Drug interaction with T-cell receptors

Drug interaction with T-cell receptors: Tcell receptor density determines degree of cross-reactivity Jan Paul Heribert Depta, MSc,a Frank Altznauer, PhD,a Katharina Gamerdinger, PhD,b Christoph Burkhart, PhD,a Hans Ulrich Weltzien, PhD,b and Werner Joseph Pichler, MDa Bern, Switzerland, and Freiburg, Germany

Key words: T-cell receptor, drug-reactive T cells, drug-hypersensitivity, cross-reactivity, sulfonamides

From the aDivision of Allergology, Clinic of Rheumatology and Clinical Immunology/Allergology, Inselspital, University of Bern, Bern, Switzerland, and bMax-Planck Institute of Immunobiology, Freiburg, Germany. Received for publication September 23, 2003; revised November 3, 2003; accepted for publication November 25, 2003. Reprint requests: Dr Werner J. Pichler, Division of Allergology, Clinic of Rheumatology and Clinical Immunology/Allergology, Inselspital, University of Bern, 3010 Bern, Switzerland. Supported by the Swiss National Science Foundation (grant 3100-061452). 0091-6749/$30.00 © 2004 American Academy of Allergy, Asthma and Immunology doi:10.1016/j.jaci.2003.11.030

Abbreviations used APC: Antigen-presenting cell SMX: Sulfamethoxazole TCC: T-cell clone TCR: T-cell receptor

Recognition of small chemicals by the immune system was thought until recently to require the ability to covalently bind to larger molecules.1,2 This hapten concept is well proven but was recently challenged by our finding that certain drugs can react directly with the T-cell receptor (TCR), without the necessity that the drug or drug metabolite covalently binds to carrier molecules.3,4 T-cell stimulation by small pharmacologic compounds such as sulfamethoxazole (SMX), lidocaine, and celecoxib is still MHC-dependent, and some T-cell clones (TCCs) can recognize the drug even if presented by different HLADR alleles.5,6 Moreover, even the type of peptide bound to the MHC groove appears to be exchangeable with persistent stimulatory capacity.7 On the basis of this finding, we proposed the concept of “pharmacologic interaction with immune receptors” (p-i-concept),8 which implies that drugs may directly interact with the TCR and probably MHC molecules and thereby stimulate T cells. On the basis of this concept, we further investigated the mechanisms of the interaction of drug with TCRs. To this end, we cloned T cells from an individual allergic to SMX, transfected the human TCR into TCR-negative murine T-cell hybridoma, and analyzed the transfectants for their reactivity toward SMX and structurally related sulfonamides. In this study, we show that drugs can interact directly with TCR in an MHC-dependent way, and we show in addition that the density of TCR expression is important for the degree of cross-reactivity.

METHODS T-cell stimulants and growth factors Sulfamethoxazole and all related sulfonamides (Fig 1; Sigma, Fluka Holding AG, Buchs, Switzerland), furosemide (Sigma), Celebrex capsules containing 200 mg celecoxib (Pfizer AG, Zurich, Switzerland), and glibenclamide (Aventis Pharma AG, Zurich, Switzerland) were used at indicated concentrations. Rat concanavalin A (ConA) supernatant of ConA-stimulated rat spleen cells served as a source of IL-2 to maintain CTLL cells.9 519

Basic and clinical immunology

Background: Immune-mediated adverse reactions to drugs are often due to T-cell reactivity, and cross-reactivity is an important problem in pharmacotherapy. Objective: We investigated whether chemical inert drugs can stimulate T cells through their T-cell receptor (TCR) and analyzed the cross-reactivities to related compounds. Methods: We transfected human TCRs isolated from two drug-reactive T-cell clones (TCCs) by PCR into a TCR-negative mouse T-cell hybridoma. The TCCs were isolated from a patient with drug hypersensitivity to the antibacterial sulfonamide sulfamethoxazole (SMX). Results: The transfectants reacted to SMX only in the presence of antigen-presenting cells (APCs). Glutaraldehyde-fixed APCs, however, were sufficient to elicit T-cell stimulation, indicating a processing-independent direct interaction of the drug with the TCR and MHC molecule. The transfected hybridomas secreted IL-2 in a drug dose–dependent manner, whereas the degree of reactivity was dependent on the level of TCR expression. One transfectant reacted not only to SMX but also to related sulfonamide compounds. Interestingly, high TCR expression increased cross-reactivity to other structurally related compounds. In addition, SMX-specific TCR crossreacted only with sulfonamides bearing a sulfanilamide core structure but not with sulfonamides such as celecoxib, furosemide, or glibenclamide. Conclusions: These results demonstrate that the T-cell reactivity to drugs is solely determined by the TCR. Moreover, these results show that cross-reactivity of structurally similar compounds correlates with the density of the TCR. Stably transfected T-cell hybridomas may represent a powerful screening tool for cross-reactivity of newly generated sulfonamide-containing compounds such as celecoxib. (J Allergy Clin Immunol 2004;113:519-27.)

520 Depta et al

J ALLERGY CLIN IMMUNOL MARCH 2004

Basic and clinical immunology FIG 1. Chemical structures of sulfonamide derivatives. All sulfonamide derivatives used in the study of von Greyerz et al5,25 are composed by a sulfanilamide core structure (R1) and a distinct heterocycle (R). Compounds are grouped according to the different heterocycles: (1) compounds with a five-ring-heterocycle, (2) pyridine derivative, (3) pyrimidine derivatives containing a guanidine partial structure, (4) pyridazine derivative, and (5) pyrimidine derivatives without a guanidine partial structure. Sulfonamides furosemide, celecoxib and glibenclamide do not contain a sulfanilamide core structure. The sulfonamide-determining structure SO2-NHx is highlighted in gray.

Depta et al 521

J ALLERGY CLIN IMMUNOL VOLUME 113, NUMBER 3

The following monoclonal antibodies were used for flow cytometry: hamster anti-murine CD3ε (145-2C11)10; FITC-conjugated anti-hamster IgG cocktail (G70-204, G94-56; Pharmingen, BD Biosciences, Basel, Switzerland); F(ab´)2 fragment of FITC-conjugated goat anti-mouse IgG (DakoCytomation AG, Zug, Switzerland); PEconjugated anti-human CD4 (MT310; DakoCytomation); unlabeled and FITC-conjugated anti-human TCR Vβ22 and Vβ11 (IMMU 546 and C21; nomenclature according to Wei et al,11 corresponding to TRBV2 and TRBV25, respectively; Immunotech, Beckman Coulter Intl SA, Nyon, Switzerland). For flow cytometric analysis, 2 × 105 cells were stained for 30 minutes at 4°C either directly with fluorescence-labeled monoclonal antibodies or with unlabeled primary monoclonal antibodies, followed by staining with FITC-conjugated secondary monoclonal antibodies. To determine the surface density of TCR transfectants, we used the DAKO QIFIKIT (DakoCytomation). Fluorescence was determined with a Coulter EPICS XL-MCL Flow Cytometer (Beckman Coulter).

T-cell clones and cell lines The SMX-specific human CD4+ T-cell clones UNO2 and UNO3 were generated from an SMX-allergic donor UNO4,12 and were cultured as described previously.5,13 The murine T-cell hybridoma 54ζ17 was a kind gift of O. Acuto (Institut Pasteur, Paris, France) and has been described previously.14 This hybridoma is a variant of the TCR-negative T-cell hybridoma 58α–β–,15 transfected with vectors for the human CD4 molecule (the hybridoma expresses no endogenous murine CD4 molecule16) and the murine CD3ζ chain. EBV-transformed human B-lymphoblastoid cell lines (B-LCL) were used as antigen-presenting cells (APCs). B-LCL were derived from donor UNO with HLA-haplotype HLA-A*0201/26, B*44/60, DRB1*01/10, DQB1*05/x, DQA1*01041/0401. Written consent was obtained from the donor, and the study was approved by the Medical Ethics Committee of the Canton Bern.

Culture media The cell culture medium used for B-LCL was RPMI-1640 (Invitrogen AG, Basel, Switzerland) supplemented with 10% pooled heatinactivated fetal calf serum (FCS, Biochrom KG, Oxoid AG, Basel, Switzerland), 25 mmol/L HEPES buffer (Biochrom KG), 2 mmol/L L-glutamine (Biotest AG, Rupperswil, Switzerland), 10 µg/mL streptomycin and 100 U/mL penicillin (Amimed Products AG, Allschwil, Switzerland). T-cell hybridomas were grown in same media complemented with 50 µmol/L 2-mercaptoethanol. Human T cells were cultured in RPMI-1640 supplemented with 10% pooled, heat-inactivated human AB serum (ZLB Bioplasma, Bern, Switzerland), 25 mmol/L HEPES buffer, 2 mmol/L L-glutamine, 10 µg/mL streptomycin, and 100 U/mL penicillin enriched with 50 U/mL human recombinant IL-2 (Roche Pharma AG, Basel, Switzerland).

T-cell proliferation assay To determine the responses to noncovalently MHC-presented drugs, TCC (5 × 104 cells/well) were incubated in triplicate in 96well, U-bottom plates, together with irradiated (6000 rad) 1 × 104 autologous B-LCL in 0.2 mL medium for human T cells in the presence or absence of various concentrations of antigen. After 48 hours, 0.5 µCi [3H]thymidine was added. After 16 hours, cells were harvested (96-well Cell Harvester; Inotech, Wohlen, Switzerland), and incorporated radioactivity was determined on a scintillation liquidfree beta counter (Trace96; Inotech). To evaluate responses to covalently presented drugs, B-LCL were incubated with indicated amounts of antigen in RPMI-1640 for 2 hours. Antigen-pulsed APC were then washed twice with HBSS, irradiated, and 1 × 104 cells were added to TCC. Proliferation was determined after 48 hours, as

described. To determine a direct, processing-independent presentation of drugs, B-LCLs were fixed with glutaraldehyde as described.4

IL-2 secretion assay To assess IL-2 secretion, T-cell hybridomas (5 × 104 cells/well) were cocultured in triplicate in 0.2 mL culture medium for T-cell hybridomas with 2.5 × 104 B-LCL with indicated antigen concentrations. After 24 hours at 37°C, 100 µL of the supernatant were used for a CTLL-bioassay as described previously.9 Briefly, 100 µL (5 × 103 cells) of the IL-2 sensitive CTLL was added to supernatant. After 30 hours at 37°C, 0.5 µCi [3H]thymidine was added. Cells were harvested 16 hours later, and incorporated radioactivity was determined as described. In some experiments, B-LCL were pulsed with antigen or fixed as described. The MHC restriction specificity of T-cell hybridomas was determined by culturing hybridomas with autologous APC and different MHC-blocking antibodies, either anti-DR (L243), anti-DP (B7.21), anti-DQ (SVPL3) (ATCC, Bethesda, Md), or an anti–class I W6/32 (hybridoma HB82, ATCC) at a dilution of supernatants of 1:10 in the presence of antigen.

Detection of ERK phosphorylation B-LCL were fixed for 5 minutes with 4% paraformadehyd (Sigma); 0.5 mL (3 × 106 cells/mL) B-LCL and 0.5 mL (6 × 106 cells/mL) T-cell hybridomas were incubated in medium for T-cell hybridomas with or without 800 µmol SMX. The cells were briefly centrifuged and incubated for 1 minute. Cells were washed with PBS, lysed, gel-separated, and electrotransferred onto membranes as described.17 The membranes were incubated overnight with a rabbit polyclonal anti-phospho-ERK 1/2 antibody (New England Biolabs, Frankfurt, Germany; 1/1000) at 4°C in TBS/0.1% Tween20/5% nonfat dry milk. For loading controls, stripped filters were incubated with a rabbit polyclonal anti-ERK 1/2 antibody (New England Biolabs, 1/1000). Filters were washed in TBS/0.1% Tween-20 for 30 minutes and incubated with horseradish peroxide–conjugated anti-rabbit secondary antibody (1/3000; Amersham Pharmacia Biotech, Dübendorf, Switzerland) in TBS/0.1% Tween20/5% nonfat dry milk for 1 hour. Filters were developed by an echochemilumenescence technique (ECL Kit, Amersham Pharmacia Biotech) according to the manufacturer’s instructions.

Generation and transfection of the TCR expression vectors Total RNA was extracted from 2 × 106 cells of TCCs with the use of the RNeasy Mini-Kit (Qiagen AG, Basel, Switzerland), which included DNA digestion, transcribed into cDNA using Omniscript (Qiagen AG), and screened by PCR for rearranged TRVA and TRVB elements to determine and to ensure functionality of the rearrangements.18 TCC UNO2 revealed in-frame TRAV3*01 and TRBV2*01 chains rearranged to TRAJ13*01 and TRBJ1-5*01, respectively. TCC UNO3 expressed TRAV3*01 and TRBV25-1*01 together with TRAJ9*01 and TRBJ2-1*01, respectively. Functionally rearranged human TCR α and β genes were used for construction of mousehuman hybrid TCR expression vectors pV2-15α and pV2-15β,19 as described in Vollmer et al.20 The resulting vectors contained human variable sequences together with mouse constant and regulatory TCR sequences. Recipient cells 54ζ17 (8 × 106) were transfected by electroporation, as described previously.20 Oligonucleotide primers used in this study were Pr α intern, TCTACCCAACACATACACATT; PrVα18, CATTTTCTGAGCCACTGGAGTGTGTG; Pr-Vβ8-EcoRI, GATCGAATTCTTTGTGTAAGGAAGGGTGTGGT; Pr-Vβ13, CATCTTGGGACCAAGGCAGGTTCTTG; the TCC UNO2-specific primers were PrLAV3, ACTCCAGTGGCTCAGAAAATGGCCTCT GCACCCATC; UNO2JαSplice-BamHI, GATCGGATCCacttacTTGGGATGACTTGGAGCTTT; AV3mutIf, CTGACTGAGCC

Basic and clinical immunology

Antibodies and flow cytometry

522 Depta et al

J ALLERGY CLIN IMMUNOL MARCH 2004

FIG 2. Expression and functionality of transfected chimeric drug-specific TCR. A, Transfected hybridomas resulting from transfection with TCR UNO2 were stained with FITC-labeled anti-human Vβ for TCR surface expression (the untransfected recipient cell line 54ζ17 was used as a control in solid gray; T2.30, dotted line; T2.25, bold line). B, To test functionality of transfected TCR, transfectants and the recipient cell line 54ζ17 were stimulated with anti-murine CD3ε-coated plates or left unstimulated and IL-2 secretion was determined by [3H]thymidine incorporation of CTLL cells. Results are representative of 3 independent experiments.

Basic and clinical immunology

CTCAGCCCACTCAA; AV3mutIr, TTGAGTGGGCTGAGGGC TCAGTCA; PrLBV2, ACCTGCCTTGGTCCCAAGATGGATAC CTGGCTCGTA; UNO2JβSplice-SalI, GATCGTCGACtcttacCTAG GATGGAGAGTCGAGTC; the UNO3-specific primers were PrLAV3, AV3mutIf, AV3mutIr as for UNO2; UNO3JαSplice-BamHI, GATCGGATCCacttacTTGCTTTAACAAATAGTCTT; PrLBV25-1, ACCTGCCTTGGTCCCAAGATGACTATCAGGCTCCTC; UNO3JβSplice-SalI, GATCGTCGACtcttacCTAGCACGGTGAGC CGTGTC. Restriction sites for EcoRI, BamHI, and SalI are in bold print. Splice sites are indicated by lowercase letters. Mutated nucleotides are underlined. The AV3 chain was modified by use of the QuickChange site-directed mutagenesis kit (Stratagene) and the primers AV3mutIf and -r to eliminate an internal SacI-restriction site.

Nomenclature TCR gene segments, CDR1, CDR2, and CDR3 regions and numbering were defined according to Lefranc in 2001.21

Statistics Correlation coefficient and P values were calculated by using the Spearman nonparametric correlation, with Prism 4.0 (Graphpad Software Inc, San Diego, Calif). R > 0.5 defines linear correlation, and P values of <.05 were stated as significant.

RESULTS Functional expression of human TCR derived from drug-reactive T cells in mouse T-cell hybridomas The human CD4+ TCC UNO2 and UNO3 were generated from peripheral blood mononuclear cells of the SMX-allergic donor UNO.4,12 TCC UNO2 and UNO3 were highly reactive to the inert and noncovalently binding antibacterial drug SMX. The rearranged V(D)J-regions of the functional TCR α- and β-chains were amplified by PCR, cloned into expression vectors for the α- and β-chain,19 and transfected into TCR-negative mouse T-cell hybridoma 54ζ17. To prove successful transfection, a panel of transfectants was analyzed for surface expression of TCR by using

monoclonal antibody against human TRBV2 (UNO2) and TRBV25 (UNO3), respectively. TCR expression differed substantially between the transfectants derived from TCC UNO2 (Fig 2, A) or UNO3 (data not shown), herein after referred to as T2- and T3-transfectants, respectively. The TCR number expressed on the surface was also quantified, and the numbers of two transfectants each ranked as TCR low and high are presented in Table I. Functionality of the expressed TCR was assessed by stimulation with anti-mouse CD3ε and determination of IL-2 secretion. The transfectants but not the untransfected hybridoma 54ζ17 responded to the CD3 stimulus (Fig 2, B). Thus, the hybrid TCR are expressed on the surface of mouse Tcell hybridoma cells and are functional.

SMX interacts in an APC-dependent, processing-independent, and direct manner with TCR transfectants We next investigated whether the reactivity to SMX is solely due to the transfected TCR. Indeed, SMX was capable to stimulate only transfectants with TCR derived from drug-reactive TCCs such as T2.25, whereas the untransfected recipient cell line 54ζ17 as well as the Ni2+specific TCR-transfectant T91320,22,23 did not react with SMX in the presence of the B-LCL (Fig 3, A). NiSO4, however, stimulated the hybridoma T913 only but not T2.25 confirming the specificity of the TCR to SMX. To test dose-dependency to SMX and HLA-restriction of the transfected hybridomas, we used graded concentrations of SMX and HLA-blocking antibodies against HLA-DR, -DP, -DQ and -class I. The IL-2 secretion by the transfectants depended on the concentration of SMX (Fig 3, B). However, transfectant T3.27 appeared to be less sensitive than T2.25. The transfectant T2.25 was restricted to HLA-DQ, whereas T3.27 was HLA-DR restricted, as HLA-DQ– and HLA-DR–specific blocking antibodies could block responses to SMX (Fig 3, C).

Depta et al 523

Basic and clinical immunology

J ALLERGY CLIN IMMUNOL VOLUME 113, NUMBER 3

FIG 3. Characterization of drug-specific TCR transfectants. A, Specific interaction with drug-specific TCR was analyzed by culturing transfectant T2.25, T913 (transfected with Ni2+-specific TCR), or 54ζ17 (untransfected recipient cell line) with APCs in presence or absence of SMX or NiSO4, respectively. IL-2 secretion was determined as in Fig 2, B. B, Dose dependency of transfectants was determined by incubation with graded concentrations of the drug SMX in the presence of APCs. IL-2 secretion was determined as in Fig 2, B. C, Restriction of TCR UNO2 and TCR UNO3 in transfected hybridomas T2.25 and T3.27, respectively, was determined with autologous APCs in the presence of 800 µmol SMX with HLA-blocking antibodies. IL-2 secretion was determined as in Fig 2, B. D, Processing-independent, labile, and specific interaction of SMX with TCR UNO2 was examined by culture of transfectant T2.25 with or without SMX in the presence or absence of autologous APCs, which where either fixed, untreated, or SMX-pulsed. IL-2 secretion was determined as in Fig 2, B. E, To demonstrate the specific and direct interaction of SMX with TCR and APCs, 54ζ17 and T2.25 together with autologous APCs were incubated for 1 minute with or without 800 µmol SMX and subsequently analyzed for ERK 1/2 phosphorylation by Western blotting and immunodetection by antiphospho ERK 1/2 antibody (upper panel). Equal loading of the gel was ensured by immunodetection of ERK 1/2 on the stripped filter (lower panel). Results are representative of 3 independent experiments.

To further investigate the mechanism of the interaction of SMX with TCR, we tested whether APCs are needed for activation of transfectants with SMX. In addition, we examined whether SMX covalently binds to MHC molecules before triggering TCR by pulsing APCs with SMX.

Finally, we tested whether the inert drug SMX needs to be processed to become stimulatory by fixing APCs with glutaraldehyde, as fixation prevents processing of antigens. T2.25 reacted to SMX only in the presence of autologous APCs (Fig 3, D), whereas pulsing of APCs

524 Depta et al

Basic and clinical immunology

FIG 4. Sensitivity and cross-reactivity of TCR transfectants correlates with TCR density. A, UNO2 transfectants (n = 28) bearing different densities of the same TCR were cultured with 800 µmol SMX. Correlation of TCR density to sensitivity was R = 0.8665. B, UNO2 transfectants of different TCR densities (n = 28) were cultured with different sulfonamides structurally related to SMX (Fig 1) at 800 µmol. Correlation of TCR density to degree of cross-reactivity was R = 0.8725. IL-2 secretion was determined as in Fig 2, B. To visualize correlation, data were shown after linear transformation to the natural logarithm; linear regression of data is displayed. Results are representative of 3 independent experiments.

with SMX followed by a washing step did not result in IL-2 secretion, indicating a labile binding of SMX to APCs (Fig 3, D). A direct, processing-independent binding of SMX to surface molecules was suggested because fixing APCs with glutaraldehyde did not abrogate reactivity to SMX (Fig 3, D). In addition, the extracellular signal-regulated kinases are required for the stimulation of IL-2 gene transcription in T cells.24 Western blot analysis of ERK phosphorylation further supported the suggestion that SMX interacts solely with the TCR in a fast, direct, and processingindependent way. SMX stimulated only the transfected hybridoma T2.25 but not the untransfected control 54ζ17 rapidly (1 minute) after addition of SMX (Fig 3, E). With these experiments, we therefore demonstrated that SMX directly interacts with the TCR of drug-reactive T cells.

TCR density determines degree of crossreactivity Next, we evaluated the relation between TCR density and reactivity to the drug. For this purpose, we measured

J ALLERGY CLIN IMMUNOL MARCH 2004

the IL-2 production on SMX stimulation of 28 hybridoma clones that were transfected with the same TCR (TCC UNO2), but each clone bears a different number of TCR on the cell surface. Transfectants with high TCR expression appeared to produce higher amounts of IL-2 in response to SMX than those with low TCR surface density. In Table I, two representative transfectants of each transfected TCR are shown. Fig 4, A, displays the dependency of IL-2 secretion on TCR density of all 28 UNO2 transfectants tested (correlation coefficient, R = 0.8655). This relation was of high statistic significance (P < .0001). Furthermore, we investigated if the level of TCR expression influences its cross-reactivity. Therefore, we tested the transfectants for reactivity to 15 sulfonamide drugs such as SMX5,25 (Fig 1). Compounds containing solely the sulfonamide structure SO2-NHx such as furosemide, celecoxib, and glibenclamide did not elicit cross-reactivity to T2.23 nor to T3.27 with B-LCLs (Fig 5). In contrast, culturing transfectants with B-LCLs and a panel of 12 sulfonamides, which all have a sulfanilamide core structure such as SMX but only differing in side chains, revealed a different pattern of cross-reactivity. TCC UNO3 and its transfectants reacted exclusively to SMX (Table I), whereas TCC UNO2 and its transfectants cross-reacted with up to 7 different related sulfonamides bearing a sulfanilamide core structure (Table I). However, transfectants of low TCR density reacted with fewer compounds than transfectants expressing high TCR density (Table I). Taken together, all 28 UNO2 transfectants tested showed a strong correlation between TCR density and degree of cross-reactivity (correlation coefficient, R = 0.8725; Fig 4, B). This relation was of high statistic significance (P < .0001). The coreceptor CD4 expression level did not contribute to this distinct reactivity, as it was found similar in all transfectants (data not shown). Hence, the strength of reactivity and crossreactivity was not solely determined by the TCR but was dependent on its surface density.

DISCUSSION The presented data show that transfecting the TCR derived from TCC from patients with drug hypersensitivity into a mouse hybridoma transfers the drug specificity and that APCs, fixed and unable to process, could still serve as presenting cells for the drug. We thus demonstrate that chemically inert drugs can stimulate T cells through the TCR. This stimulation still requires the presence of MHC molecules, whereby previous investigations have shown that TCCs with selective specificity for SMX are less dependent on the type of MHC allele than TCCs able to interact with more sulfanilamides.25,26 Our data support the p-i-concept (pharmacologic interaction with immune receptors8), which implies that drugs, even if they are not haptens, can interact directly with certain TCR.4,8 This type of drug interaction with TCR does not require covalent binding of the drug to MHC-peptide complexes, as washing removed the drug, and even fixed APC could still present the drug.4,12 The

interaction is therefore independent of processing and drug metabolism, but stimulation of the transfectants to secrete IL-2 still requires the presence of a MHC structure. Importantly, this interaction was specific, fast, and direct, as the phosphorylated form of ERK proteins were only found in the transfectants shortly after addition of SMX. In consequence, an interaction of small molecules such as drugs with a certain TCR can be sufficient to stimulate the T cell or a mouse T-cell hybridoma, provided MHC molecules are present. It is possible that the labile binding of the drug to the TCR and the MHC molecule is stabilized by forming a trimolecular stimulatory complex (TCR–drug–MHC peptide). Hence, for certain drugs such as SMX, celecoxib, lidocaine, mepivacaine, ciprofloxacine, lamitrogine, carbamazepine,3,4,27,28 and possibly others, it is not the chemical reactivity of the drug but its structure and ability to interact with MHC and TCR that determine the potential to stimulate T cells. We found a great variability in TCR expression levels of drug-specific TCCs (50,000 to 140,000 TCR/cell).5 The factors, which determine the TCR density, are unknown. Transfectants with the same TCR revealed quite different degrees of reactivity, which was clearly related to the TCR density. It is likely that randomly occurring TCR integration into the genome influences the degree of TCR expression on the surface. As the level of costimulatory molecules (human CD4) was similar in the different transfectants, the density of TCR appears to be the important factor for the reactivity of the T cell.29,30 This readiness to react and secrete IL-2 of the different hybridomas has a clear implication for cross-reactivity: First, the potential cross-reactivity of TCR with structurally related drug is primarily determined by its affinity to the drug, since several TCCs5,25 and the transfectants of UNO3 studied here fail to have any crossreactivity, even if TCR expression is high. A second determinant is the TCR density. The higher the TCR density, the more likely a substantial cross-reactivity was found. Third, missing reactivity to a certain drug in transfectants of poor TCR density could be overcome to a certain extent by increasing the drug concentration (data not shown). However, it was not possible to gain additional reactivity beyond the cross-reactivity pattern of the parental TCC by augmenting the drug quantity (data not shown). This implies that the overall stimulation of a T cell through its TCR is the result of affinity, TCR density, and drug concentration. Thereby, the affinity of the TCR for the drug determines whether the presenting molecule is more or less allele-restricted.25,26 However, at present, it is not possible to examine TCR density and cross-reactivity ex vivo in individuals who are allergic to drugs, as technical feasibility is limited. Although our data are based on patients allergic to drugs and have a major impact for better understanding of drug-hypersensitivity reactions, they may also have some practical implications: In addition to the drug, which was causing the allergy, different related compounds were found to interact with the same TCR as well. These compounds are not on the market, which

Depta et al 525

FIG 5. Cross-reactivity to nonantibacterial sulfonamides. T2.25 (upper panel) and T3.27 (lower panel) were cultured with autologous APCs and graded concentration of SMX, furosemide, celecoxib, or glibenclamide. IL-2 secretion was determined as in Fig 2, B. Results are representative of 3 independent experiments.

rules out a previous encounter of the patient allergic to SMX with this drug. Hence, our data illustrate the potential use of these transfectants for screening for crossreactivity of new compounds, that is, has a newly generated sulfonamide-containing drug such as celecoxib any ability to interact with SMX-specific T cells? In such a way, we show that SMX-specific TCR cross-reacted with sulfonamides bearing an antibacterial sulfanilamide core structure but did not cross-react generally with sulfonamide-containing drugs such as furosemide, celecoxib, or glibenclamide.31 Indeed, the current and previous analyses,5,25,28 have revealed that T-cell cross-reactivity differs from B-cell reactions, in particular T cells may require the presence of an identical core structure to recognize related drugs,31 whereas B cells may recognize smaller structures, such as side chains.32,33 In this context, stably transfected T-cell hybridomas may represent a powerful screening tool to predict the potential crossreactivity by T cells with newly generated compounds with related structure. In conclusion, chemically rather inert drugs can interact with TCR and stimulate the T cell. Structurally related drugs may also be stimulatory, dependent on the affin-

Basic and clinical immunology

J ALLERGY CLIN IMMUNOL VOLUME 113, NUMBER 3

526 Depta et al

J ALLERGY CLIN IMMUNOL MARCH 2004

TABLE I. Cross-reactivity of TCCs and its transfectants Clone

TCC UNO2

TCR/cell* Control Sulfamethoxazole Sulfamethizole Sulfathiazole Sulfamoxole Sulfapyridine Sulfadiazine Sulfamerazine Sulfamethazine Sulfamethoxidiazine Sulfamethoxipyridazine Sulfisomidine Sulfadimethoxine Sulfadoxine

55,144 1302† 8156† 7956† 13,964 † 2115† 4336† 2025† 2280† 1792† 1574† 14,733† 5554† 11,883† 15,340†

T2.30

4,167 812‡ 12,324‡ 8396 ‡ 1491 ‡ 428‡ 664‡ 526‡ 455‡ 423‡ 864‡ 739‡ 763‡ 1972 ‡ 765‡

T2.25

TCC UNO3

T3.22

50,651 3906‡ 52,385‡ 37,073‡ 18,163‡ 2746 ‡ 2927 ‡ 2498 ‡ 3441 ‡ 3185 ‡ 3061 ‡ 8332 ‡ 3402 ‡ 25,563‡ 8475 ‡

72,183 234† 17,000† 226† 229† 171† 269† 257† 228† 191† 221† 221† 302† 227† 214†

20,745 15‡ 6046 ‡ 27‡ 25‡ 16‡ 65‡ 34‡ 35‡ 40‡ 65‡ 42‡ 45‡ 30‡ 19‡

T3.27

59,281 92‡ 20,716‡ 49‡ 70‡ 34‡ 42‡ 56‡ 39‡ 67‡ 98‡ 45‡ 51‡ 49‡ 74‡

*TCR density, number of TCR per cell, quantified by the DAKO Qifikit. †Direct proliferation of TCC measured by 3[H]thymidine incorporation in cpm. ‡IL-2 secretion measured in proliferation of IL-2–sensitive cell line CTLL by 3[H]thymidine-incorporation in cpm.

Basic and clinical immunology

ity, concentration, and TCR density expressed on the cell surface. These findings have an effect to screen for crossreactivity and may even open new strategies to intervene with T-cell functions, based on their specificity. We thank Drs Oreste Acuto (Institut Pasteur, Paris, France) for providing us with 54ζ17, Giulia Casorati (DIBIT, Milano, Italy) for the vectors pV2-15α and pV2-15β, and Thomas Brunner (Institut of Pathology, University of Bern, Bern, Switzerland) for the kind gift of 2C11 antibody.

REFERENCES 1. Landsteiner K, Jacobs J. Studies on the sensitization of animals with simple chemical compounds. J Exp Med 1935;61:643-56. 2. Schneider CH, de Weck AL. Chemical aspects of penicillin allergy: the direct penicilloylation of epsilon-amino groups by penicillin at pH 7.4. Helv Chim Acta 1966;49:1695-706. 3. Schnyder B, Mauri-Hellweg D, Zanni M, Bettens F, Pichler WJ. Direct, MHC-dependent presentation of the drug sulfamethoxazole to human alphabeta T cell clones. J Clin Invest 1997;100:136-41. 4. Zanni MP, von Greyerz S, Schnyder B, Brander KA, Frutig K, Hari Y, et al. HLA-restricted, processing- and metabolism-independent pathway of drug recognition by human alpha beta T lymphocytes. J Clin Invest 1998;102:1591-8. 5. von Greyerz S, Zanni MP, Frutig K, Schnyder B, Burkhart C, Pichler WJ. Interaction of sulfonamide derivatives with the TCR of sulfamethoxazole-specific human αβ+ T cell clones. J Immunol 1999;162:595-602. 6. Zanni MP, von Greyerz S, Schnyder B, Wendland T, Pichler WJ. Alleleunrestricted presentation of lidocaine by HLA-DR molecules to specific αβ+ T cell clones. Int Immunol 1998;10:507-15. 7. Burkhart C, Britschgi M, Strasser I, Depta JP, von Greyerz S, Barnaba V, et al. Non-covalent presentation of sulfamethoxazole to human CD4+ T cells is independent of distinct human leucocyte antigen-bound peptides. Clin Exp Allergy 2002;32:1635-43. 8. Pichler WJ. Pharmacological interaction of drugs with antigen-specific immune receptors: the p-I concept. Curr Opin Allergy Clin Immunol 2002;2:301-5. 9. Grabstein K, Eisenman J, Mochizuki D, Shanebeck K, Conlon P, Hopp T, et al. Purification to homogeneity of B cell stimulating factor: a molecule that stimulates proliferation of multiple lymphokine-dependent cell lines. J Exp Med 1986;163:1405-14. 10. Leo O, Foo M, Sachs DH, Samelson LE, Bluestone JA. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc Natl Acad Sci U S A 1987;84:1374-8.

11. Wei S, Charmley P, Robinson MA, Concannon P. The extent of the human germline T-cell receptor V beta gene segment repertoire. Immunogenetics 1994;40:27-36. 12. Schnyder B, Burkhart C, Schnyder-Frutig K, von Greyerz S, Naisbitt DJ, Pirmohamed M, et al. Recognition of sulfamethoxazole and its reactive metabolites by drug-specific CD4+ T cells from allergic individuals. J Immunol 2000;164:6647-54. 13. Zanni MP, Mauri-Hellweg D, Brander C, Wendland T, Schnyder B, Frei E, et al. Characterization of lidocaine-specific T cells. J Immunol 1997;158:1139-48. 14. Blank U, Boitel B, Mege D, Ermonval M, Acuto O. Analysis of tetanus toxin peptide/DR recognition by human T cell receptors reconstituted into a murine T cell hybridoma. Eur J Immunol 1993;23:3057-65. 15. Letourneur F, Malissen B. Derivation of a T cell hybridoma variant deprived of functional T cell receptor alpha and beta chain transcripts reveals a nonfunctional alpha-mRNA of BW5147 origin. Eur J Immunol 1989;19:2269-74. 16. Glaichenhaus N, Shastri N, Littman DR, Turner JM. Requirement for association of p56lck with CD4 in antigen-specific signal transduction in T cells. Cell 1991;64:511-20. 17. Altznauer F, von Gunten S, Späth P, Simon HU. Concurrent presence of agonistic and antagonistic anti-CD95 autoantibodies in intravenous immunoglobulin (IVIg) preparations. J Allergy Clin Immunol 2003;112:1185-90. 18. Genevee C, Diu A, Nierat J, Caignard A, Dietrich PY, Ferradini L, et al. An experimentally validated panel of subfamily-specific oligonucleotide primers (V alpha 1-w29/V beta 1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur J Immunol 1992;22:1261-9. 19. Casorati G, Traunecker A, Karjalainen K. The T cell receptor alpha beta V-J shuffling shows lack of autonomy between the combining site and the constant domain of the receptor chains. Eur J Immunol 1993;23:586-9. 20. Vollmer J, Weltzien HU, Dormoy A, Pistoor F, Moulon C. Functional expression and analysis of a human HLA-DQ restricted, nickel-reactive T cell receptor in mouse hybridoma cells. J Invest Dermatol 1999;113:175-81. 21. Lefranc MP. The T cell receptor facts book. London: Academic Press; 2001. 22. Vollmer J, Weltzien HU, Moulon C. TCR reactivity in human nickel allergy indicates contacts with complementarity-determining region 3 but excludes superantigen-like recognition. J Immunol 1999;163:2723-31. 23. Gamerdinger K, Moulon C, Karp DR, Van Bergen J, Koning F, Wild D, et al. A new type of metal recognition by human T cells: contact residues for peptide-independent bridging of T cell receptor and major histocompatibility complex by nickel. J Exp Med 2003;197:1345-53. 24. Whitehurst CE, Geppert TD. MEK1 and the extracellular signal-regulated kinases are required for the stimulation of IL-2 gene transcription in T cells. J Immunol 1996;156:1020-9.

25. von Greyerz S, Bultemann G, Schnyder K, Burkhart C, Lotti B, Hari Y, et al. Degeneracy and additional alloreactivity of drug-specific human alpha beta(+) T cell clones. Int Immunol 2001;13:877-85. 26. von Greyerz S, Burkhart C, Pichler WJ. Molecular basis of drug recognition by specific T-cell receptors. Int Arch Allergy Immunol 1999;119:173-80. 27. Britschgi M, Steiner UC, Schmid S, Depta JP, Senti G, Bircher A, et al. T-cell involvement in drug-induced acute generalized exanthematous pustulosis. J Clin Invest 2001;107:1433-41. 28. Zanni MP, von Greyerz S, Hari Y, Schnyder B, Pichler WJ. Recognition of local anesthetics by alphabeta+ T cells. J Invest Dermatol 1999;112:197-204. 29. Kim DT, Rothbard JB, Bloom DD, Fathman CG. Quantitative analysis of T cell activation: role of TCR/ligand density and TCR affinity. J Immunol 1996;156:2737-42.

Depta et al 527

30. Viola A, Lanzavecchia A. T cell activation determined by T cell receptor number and tunable thresholds. Science 1996;273:p104-6. 31. Depta JP, Pichler WJ. Cross-reactivity with drugs at the T cell level. Curr Opin Allergy Clin Immunol 2003;3:261-7. 32. Zhao Z, Baldo BA, Rimmer J. Beta-lactam allergenic determinants: fine structural recognition of a cross-reacting determinant on benzylpenicillin and cephalothin. Clin Exp Allergy 2002;32:1644-50. 33. Fernandez M, Warbrick EV, Blanca M, Coleman JW. Activation and hapten inhibition of mast cells sensitized with monoclonal IgE anti-penicillin antibodies: evidence for two-site recognition of the penicillin derived determinant. Eur J Immunol 1995;25:2486-91.

Basic and clinical immunology

J ALLERGY CLIN IMMUNOL VOLUME 113, NUMBER 3