc-392; RRID:AB_2314612

GFP polyclonal anti-rabbit

Abcam

Cat# ab290; RRID:AB_303395

GST monoclonal anti-mouse

Sigma

Cat# G1160; RRID:AB_259845

MCU polyclonal anti-rabbit

Abcam

ab121499

MFF polyclonal anti-rabbit

Sigma

Cat# HPA010968; RRID:AB_1845714

MTCOI monoclonal anti-mouse

Abcam

Cat# ab14705; RRID:AB_2084810

Antibodies

mtHSP70 monoclonal anti-mouse

Thermo Scientific

Cat# MA3-028; RRID:AB_325474

c-Myc monoclonal anti-mouse

Santacruz

Cat# sc-40; RRID:AB_627268

TOM20 monoclonal anti-mouse

Santacruz

Cat# sc-17764; RRID:AB_628381

a-tubulin monoclonal anti-mouse

Santacruz

Cat# sc-8035; RRID:AB_628408

VDAC monoclonal anti-mouse

Abcam

Cat# ab14734; RRID:AB_443084

Zip1 polyclonal anti-goat

Santacruz

Cat# sc-103945; RRID:AB_2190521

Zip1 polyclonal anti-rabbit

Millipore

ABC849

Anti-c-myc Agarose

Thermo Scientific

20168

Anti-Goat IgG (H+L)

Jackson IR

Cat# 005-000-003; RRID:AB_2336985

Anti-mouse IgG (H+L)

Jackson IR

Cat# 015-000-003; RRID:AB_2337188

Donkey polyclonal anti-mouse HRP

Jackson IR

Cat# 715-035-151; RRID:AB_2340771

Donkey polyclonal anti-rabbit HRP

Jackson IR

Cat# 711-005-152; RRID:AB_2340585

Donkey polyclonal anti-mouse-Alexa488

Jackson IR

Cat# 715-545-150; RRID:AB_2340846

Donkey polyclonal anti-mouse-Cy3

Jackson IR

Cat# 715-165-150; RRID:AB_2340813

Donkey polyclonal anti-mouse-Cy5

Jackson IR

Cat# 715-175-150; RRID:AB_2340819

Donkey polyclonal anti-rabbit-Alexa488

Jackson IR

Cat# 711-545-152; RRID:AB_2313584

Donkey polyclonal anti-rabbit-Cy3

Jackson IR

Cat# 711-165-152; RRID:AB_2307443

Donkey polyclonal anti-rabbit-Cy5

Jackson IR

Cat# 711-175-152; RRID:AB_2340607

Donkey polyclonal anti-Goat-Alexa488

Jackson IR

Cat# 705-545-003; RRID:AB_2340428

Donkey polyclonal anti-Goat-Cy3

Jackson IR

Cat# 705-165-003; RRID:AB_2340411

RBC

RH617-J80

Bacterial and Virus Strains DH5a E.coli Chemicals, Peptides, and Recombinant Proteins 4% paraformaldehyde (PFA)

Biosesang

P2031

17-AAG

Sigma

A8476

Agarose

Affymetrix

32802

Ampicillin

Affymetrix

AAj1125906

B27

GIBCO

17504-044

beta-mercaptoethanol

Sigma

M6250

Bromophenol Blue (BPB)

Sigma

B8026

Bovine serum albumin (BSA)

Millipore

82-100-6

CHAPS

Sigma

10810118001

cOmplete EDTA-free Protease inhibitor cocktail

Roche

11836170001

DEPC-treated DW

Biosesang

HW2004

D-glucose

Sigma

G6152 (Continued on next page)

e1 Molecular Cell 73, 1–13.e1–e8, January 17, 2019

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Digitonin

Sigma

D141

High glucose DMEM

Welgene

LM001-05

Low glucose DMEM

Welgene

LM001-15

DSP

Thermo Scientific

22586

DTT

Sigma

43815

ECL

Thermo Scientific

32106

EDTA

Biosesang

E2002

EGTA

Biosesang

E2024

FBS

GIBCO

16000-044

FluZin-3 AM

Thermo Scientific

F24195

GlutaMax

Thermo Scientific

35050061

Glycerol

Biosesang

G1018

GST-bead

GE Healthcare

17-0756-01

HBSS

Thermo Scientific

14175095

HEPES

Biosesang

H2003

Hoechst 33342

Invitrogen

H3570

IgG-free BSA

Jackson IR

001-000-162

IPTG

Biosesang

I2001

Kanamycin

Affymetrix

25389-94-0

KOD Hot start polymerase

Millipore

71086

LB agar

Affymetrix

75851

LB broth

Affymetrix

75852

Magnesium chloride

Sigma

1374248

MEM

Thermo Scientific

11090081

MitoSox

Invitrogen

M36008

M-MLV reverse transcriptase

Promega

M170B

Neurobasal

Thermo Scientific

21103049

Opti-MEM

Thermo Scientific

31985088

PBS

Biosesang

P2007-1

PEI

Polyscience

23966

PhosSTOP

Roche

04906837001

Poly-D-lysine

Sigma

P6407

Potassium acetate

Sigma

P1190

Potassium chloride

Sigma

P9541

Potassium phosphate monobasic

Sigma

P9791

Proteinase K

Thermo Scientific

EO-491

Penicillin/streptomycin

Thermo Scientific

10378016

Pyruvate

Thermo Scientific

11360070

Recombinant Rnasin Ribonuclease inhibitor

Promega

N2111

SDS

Affymetrix

75819

Sodium chloride

Sigma

S7653

Sodium deoxycholate

Sigma

D6750

Sodium phosphate dibasic

Sigma

S5136

Taq DNA polymerase

Bioneer

E-3100

TBS

Biosesang

T2005

Trypsin EDTA

Thermo Scientific

25200-056

TMRM

Thermo Scientific

T668 (Continued on next page)

Molecular Cell 73, 1–13.e1–e8, January 17, 2019 e2

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

TPEN

Sigma

P4413

Tris

Sigma

T1503

Triton X-100

Affymetrix

22686

TRIZOL

Invitrogen

15596018

Zinc chloride

Sigma

39059

Zinc pyrithione

Sigma

H6377

Peptide (Zip1 1-28): MGPWGEPELLVWRPEAVASEPPVPVGLE

This paper

N/A

Critical Commercial Assays ATP/ADP

Sigma

MAK135

BCA

Thermo Scientific

23227

Duolink

Sigma

DUO92007

This paper, Mendeley Data

https://doi.org/10.17632/ nkdznpkc68.1

Deposited Data Original Data Experimental Models: Cell Lines HeLa

ATCC

HEK293

ATCC

Experimental Models: Organisms/Strains Sprague Dawley rat (for in vitro experiment)

Orient bio

Oligonucleotides shRNA targeting sequence: Drp1 GAGAACTATGTAATACTGAGA

This paper

N/A

shRNA targeting sequence: MCU GCAAGGAGTTTCTTTCTCTTT

This paper

N/A

shRNA targeting sequence: Zip1 AAGGCTCAGCTTCCCGCCA

This paper

N/A

shRNA Non-targeting sequence

This paper

N/A

Site-direct mutagenesis: Drp1 A395D F:ACACTATTGACATTTTGACTGAC ATTAGAAATGCTACTGGTCC. R:GGACCAGTAGCATTTCTAATGTCAGTC AAAATGTCAATAGTG

This paper

N/A

Site-direct mutagenesis: Drp1 Q34A F:CAAATCGTCGTAGTGGGAACGG CGAGCAGCGGAAAGAGCTCAG R:CTGAGCTCTTTCCGCTGCTCGCCG TTCCCACTACGACGATTTG

This paper

N/A

Site-direct mutagenesis: Drp1 S39A F:CAGAGCAGCGGAAAGGCCTCAG TGCTAGAAAG R:CTTTCTAGCACTGAGGCCTTTCCGCTGCTCTG

This paper

N/A

Site-direct mutagenesis: Drp1 D146A F:CAATTTGACACTTGTGGCTTTG CCAGGAATGACC R:GGTCATTCCTGGCAAAGCCACAAGTGTCAAATTG

This paper

N/A

Site-direct mutagenesis: Drp1 G149A F:GTGGATTTGCCAGCAATGACC AAGGTGC R:GCACCTTGGTCATTGCTGGCAAATCCAC

This paper

N/A

Site-direct mutagenesis: Drp1 K216A F:CCTAGCTGTAATCACTGCACTTG ATCTCATGGATG R:CATCCATGAGATCAAGTGCAGTGATTACAGCTAGG

This paper

N/A

Site-direct mutagenesis: Drp1 D218A F:GTAATCACTAAACTTGCTCTCAT GGATGCGGG R:CCCGCATCCATGAGAGCAAGTTTAGTGATTAC

This paper

N/A

Site-direct mutagenesis: Drp1 S35A F:GTGGGAACGCAGGCCAGCGG AAAGAG R:CTCTTTCCGCTGGCCTGCGTTCCCAC

This paper

N/A

Site-direct mutagenesis: Drp1 E81A F:GGAAAACAACAGGAGCAGAAAAT GGGGTGG R:CCACCCCATTTTCTGCTCCTGTTGTTTTCC

This paper

N/A

Sequencing primer1 F:ATGGAGGCGCTAATTCCTGT

This paper

N/A

Sequencing primer2 F:GAACAAAGTATCTTGCTAGG

This paper

N/A

Sequencing primer3 F:CCAGAGAATTACCTTCAGCT

This paper

N/A

RT-PCR: MT2A F:CCGACTCTAGCCGCCTCTT R:GTGGAAGTCGCGTT CTTTACA

Suazo et al., 2008

N/A (Continued on next page)

e3 Molecular Cell 73, 1–13.e1–e8, January 17, 2019

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

RT-PCR:GAPDH F:GGATTTGGTCGTATTGGG R:GGAAGATGGTGAT GGGATT

This paper

N/A

S-18-NN randomer

TriLink

O-30030

S-18-NN randomer control

TriLink

O-30040

BFP-Mito

Addgene

#49151

DsRed-LC3

This paper

N/A

DsRed-mito

Clontech

N/A

GFP-C10orf81

Ho Chul Kang lab

N/A

GFP-FNDC8

Ho Chul Kang lab

N/A

GFP-GSTA4

Ho Chul Kang lab

N/A

GFP-Mfn2

This paper

N/A

GFP-mito

Clontech

632432

GFP-N1

Clontech

6085-1

GFP-OR2T35

Ho Chul Kang lab

N/A

GFP-Parkin

Addgene

#45875

GFP-Zip1

Ho Chul Kang lab

N/A

GFP-Zip1 1-28

This paper

N/A

mCherry-C1

Clontech

632524

mCherry-Drp1

This paper

N/A

mCherry-Zip1

This paper

N/A

Mito-ZapCY1

Addgene

#58996

pCox8-EGFP-mCherry

Addgene

#78520

pCS2+MT (Myc)

Promega

N/A

pCS2+MT-Zip1 (Myc-Zip1)

This paper

N/A

pGEX-Drp1

Soon Ji Yoo lab

N/A

pGEX-Drp1 D1

Soon Ji Yoo lab

N/A

pGEX-Drp1 D2

Soon Ji Yoo lab

N/A

pGEX-Drp1 D3

Soon Ji Yoo lab

N/A

pGEX-Drp1 D4

Soon Ji Yoo lab

N/A

pGEX-Drp1 D5

Soon Ji Yoo lab

N/A

pGEX-Drp1 D6

Soon Ji Yoo lab

N/A

pET11a-Z-NspGFP

Addgene

#40729

pMRBad-Z-CspGFP

Addgene

#40730

TOM20-GFP

This paper

N/A

Twinkle-GFP

Johannes N. Spelbrink lab

N/A

YFP-C1

Clontech

N/A

YFP-Arih1

This paper

N/A

YFP-Drp1

This paper

N/A

YFP-Drp1 A395D

This paper

N/A

YFP-Drp1 D190A

This paper

N/A

YFP-Drp1 D3

This paper

N/A

Recombinant DNA

YFP-Drp1 E81A

This paper

N/A

YFP-Drp1 K38A

Frank et al., 2001

N/A

YFP-Drp1 Q34A

This paper

N/A

YFP-Drp1 S35A

This paper

N/A

YFP-Drp1 S39A

This paper

N/A (Continued on next page)

Molecular Cell 73, 1–13.e1–e8, January 17, 2019 e4

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

YFP-Zip1

This paper

N/A

Z-CspGFP-Drp1

This paper

N/A

Z-NspGFP-Zip1

This paper

N/A

Amira

FEI

N/A

Prism 7

GraphPad Software

N/A

ImageJ

National Institutes of Health

https://imagej.nih.gov/ij/

MATLAB

MathWorks

N/A

Software and Algorithms

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and request may be directed to an will be fulfilled by the Lead Contact, Woong Sun ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell lines, cell culture, and primary culture HeLa cells were maintained in 5% CO2 at 37 C with high-glucose DMEM (25 mM, Welgene) supplemented with 10% fetal bovine serum (FBS, GIBCO) and 1% penicillin/streptomycin (PS, USA, GIBCO). HeLa cells were passaged at 80% confluency, and split at a ratio of 1:10 in fresh media. For the experiment involving induction of mitophagy under hyperglycemic conditions, HeLa cells were maintained for 2 weeks in low-glucose DMEM (5 mM, Welgene) supplemented with 10% FBS and 1% PS to adapt to the low-glucose condition. For primary culture of rat cortical neurons, the cortical region was dissected from Sprague-Dawley rat embryos on embryonic day 16 (E16) (Orient bio) in prechilled dissection buffer consisting of Hank’s Buffered Salt Solution (GIBCO), 20 mM HEPES (GIBCO), 0.1% D-glucose. It was then trypsinized and dissociated into single neurons. This experiment was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Korea University Institutional Animal Care and Use Committee. The protocol was approved by the Committee on the Ethics of Animal Experiments of the Korea University (Permit Number: KUIACUC20110304-2). The cortical neurons were plated onto plates coated with poly-D-lysine (Sigma), and maintained in 5% CO2 at 37 C with MEM (GIBCO) supplemented with 10% FBS (GIBCO), 0.45% D-glucose (Sigma), 1 mM pyruvate (GIBCO), 200 mM GlutaMax (Invitrogen), and 1% PS (USA, GIBCO). After 4 h, the medium was changed to neurobasal medium (GIBCO) supplemented with 2% B27 (GIBCO), 200 mM GlutaMax (Invitrogen), and 1% PS (GIBCO). Bacterial Strains Competent DH5a E. coli was used for transformations. METHOD DETAILS Site-directed mutagenesis and PCR To generate a point mutation in the Drp1 sequence, the pEYFP-Drp1 plasmid was subjected to PCR using mutagenic primers (sequences listed in Key Resources Table). The PCR product was amplified by Pfu polymerase and digested with DpnI to cut the methylated plasmid, which was then used to transform DH5a E. coli cells. Transformed cells were plated onto LB agar plates containing 30 mg/mL kanamycin for selection. Single colonies were inoculated in LB broth for overnight culture, and plasmid DNA was extracted by using the mini-prep kit. Sequencing primers were used to confirm mutations (sequencing primers listed in Key Resources Table) Quantitative RT- PCR Cells were lysed by using TRIZOL reagent according to the manufacturer’s instructions. Chloroform solution was added to the cell lysate, and the mixture was incubated at RT for 3 min. The mixture was then centrifuged at 12,000x g for 15 min at 4 C. After centrifugation, the colorless aqueous phase containing RNA was transferred to a fresh tube. Isopropanol was added to precipitate the RNA from the mixture for 10 min at RT. RNA was precipitated by centrifugation at 12,000x g for 5 min at 4 C, then washed with 70% ethanol. The RNA pellet was resuspended in DEPC-treated water. The RNA was reverse transcribed using M-MLV reverse transcriptase to obtain cDNA. The generated cDNA template was diluted in water and subjected to quantitative PCR using the primers listed in the Key Resources Table.

e5 Molecular Cell 73, 1–13.e1–e8, January 17, 2019

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

Transfection For transfection, HeLa cells were seeded at a density of 7 3 104 cells onto 18-mm coverslips for imaging, at a density of 2.5 3 105 cells onto 6-well plates for western blot, and at a density of 2.5 3 106 cells onto a 100-mm dishes for immunoprecipitation and RT-PCR. The next day, DNA constructs were mixed with polyethylenimine (PEI, Polyscience) in Opti-MEM (1:1, w/w), and the mixture was incubated for 20 min at RT. DNA-PEI complexes were added to the cells. Most of the experiments were performed one day after transfection. In the case of primary cortical neurons, purified cells were transfected with expression vectors encoding for GFP or Zip1 1-28 GFP by electroporation using a nucleofector device (Lonza) prior to cell seeding. Total neurite length at DIV5 was measured by NeuronJ, an ImageJ plugin. Cell staining and Live imaging To measure the MMP level, HeLa cells seeded onto 18-mm coverslips were stained with 20 nM tetramethylrhodamine methyl ester perchlorate (TMRM) for 45 min at RT. Mitochondrial ROS was monitored in cells loaded with 5 mM MitoSOX (Invitrogen) for 10 min at 25 C. For visualization of cytosolic Zn2+, HeLa cells were incubated in media containing 2 mM FluoZin-3 AM for 30 min at RT, and then the cells were washed twice in dye-free media at 37 C for de-esterification of intracellular AM ester. Live cell imaging was performed using a confocal microscope (Leica) with 63 3 water immersion objective lens (numerical aperture 1.20) and 100 3 oil immersion objective lens (numerical aperture 1.40). HeLa cells seeded onto 18-mm coverslips were cultured and mounted into live-imaging chamber (Live cell instrument), and then incubated in serum-free media containing 20 mM HEPES during the live imaging. In addition, we used an inverted fluorescence microscope (Zeiss) equipped with CoolLED (pE-2) as a light source, a definite focus module, an EMCCD camera (Evolve 512 delta, Photometrics), and a humidified chamber that maintained cells at 5% CO2 and 37 C. Images were obtained using a Meta morph (version 7.7.5) imaging program (Molecular devices). High-resolution images were obtained using a confocal microscope equipped with an Airyscan detector (LSM800, Carl Zeiss) with 63 3 water immersion objective lens (numerical aperture 1.20). Image analysis of MMP reduction during the mitochondria fission Time-lapse images of live HeLa cells transfected with mitochondrial markers were acquired every 2–3 s for 15 min using the Las X software (Leica). Mitochondrial area and MMP levels were quantified by measuring the fluorescence intensity at ROI containing a 0.5 mm-diameter circle from a mitochondrial fission site. Time constant (t) was fitted to a one-phase decay function. To determine the correlation between MMP and Drp1 puncta, HeLa cells overexpressing YFP-Drp1 were stained with TMRM. The fluorescence intensity of YFP-Drp1 at the site of reduced MMP level was measured. Protein microarray The HuProt human proteome microarray v2.0 (CDI Laboratories) was used for the detection of Drp1-interacting proteins, and the experiment was performed according to the manufacturer’s protocol, with some modifications: Each protein chip was equilibrated with microarray buffer containing (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM KH2PO4, pH 7.4, 0.1% Triton X-100) for 5 min at RT and sequentially incubated with blocking solution composed of 5% IgG-free BSA (Jackson ImmunoResearch) in microarray buffer for 30 min at RT. For screening of Drp1-interacting proteins, a blocked protein chip was washed 3 times with microarray buffer for 10 min, followed by incubation with Drp1 recombinant proteins at a dilution of 5 mg/mL for 12 h at 4 C. To apply Drp1 antibody on protein chips, residual non-bound Drp1 proteins were removed by washing each chip with microarray buffer for 10 min. The washed protein chip was incubated with polyclonal anti-Dlp1 antibody (1:1,000) in microarray buffer containing IgG-free BSA for 2 h and then washed 3 times. The chip was then incubated with secondary anti-rabbit Alex-fluor 647 antibody (1:5,000) for 1 h at RT and washed 3 times with microarray buffer. Each protein chip was dried via centrifugation at 200 g for 2 min using a 50-mL conical tube and scanned using GenePix 4000B (Axon Instruments). Following scanning, the signal intensity value for each spot was obtained as the ratio of foreground to background signals and normalized to GST signal intensity. The mean signal intensity of all proteins on the chip was calculated. Immunocytochemistry and measurement of mitochondrial morphology HeLa cells and cortical neurons were fixed with 4% paraformaldehyde and washed twice using PBS. To prevent non-specific binding of antibodies, samples were incubated with blocking solution containing 3% bovine serum albumin (BSA) and 0.2% Triton X-100 in PBS, pH 7.4. Cells were incubated with the appropriate primary antibody for 2 h at RT: Zip1 (Santacruz, 1:500), Dlp1 (BD bioscience, 1:500), and cytochrome c (BD bioscience, 1:500). After washing with PBS, appropriate fluorophore-labeled secondary antibody was used for 30 min at RT: donkey anti-rabbit (Jackson), anti-mouse (Jackson), and anti-goat (Jackson). Hoechst 33342 (Invitrogen) was used for counterstaining. To visualize the morphology of mitochondria, HeLa cells were transfected with the mitochondrial marker DsRed mito or GFP mito. The images were captured using a confocal microscope (LSM700, Cal Zeiss). Western blot Cells were lysed with RIPA lysis buffer (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate, 1% Triton X-100, and a protease and phosphatase inhibitor cocktail (Roche)) to collect the lysate. Cell lysates were centrifuged at 10,000 3 g for 20 min at 4 C to obtain the cell pellet. Protein content in the supernatant was quantified using bicinchoninic Molecular Cell 73, 1–13.e1–e8, January 17, 2019 e6

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

acid (BCA) protein assay kit according to manufacturer’s instruction. After quantification, samples were mixed with 2 3 SDS Laemmli sample buffer (120 mM Tris-HCl, pH 6.8, 4% sodium dodecyl sulfate, 20% Glycerol), and then heated for 5 min at 100 C. Proteins were separated by 10% SDS-PAGE and transferred onto a PVDF membrane (polyvinylidene difluoride membrane). To prevent non-specific binding of antibodies, the PVDF membrane was blocked by 3% BSA in TBS-T (20 mM Tris-HCl, pH 7.6, 136 mM NaCl, and 0.1% Tween-20) for 1 h at RT. Next, the membrane was incubated with primary antibody in 3% BSA TBST for overnight at 4 C. After extensive washing, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (Jackson) in 5% skim milk TBST for 1 h at RT. Immunoreactive signals were detected with the ECL solution. Immunoprecipitation HeLa cells or HEK293 cells were transfected with Myc, Myc-Drp1, YFP, and YFP-Zip1 in various combinations. After 48 h, cells were treated with 0.75 mM DSP-crosslinker for 30 min. To complete crosslinking reactions, cells were treated with 20 mM Tris, pH 7.4. Subsequently, the cells were lysed with IP buffer containing 30 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% CHAPS, and protease inhibitor cocktail. Lysates were centrifuged at 13,500 3 g for 20 min at 4 C, and the protein concentration in the supernatant was quantified by the BCA Protein Assay according to the manufacturer’s instructions. Prior to incubation with the primary antibody, lysates were pre-cleared by protein-A agarose beads in IP buffer. The supernatant was then transferred to a fresh tube. The lysate and antibody mixture were then incubated overnight at 4 C. Immunocomplexes were incubated with fresh protein-A agarose beads for 4 h at 4 C. After carefully washing the samples 3 times, 2 3 SDS sample buffer was added, and the mixtures were boiled for 5 min. The following antibodies were used for western blot: anti-Dlp1 (1:1,000), anti-Zip1 (Santa Cruz, 1:1,000), and antiMyc (1:1,000). Mitochondrial fractionation For mitochondrial fractionation, HeLa cells were rinsed using PBS, and lysed with pre-chilled mitochondrial buffer containing 250 mM sucrose, 10 mM KCl, 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 20 mM HEPES, and protease and phosphatase inhibitor cocktail. The cells were centrifuged at 500 3 g for 5 min at 4 C to obtain the supernatant, and the supernatant was centrifuged at 10,000 3 g for 15 min at 4 C. The pellet and supernatant were used as the mitochondrial and cytosolic fraction, respectively. 2 3 SDS sample buffer was added, and the mixtures were boiled for 5 min. The following antibodies were used for western blot: anti-Dlp1 (1:1,000), antiVDAC (1:1,000), anti-tubulin (1:1,000), anti-Gq (1:1,000), anti-Zip1 (Santa Cruz, 1:1,000), and anti-Myc (1:1,000). Proximity ligation assay To confirm protein interaction in situ, the Duolink II kit was used according to the manufacturer’s instruction. This method is based on the proximity ligation assay, which allows for the detection of a pair of closely localized proteins (< 40 nm) in situ (So¨derberg et al., 2008). Briefly, cells were fixed and incubated with blocking solution containing 3% BSA and 0.2% Triton X-100 in PBS for 30 min. Cells were then incubated overnight with the primary antibody: anti-Drp1 (1:500) or anti-Zip1 (Santa Cruz, 1:500). Duolink secondary antibodies were then added. Oligonucleotide-conjugated secondary antibodies were ligated together in a circle using the Duolink ligation solution, and polymerase was added to amplify the ligated circular oligonucleotides. Duolink red fluorescence was indicative of polymerized oligonucleotide signals. To label mitochondria, cells were transfected with GFP-mito prior to fixation. Signals were observed using a confocal microscope (Carl Zeiss, LSM510). BiFC assay HeLa cells were co-transfected with Z-Nsp-Zip1 and Z-Csp-Drp1 for the BiFC assay. After 24 h, HeLa cells were fixed with 4% PFA, and then incubated with blocking solution containing 3% BSA and 0.2% Triton X-100 in PBS for 30 min. Cytochrome c antibody was used to label mitochondria. Signals were observed using a confocal microscope (Carl Zeiss, LSM700). Fluorescence protease protection assay (FPP assay) Seeded cells were transfected with the DsRed-mito and YFP-Zip1 construct using PEI. One day after transfection, growth media was replaced with KHM buffer (110 mM potassium acetate, 20 mM HEPES, 2 mM MgCl2) for live imaging. Images were captured every 10 s for 5 min by confocal microscopy (Carl Zeiss). The same volume of KHM buffer containing 20 mM digitonin was added to the cells for 1 min to permeabilize the plasma membrane. The cells were washed with KHM buffer, then 50 mg/mg protease K was added, and the fluorescence was recorded until disappearance of signals. Protein purification GST constructs were transformed into the Escherichia coli BL21 strain. When optical density (O.D.) reached 0.6–0.8, 0.5 mM IPTG was added to the LB media, and the E. coli culture was incubated overnight at 37 C. Cells were collected by centrifugation, lysed using a lysis buffer containing 50 mM Tris-HCl, 100 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, and 1 mM DTT, and then sonicated. Subsequently, the lysates were mixed with washed glutathione-Sepharose beads. After incubation and intensive washes, both GST-Drp1 and GST-Drp1 deletion mutants were eluted using a GST elution buffer. Finally, GST proteins were concentrated and purified using a centrifugal filter unit (USA, Millipore). Purified GST proteins were mixed with pre-cleared glutathione-Sepharose beads, and the mixture was incubated for overnight in rotator at 4 C. Subsequently, the Sepharose beads were mixed with HEK293 cells

e7 Molecular Cell 73, 1–13.e1–e8, January 17, 2019

Please cite this article in press as: Cho et al., Drp1-Zip1 Interaction Regulates Mitochondrial Quality Surveillance System, Molecular Cell (2018), https:// doi.org/10.1016/j.molcel.2018.11.009

expressing YFP-Zip1. The mixture was once again incubated for 4 h in a rotator at 4 C. After intensive washes, 2 3 sample buffer (1 M Tris-HCl, pH 6.8, 10% SDS, 50% glycerol, 5% 2-mercaptoethanol, and 1% bromophenol blue (BPB)) was added and the mixture was heated for 5 min at 100 C. Analysis of mitochondrial Zn2+ using FRET imaging Seeded cells were transfected with mCherry, mCherry-Drp1, and mito-ZapCY1 constructs. One day after transfection, growth media was replaced with live imaging buffer (10 mM HEPES, pH 7.4, 145 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 1.0 mM MgCl2, 10 mM D-glucose). FRET images were acquired by confocal microscopy (Leica) using a microscope filter combination of FRET and CFP: 430/24 nm excitation filter, 455 nm dichroic mirror, and 535/25 nm and 470/24 nm emission filters, respectively. All images were analyzed using ImageJ software. MitoZapCY1-expressing cells were also stained with TMRM to measure MMP levels. Images were captured in live imaging media for 10 min every 3 s. Acquired FRET images were processed as follows with ImageJ software: ‘subtract background’, ‘median filter’, ‘32-bit transition’, ‘Threshold’ and ‘ratio plus plugin’. MATLAB was used for cross-correlation analysis between FRET and TMRM signals. Measurement of cellular ADP:ATP ratio Cells (3.5 3 103) were seeded in 96-well plates one day prior to transfection. Subsequently, the cells were transfected with GFP and GFP-Zip1 1-28. After 2 days, the cells were washed twice, and the cellular ATP:ADP ratio was measured using an ADP:ATP ratio assay kit, according to the manufacturer’s instruction. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical analysis and plotting of graphs were performed using Prism 5.0. The center value and error bar for each graph indicate the mean value and standard error, respectively. Quantitative data were analyzed using the unpaired Student’s t test. DATA AND SOFTWARE AVAILABILITY Raw experimental data from this study have been deposited to Mendeley Data and are available at https://data.mendeley.com/datasets/nkdznpkc68/draft?a=216ed09f-9fab-4cd5-a422-e793086951d2

Molecular Cell 73, 1–13.e1–e8, January 17, 2019 e8