- Email: [email protected]
Dual Function of a Human Immunodeficiency Virus (HIV)-Specific Cytotoxic T-Lymphocyte Clone: Inhibition of HIV Replication by Noncytolytic Mechanisms and Lysis of HIV-Infected CD4+ Cells
VIROLOGY
225, 248–253 (1996) 0597
ARTICLE NO.
SHORT COMMUNICATION Dual Function of a Human Immunodeficiency Virus (HIV)-Specific Cytotoxic T-Lymphocyte Clone: Inhibition of HIV Replication by Noncytolytic Mechanisms and Lysis of HIV-Infected CD4/ Cells FLORENCE BUSEYNE, MICHE`LE FE´VRIER, SYLVIE GARCIA,* MARIE LISE GOUGEON,* and YVES RIVIE`RE1 Unite´ de Virologie et Immunologie Cellulaire and *Unite´ d’Oncologie Virale, URA CNRS 1157, Institut Pasteur, 75724 Paris Cedex 15, France Received August 1, 1996; accepted September 4, 1996 CD8/ T cells may play a beneficial role in human immunodeficiency virus (HIV)-infected patients by two mechanisms: HIV-specific cytotoxic activity and secretion of a soluble mediator(s) that inhibits HIV replication in vitro. Here we characterized both activities mediated by an HIV p24gag-specific cytotoxic T lymphocyte (CTL) CD8/ clone derived from an HIVinfected patient. When the CTL clone was mixed with HIV-infected autologous CD4/ T cells, viral replication was suppressed. This viral inhibition was observed in heterologous CD4/ T cells and when CD8/ and CD4/ populations were separated by a semipermeable membrane, demonstrating the involvement of a diffusible factor(s). The lysis of autologous HIV-infected T cells was also detected. However, HIV suppression was more efficient when CD4/ and CD8/ T cells shared major histocompatibility complex alleles and were in direct contact. Thus, one and the same CD8/ T cell population can mediate both lysis of HIV-infected targets and nonlytic suppression of HIV replication. These results underline the multiple roles of CD8/ T lymphocytes in the suppression of HIV-infected cells. q 1996 Academic Press, Inc.
Virus-specific, major histocompatibility complex (MHC) class I-restricted CD8/ cytotoxic T lymphocytes (CTL) have been shown to play a role in recovery from viral infections (1). Recognition of appropriate target cells by CD8/ T cells leads to both direct lysis of infected cells and secretion of soluble factors with antiviral function, such as interferon-g or tumor necrosis factor-a (2–4). A vigorous CTL response has been detected in people infected with the human immunodeficiency virus (HIV). The effector cells express the CD8 cell surface marker, are MHC class I restricted, and are directed to most structural and regulatory viral proteins (for review, 5, 6). Virus-specific CTL have been temporally associated with reduction of virus load during primary HIV infection in humans, as well as in simian immunodeficiency virusinfected rhesus macaques (7–9). An increased rate of progression to AIDS was observed in asymptomatic HIVinfected adults who had no primary HIV p55gag-specific CTL activity (10). Another activity of CD8/ T lymphocytes is the inhibition of HIV replication in vitro described by Walker et al. (11). A soluble inhibitor released by these cells has been implicated in mediating this antiviral effect (12–14). Re-
cently, IL-16 and a combination of RANTES, macrophage inflammatory protein 1a (MIP-1a), and MIP-1b were shown to inhibit HIV replication (15, 16). Most studies argued that the HIV-inhibitory activity was distinct from direct cytolysis (for review, 17, 18). Although one study demonstrated that the CD8/ T cells which control virus replication had the same phenotype as CTL, polyclonal populations were used in these experiments, which complicated the analysis (19). Based on the known cytokines secretion by virus-specific CTL (3, 4, 20–23), we postulated that the same CD8/ T cell should be able to both lyse infected targets and secrete HIV-inhibitory factor(s). To test our hypothesis, we derived an HIV-specific CD8/ T cell clone. We founded that this clonal CD8/ T cell population exhibited both cytotoxic activity and ability to inhibit HIV replication in acutely infected CD4/ T cells, therefore direct lysis and secretion of HIV-inhibitory factors can be mediated by the same CD8/ T cell. CTL line 141 was derived from an HIV-infected patient (24). PBMC were seeded at 50 cells per well in 96-well plates and cultured with phytohemagglutinin (PHA-p, 2 mg/ml; Difco, Coger, France) and 106/ml irradiated (50 Gy) allogeneic uninfected PBMC as feeder cells. Plates were fed once a week with fresh medium. Subsequent stimulations were antigen specific and performed every 3 to 4 weeks as follows: autologous B-EBV cells were incubated overnight with antigenic peptide 25-17 (KTLRAEQASQEVKNWMTET, aa 302–320 from HIV p24gag,
1 To whom correspondence and reprint requests should be addressed at the Unite´ de Virologie et Immunologie Cellulaire, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France. Fax: (33)1 40 61 30 12; E-mail: [email protected].
0042-6822/96 $18.00
248
Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
VY 8223
/
6a21$$$441
10-04-96 03:37:47
vira
AP: Virology
SHORT COMMUNICATION
249
Ref. 25) or 5045 (QASQEVKNW aa 308–316 from HIV p24gag) at 1 mg/ml, then washed and irradiated (100 Gy). The stimulator to effector ratio was 1/1, and allogeneic irradiated feeder cells were added at a concentration of 106 cells/ml. One to three weeks after the second stimulation, the growing wells were screened for CTL activity against peptide-coated autologous B-EBV cell line, using uncoated B-EBV as control. Flow cytometry analysis demonstrated that the 141 cell line was 99.8% CD3/ CD40 CD8/ TCRab/ TCRgd0 (Fig. 1 and data not shown). Within peptide 25-17, the 9-mer sequence QASQEVKNW (peptide 5045, aa 308–316) was the shortest sequence recognized, and the lowest peptide concentration required for maximal target cell sensitization was 1 ng/ml for the 9-mer. Presentation of antigenic peptide to CTL line 141 is restricted by an MHC class I molecule, HLA-C, not yet defined or detected by genetic or serologic techniques (Buseyne et al., submitted). Using a panel of antibodies specific for TCR-Vb chains the uniform expression of TCR Vb13 was stable over several months (Figs. 1A and 1B). To further characterize the clonality of the 141 Vb13 T cells, both CDR3 size distribution of the Vb13 transcripts and the Jb segments associated with Vb13 were analyzed in a run-off method previously described (30). By contrast to the classical Gaussian-like profile obtained from a control donor’s PBMC, the Vb13-Cb CDR3 size profile obtained from 141 T cells consisted in a single peak with a CDR3 size corresponding to 9 amino acids (Fig. 1C). When the 13 Jb primers were used to refine the molecular analysis of 141 Vb13-Cb transcripts, only Jb1.2 yielded a signal, also composed of a peak corresponding to the expected size of 9 amino acids, whereas Gaussian-like patterns were obtained from control PBMC with all Jb primers (Fig. 1D). Altogether, these results provide evidence of clonality for 141 CTL cells. To determine the capacity of the HIV-specific CTL clone 141 to suppress viral replication, CD4/ T cell lines were infected with HIV-1 and mixed with CD8/ T cell clone 141 restimulated 7 days before. HIV production was monitored by the presence of RT activity in the supernatant (31). CD4/ T cell lines were derived from HIV1-infected patient EM47 and from an HIV-seronegative adult (S26). EM47 CD4/ T cells expressed HLA-A30, A68, B53, and Cw4; S26 CD4/ T cells expressed HLAA29, A32, B7, B17, and Cw7. When clone 141 was added to autologous HIV-infected CD4/ T targets, no viral production could be detected at CD8 to CD4 ratios of 10/1 or 3/1, and at a ratio of 1/1 viral production was delayed (Fig. 2A). CTL were also able to reduce viral replication in HLA-class I mismatched CD4/ T cells, but with a reduced efficiency (Fig. 2B). As an example, inhibition of viral replication at a CD8 to CD4 ratio of 3 was complete in autologous CD4/ T cells, but partial in heterologous cells (Fig. 2). This difference in HIV inhibitory activity against autologous and heterologous CD4/ T cell lines
FIG. 1. Phenotypical and molecular characterization of the TCR from clone 141. (A) The expression of Vb13 TCR element among 141 cells was determined by FACS analysis, using the FITC-conjugated diversiT bV13 mAb (T cell diagnostic; Bioadvance, Emerainville, France). Samples were analyzed on a FACScan cytometer using Lysis II software (Becton Dickinson). The histogram profile of Vb13 fluorescence and that of an irrelevant control mAb are shown in black and white, respectively. (B) The coexpression of TCR Vb13 region and CD8 molecule by two-color immunofluorescence using FITC-conjugated anti-TCR Vb13 and PE-conjugated Leu2a (anti-CD8; Becton Dickinson, Le Pont de Claix, France) specific mAbs is represented on the dot plot analysis. (C and D) Distribution, measured as relative fluorescence intensity, of the aa size of the CDR3 for the run-off reaction products using Cb (C) or the Jb1.2 (D) fluorescent primers. Each peak corresponds to a defined CDR3 size. Patterns on the bottom left correspond to the profile of 141 and patterns in the insets correspond to fresh donor’s profiles. Total RNA from CTL clone 141 was prepared as previously described (26) and reverse transcribed using the Boerhinger Mannheim cDNA synthesis kit. cDNA was amplified by PCR using Vb13 5* primer and Cb 3* primers (27). PCR products were subjected to a run-off reaction using a fluorescent Cb (5* GGTGTGGGAGAATTCTGCTTCTGA 3*) or Jb1.2 3* primer (28) as previously described (29). Separation and analysis of the size of the runoff products, depending on the CDR3 size, were performed using Applied Biosystem 373A DNA sequencer and specially designed software (Immunoscope; C. Pannetier, Paris, France).
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
250
SHORT COMMUNICATION
FIG. 2. CD8/ CTL clone 141 inhibits HIV replication in autologous and heterologous CD4/ T cell lines. In order to derive CD4/ T cell lines, PBMC were depleted of CD8/ T cells using magnetic beads coated with anti-CD8 mAb (Immunotech, Marseille, France) following the manufacturer’s instructions, then seeded at 5 1 105 cells in 24-well plates and stimulated with PHA-p (2 mg/ml) and allogeneic irradiated feeder cells (106/ml). They were restimulated every 3 or 4 weeks with PHA-p. Cell lines were 99% CD4/CD3/ as shown by flow cytometry. CD8/ T cell clone and the CD4/ T cell lines were cultured in RPMI 1640 supplemented with 5% human AB serum (ETS, Les Ulis, France), 2 mM L-glutamine, nonessential amino acids (Gibco BRL), 1 mM sodium pyruvate (Gibco BRL), and 100 IU/ml rIL2 (RU49637, a generous gift from Dr. D. Lando, Roussel Uclaf, Romainville, France). A stock of HIV-1Lai grown in PHA-p-activated PBMC from an HIV-seronegative donor was used to infect the CD4/ T cell lines. CD4/ T cell lines were incubated with HIV (3 to 10 1 104 cpm of RT activity for 106 cells) and polybrene (5 mg/ml), in a small volume for 2 hr at 377 and washed. Infected cells (105) were seeded in 24-well plates and CD8/ T cell clone was added at various concentrations in a final volume of 1 ml. Uninfected CD4/ or CD8/ T lymphocytes were used as negative control, and HIV-infected CD4/ T cell lines alone were used as positive control. Culture supernatants were changed two or three times a week and stored at 0207 until RT activity was assayed using the technique described by Schwartz et al. (31). RT activity is expressed in cpm per 50 ml. Results from one representative experiment are shown. Background RT activity in wells containing CD8/ or uninfected CD4/ alone was 1100 cpm. (A) Clone 141 cocultured with HIVLAI-infected autologous EM47 CD4/ T cell line. (B) Clone 141 cocultured with HIVLAI-infected heterologous S26 CD4/ T cell line.
was observed in five independent experiments where both CD4/ T cells were tested in parallel. But both CD4/ T cell lines were equally sensitive to HIV inhibition by other CD8/ T populations, derived from unrelated uninfected subjects (data not shown). So the higher reverse transcriptase (RT) activity produced by CD4/ T cell line S26 had probably no major influence on HIV inhibition by CD8/ T cell clone 141. The control of HIV replication was also observed when clone 141 was separated from autologous or heterologous CD4/ T cell lines by a 0.4-mm pore size filter in transwell cultures (Fig. 3). In both situations where clone 141 and HIV-infected CD4/ T cell line were HLA matched (Fig. 3A) or mismatched (Fig. 3B), viral production was observed at CD8 to CD4 ratios of 3 to 1 and 1 to 1. The inhibition of viral replication was only observed at a CD8 to CD4 ratio of 10 to 1. Thus, clone 141 was able to control HIV replication in a MHC-independent manner and secretion of soluble inhibitor(s) was involved in this activity. A recent report suggested that the chemokines Rantes, MIP-1a, and MIP-1b are responsible for the antiviral activity of CD8/ T cells (16). We have been able to detect the secretion of RANTES and MIP-1b by ELISA in the supernatants of clone 141 (between 1 and 2 ng/ml at cell concentration of 106/ml). However, it is very unlikely that these chemokines are the suppressive factors in this system because the T-cell-adapted HIVLai strain tested here uses fusin as the coreceptor and is therefore insensitive to RANTES, MIP-1a, and MIP-1b inhibition (16, 32–34).
The mode of action of HIV-inhibitory CD8/ cells is still a matter of debate. Both MHC-restricted and non-MHCrestricted mechanisms have been reported; in most reports suppressive activity was higher in MHC-restricted conditions (11, 13, 19, 20, 35–37). Some investigators reported no contribution of soluble factors (35) or these mediators alone were active but less than CD8/ T cells themselves (12, 13, 37, 38). Here we report that a monoclonal CD8/ T cell population reproducibly exhibited higher inhibitory activity against autologous CD4/ T cells than against heterologous CD4/ T cells or CD4/ T cells separated by a semipermeable membrane (Figs. 2 and 3), and this phenomenon was reproducible (data not shown). As these HIV inhibition assays were conducted in parallel, neither interindividual variations (39) nor laboratory differences in protocols could be invoked to explain these differences. In conclusion, cell contact and MHC compatibility with HIV-infected CD4/ increase the suppressive activity of T cell clone 141. It could be argued that the control of viral replication in autologous CD4/ T cell line occurred because infected cells were lysed by CTL clone 141. As shown in Fig. 4, clone 141 lysed autologous CD4/ T cell line coated with the cognate peptide (Fig. 4A) or autologous HIV-infected CD4/ T cells (Fig. 4B), but was unable to lyse the HLA-class I mismatched CD4/ T cell line that has been used in HIV inhibition assay, coated with the cognate peptide or infected with HIV (Fig. 4). Thus in our experimental system, allogeneic or nonspecific lytic mechanisms do not account for the suppression of HIV
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
SHORT COMMUNICATION
251
FIG. 3. CD8/ CTL clone 141 inhibits HIV replication: involvement of diffusible factors. CD4/ T cell lines were infected with HIV and cultured in the bottom chamber of a transwell culture device (Ref. 3427; Costar, Osi, Maurepas, France). CD8/ cells were added in the top chamber at different ratios. The experiment was otherwise similar to those described for Fig. 2. RT activity is expressed as cpm/50 ml supernatants. Results from one representative experiment are shown. Background RT activity in wells containing CD8/ or uninfected CD4/ alone was 1800 cpm. (A) Clone 141 and HIVLAI-infected autologous EM47 CD4/ T cell line were separated by a semipermeable membrane. (B) Clone 141 and HIVLAI-infected heterologous S26 CD4/ T cell line were separated by a semipermeable membrane.
replication in heterologous CD4/ T cell line, whereas autologous HIV-infected CD4/ T cell line was susceptible to direct lysis by clone 141. Cytotoxic activity was measured 7 days after antigenspecific stimulation and at various time points after the
FIG. 4. Lysis of CD4/ T cell lines by clone 141. CTL assays were conventional 4-hr chromium-51 release assays (40). For peptide assays, target cells were labeled for 1 hr with 3.7 MBq of Na251CrO4 (1 1 106 cells) and washed, and synthetic peptides were added just before mixing the target and effector cells. (A) Autologous (EM47) and heterologous (S26) CD4/ T cells were incubated with medium or peptide 25-17 (KTLRAEQASQEVKNWMTET, aa 302–320 from HIV p24gag) at 1 mg/ml and used as target cells. (B) CD4/ T cells were infected with HIVLAI for 13 days and used as target cells.
setting of coculture experiments and was found to remain constant for several weeks. At the end of HIV-inhibitory assays, the CD8/ T cells present in the coculture had high lytic activity against autologous targets coated with the cognate peptide (data not shown). Flow cytometry analysis demonstrated that both CD4/ and CD8/ T cells remained viable during the coculture, showing that inhibition of viral replication was not due to the suppression of CD4/ T cell lines. When direct lysis of HIV-producing cells was not allowed, i.e., against heterologous HIVproducing cells, HIV inhibition ceased 2 or 3 weeks after the beginning of the coculture (Fig. 2B), whereas HIV inhibition against autologous CTL-sensitive CD4/ T cell line was maintained until the end of the coculture experiment (Fig. 2A). These results suggest that CTL-mediated lysis may reduce viral replication, although direct demonstration would require an HIV-specific CTL clone that does not produce a suppressive factor(s). The implication of lysis of infected cells in the control of HIV replication was refuted by HIV replication after removal of CD8/ T cells from cocultures (11, 37). However, CTL lysis requires synthesis of viral proteins in target cells, and factors secreted by CD8/ T cells inhibit viral transcription (41–44). So, it is possible that in the presence of soluble inhibitor(s), HIV-infected cells could not synthesize viral antigens, and could not present them to CTL and thus avoid a physical destruction by a cytolytic mechanism. The ability of CD8/ T cells from HIV-infected individuals to suppress viral replication was first described by Walker et al. (11) and confirmed by several workers. The inhibition of HIV production is, at least in part, mediated by diffusible factor(s) (12, 13). However, these experiments were conducted with CD8/ polyclonal T cell lines and an important question remains unanswered: does a monoclonal CD8/ T cell population possess both antigen-specific cytolytic activity and the ability to secrete
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
252
SHORT COMMUNICATION
HIV-suppressive factor(s)? We addressed this question using HIV-specific CD8/ CTL clone 141. Clone 141 inhibited viral replication in autologous and heterologous CD4/ T cells acutely infected in vitro with HIV. When CTL 141 and HIV-infected CD4/ T cell lines were cultured in the same well but separated by a semipermeable membrane, inhibition of HIV production was observed. In conclusion, a clonal CD8/ T cell population is able to lyse HIV-infected cells and to secrete a soluble inhibitor(s) of HIV. Toso et al. (38) screened a panel of clonal CD8/ T cell populations derived from HIV-infected patients for suppressing activity. Some suppressive clones lysed target cells expressing HIV proteins, whereas others did not. Bollinger also reported partial inhibition of HIV replication in PBMC blasts by supernatant from CD8/ CTL population (23). These results are in agreement with our data in that CTL-mediated lysis and HIV-suppressive activities are not mutually exclusive properties of individual CD8/ T cell clones. In the autologous system, with cell contact, specific interactions between TCR and MHC peptide (by endogenous presentation) were allowed and this may maintain a continuously activated state of CD8/ T cells. In transwell assays, we observed a reduced HIV-inhibitory activity (Fig. 3). As neither a cytolytic mechanism nor direct contact necessary for T cell stimulation is allowed under this experimental condition, this result suggests that production of HIV-suppressive factor(s) was initially induced by cell activation before the coculture, but that it disappeared in absence of adequate stimulation during the coculture experiment. Indeed CD8/ T cells isolated from HIV-infected patients might be susceptible to TCR-mediated stimulation by HIV-infected CD4/ T cells, inducing the secretion of soluble HIV inhibitor(s). This could explain why CD8/ T cells from infected patients are more efficient than those from uninfected donors in HIV suppression assays (13, 37, 45). In conclusion, our data demonstrate that both CTL activity and HIV inhibitory factor(s) secretion are mediated by a clonal CD8/ T cell population. These results underlined the critical role of cytotoxic CD8/ T cells in preventing progression to disease following HIV infection and highlighted the possible mechanisms for controling HIV replication in vivo. ACKNOWLEDGMENTS We are grateful to Dr. M. McChesney and Dr. M. Emerman for helpful discussions. This work was supported by research grants from Institut Pasteur and Agence Nationale de Recherches sur le SIDA. Y. Rivie`re is an Elisabeth Glaser Scientist supported by the Pediatric AIDS Foundation. S. Garcia is supported by grants from the Fondation pour la Recherche Me´dicale (Sidaction).
REFERENCES 1. Mims, C. A., and White, D. O., In ‘‘Viral Pathogenesis and Immunology,’’ p. 87–131. Blackwell Sci., Oxford, 1984.
AID
VY 8223
/
6a21$$$442
10-04-96 03:37:47
2. Zinkernagel, R. M., and Doherty, P. C., J. Exp. Med. 141, 1427–1436 (1975). 3. Klein, J. R., Raulet, D. H., Pasternak, M. S., and Bevan, M. J., J. Exp. Med. 155, 1198–1203 (1982). 4. Morris, A. G., Lin, Y.-L., and Askonas, B. A., Nature 295, 150–152 (1982). 5. Johnson, R. P., and Walker, B. D., Curr. Top. Microbiol. Immunol. 189, 35–63 (1994). 6. Rivie`re, Y., Robertson, M., and Buseyne, F., Curr. Top. Microbiol. Immunol. 189, 65–74 (1994). 7. Yasutomi, Y., Reimann, K. A., Lord, C. I., Miller, M. D., and Letvin, N. L., J. Virol. 67, 1707–1711 (1993). 8. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., and Oldstone, M. B. A., J. Virol. 68, 6103–6110 (1994). 9. Koup, R. A., Safrit, J. T., Cao, Y., Andrews, C. A., McLeod, G., Borkowsky, W., Farthing, C., and Ho, D. D., J. Virol. 68, 4650–4655 (1994). 10. Rivie`re, Y., McChesney, M. B., Porrot, F., Tanneau-Salvadori, F., Sansonetti, P., Lopez, O., Pialoux, G., Feuillie, V., Mollereau, M., Chamaret, S., Tekaia, F., and Montagnier, L., AIDS Res. Hum. Retroviruses 11, 903–907 (1995). 11. Walker, C. M., Moody, D. J., Stites, P., and Levy, J. A., Science 234, 1563–1566 (1986). 12. Walker, C. M., and Levy, J. A., Immunology 66, 628–630 (1989). 13. Brinchmann, J. E., Gaudernack, G., and Vartdal, F., J. Immunol. 144, 2961–2966 (1990). 14. Mackewicz, C. E., Ortega, H., and Levy, J. A., Cell. Immunol. 153, 329–343 (1994). 15. Baier, M., Werner, A., Bannert, N., Metzner, K., and Kurth, R., Nature 378, 563–560 (1995). 16. Cocchi, F., DeVico, A. L., Garnizo-Demo, A., Arya, S. K., Gallo, R. C., and Lusso, P., Science 270, 1811–1815 (1995). 17. Walker, C. M., Semin. Immunol. 5, 195–201 (1993). 18. Buseyne, F., and Rivie`re, Y., AIDS 7(Suppl. 2), S81–S85 (1993). 19. Tsubota, H., Ringler, D. J., Kannagi, M., King, N. W., Solomon, K. R., MacKey, J. J., Walsh, D. G., and Letvin, N. L., J. Immunol. 143, 858–863 (1989). 20. Bagasra, O., and Pomerantz, R. J., Immunol. Lett. 35, 83–92 (1993). 21. Jassoy, C., Harrer, T., Rosenthal, T., Navia, B. A., Worth, J., Johnson, R. P., and Walker, B. D., J. Virol. 67, 2844–2852 (1993). 22. Price, P., Johnson, R. P., Scadden, D. T., Jassoy, C., Rosenthal, T., Kalams, S., and Walker, B. D., Clin. Immunol. Immunopathol. 74, 100–106 (1995). 23. Bollinger, R. C., Quinn, T. C., Liu, A. Y., Stanhope, P. E., Hammond, S. A., Viveen, R., Clements, M. L., and Siliciano, R. F., AIDS Res. Hum. Retroviruses 9, 1067–1077 (1993). 24. Buseyne, F., Blanche, S., Schmitt, D., Griscelli, C., and Rivie`re, Y., J. Immunol. 150, 3569–3581 (1993). 25. Buseyne, F., Janvier, G., Fleury, B., Schmidt, D., and Rivie`re, Y., Clin. Exp. Immunol. 97, 353–360 (1994). 26. Chomczynski, P., and Sacchi, N., Anal. Biochem. 162, 156–159 (1987). 27. Genevee, C., Diu, A., Nierat, J., Caignard, A., Dietrich, P. Y., Ferradini, L., Roman-Roman, S., Triebel, F., and Hercend, T., Eur. J. Immunol. 22, 1261–1269 (1992). 28. Toyonaga, B., Yoshikai, Y., Vadasz, V., Chin, B., and Mak, T. W., Proc. Natl. Acad. Sci. USA 82, 8624–8628 (1985). 29. Cochet, M., Pannetier, C., Regnault, A., Darche, S., Leclerc, C., and Kourilsky, P., Eur. J. Immunol. 22, 2639–2647 (1992). 30. Pannetier, C., Even, J., and Kourilsky, P., Immunol. Today 16, 176– 181 (1995). 31. Schwartz, O., Henin, Y., Marechal, V., and Montagnier, L., AIDS Res. Hum. Retroviruses 4, 441–448 (1988). 32. Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marnon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., Schall, T. J., Littman, D. R., and Landau, N. R., Nature 381, 661–666 (1996). 33. Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Naga-
vira
AP: Virology
SHORT COMMUNICATION
34. 35. 36. 37. 38.
39.
shima, K. A., Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A., Nature 381, 667–673 (1996). Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A., Science 272, 872–876 (1996). Go´mez, A. M., Smaill, F. M., and Rosenthal, K. L., Clin. Exp. Immunol. 97, 68–75 (1994). Mackewicz, C. E., Ortega, H. W., and Levy, J. A., J. Clin. Invest. 87, 1462–1466 (1991). Walker, C. M., Erickson, A. L., Hsueh, F. C., and Levy, J. A., J. Virol. 65, 5921–5927 (1991). Toso, J. F., Chen, C.-H., Mohr, J. R., Piglia, L., Oei, C., Ferrari, G., Greenberg, M. L., and Weinhold, K. J., J. Infect. Dis. 172, 964– 973 (1995). Walker, C. M., Moody, D. J., Stites, D. P., and Levy, J. A., Cell. Immunol. 119, 470–475 (1989).
AID
VY 8223
/
6a21$$$443
10-04-96 03:37:47
253
40. Buseyne, F., McChesney, M., Porrot, F., Kovarik, S., Guy, B., and Rivie`re, Y., J. Virol. 67, 694–702 (1993). 41. Chen, C.-H., Weinhold, K. J., Bartlett, J. A., Bolognesi, D. P., and Greenberg, M. L., AIDS Res. Hum. Retroviruses 9, 1079–1086 (1993). 42. Knuchel, M., Bednarik, D. P., Chikkala, N., and Ansari, A. A., J. Acquired Immune Defic. Syndr. 7, 438–446 (1994). 43. Mackewicz, C. E., Blackbourn, D. J., and Levy, J. A., Proc. Natl. Acad. Sci. USA 92, 2308–2312 (1995). 44. Powell, J. D., Bednarik, D. P., Folks, T. M., Jehuda-Cohen, T., Villinger, F., Sell, K. W., and Ansari, A. A., Clin. Exp. Immunol. 91, 473–481 (1993). 45. Kannagi, M., Chalifoux, L. V., Lord, C. I., and Letvin, N. L., J. Immunol. 140, 2237–2242 (1988).
vira
AP: Virology
225, 248–253 (1996) 0597
ARTICLE NO.
SHORT COMMUNICATION Dual Function of a Human Immunodeficiency Virus (HIV)-Specific Cytotoxic T-Lymphocyte Clone: Inhibition of HIV Replication by Noncytolytic Mechanisms and Lysis of HIV-Infected CD4/ Cells FLORENCE BUSEYNE, MICHE`LE FE´VRIER, SYLVIE GARCIA,* MARIE LISE GOUGEON,* and YVES RIVIE`RE1 Unite´ de Virologie et Immunologie Cellulaire and *Unite´ d’Oncologie Virale, URA CNRS 1157, Institut Pasteur, 75724 Paris Cedex 15, France Received August 1, 1996; accepted September 4, 1996 CD8/ T cells may play a beneficial role in human immunodeficiency virus (HIV)-infected patients by two mechanisms: HIV-specific cytotoxic activity and secretion of a soluble mediator(s) that inhibits HIV replication in vitro. Here we characterized both activities mediated by an HIV p24gag-specific cytotoxic T lymphocyte (CTL) CD8/ clone derived from an HIVinfected patient. When the CTL clone was mixed with HIV-infected autologous CD4/ T cells, viral replication was suppressed. This viral inhibition was observed in heterologous CD4/ T cells and when CD8/ and CD4/ populations were separated by a semipermeable membrane, demonstrating the involvement of a diffusible factor(s). The lysis of autologous HIV-infected T cells was also detected. However, HIV suppression was more efficient when CD4/ and CD8/ T cells shared major histocompatibility complex alleles and were in direct contact. Thus, one and the same CD8/ T cell population can mediate both lysis of HIV-infected targets and nonlytic suppression of HIV replication. These results underline the multiple roles of CD8/ T lymphocytes in the suppression of HIV-infected cells. q 1996 Academic Press, Inc.
Virus-specific, major histocompatibility complex (MHC) class I-restricted CD8/ cytotoxic T lymphocytes (CTL) have been shown to play a role in recovery from viral infections (1). Recognition of appropriate target cells by CD8/ T cells leads to both direct lysis of infected cells and secretion of soluble factors with antiviral function, such as interferon-g or tumor necrosis factor-a (2–4). A vigorous CTL response has been detected in people infected with the human immunodeficiency virus (HIV). The effector cells express the CD8 cell surface marker, are MHC class I restricted, and are directed to most structural and regulatory viral proteins (for review, 5, 6). Virus-specific CTL have been temporally associated with reduction of virus load during primary HIV infection in humans, as well as in simian immunodeficiency virusinfected rhesus macaques (7–9). An increased rate of progression to AIDS was observed in asymptomatic HIVinfected adults who had no primary HIV p55gag-specific CTL activity (10). Another activity of CD8/ T lymphocytes is the inhibition of HIV replication in vitro described by Walker et al. (11). A soluble inhibitor released by these cells has been implicated in mediating this antiviral effect (12–14). Re-
cently, IL-16 and a combination of RANTES, macrophage inflammatory protein 1a (MIP-1a), and MIP-1b were shown to inhibit HIV replication (15, 16). Most studies argued that the HIV-inhibitory activity was distinct from direct cytolysis (for review, 17, 18). Although one study demonstrated that the CD8/ T cells which control virus replication had the same phenotype as CTL, polyclonal populations were used in these experiments, which complicated the analysis (19). Based on the known cytokines secretion by virus-specific CTL (3, 4, 20–23), we postulated that the same CD8/ T cell should be able to both lyse infected targets and secrete HIV-inhibitory factor(s). To test our hypothesis, we derived an HIV-specific CD8/ T cell clone. We founded that this clonal CD8/ T cell population exhibited both cytotoxic activity and ability to inhibit HIV replication in acutely infected CD4/ T cells, therefore direct lysis and secretion of HIV-inhibitory factors can be mediated by the same CD8/ T cell. CTL line 141 was derived from an HIV-infected patient (24). PBMC were seeded at 50 cells per well in 96-well plates and cultured with phytohemagglutinin (PHA-p, 2 mg/ml; Difco, Coger, France) and 106/ml irradiated (50 Gy) allogeneic uninfected PBMC as feeder cells. Plates were fed once a week with fresh medium. Subsequent stimulations were antigen specific and performed every 3 to 4 weeks as follows: autologous B-EBV cells were incubated overnight with antigenic peptide 25-17 (KTLRAEQASQEVKNWMTET, aa 302–320 from HIV p24gag,
1 To whom correspondence and reprint requests should be addressed at the Unite´ de Virologie et Immunologie Cellulaire, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France. Fax: (33)1 40 61 30 12; E-mail: [email protected].
0042-6822/96 $18.00
248
Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
VY 8223
/
6a21$$$441
10-04-96 03:37:47
vira
AP: Virology
SHORT COMMUNICATION
249
Ref. 25) or 5045 (QASQEVKNW aa 308–316 from HIV p24gag) at 1 mg/ml, then washed and irradiated (100 Gy). The stimulator to effector ratio was 1/1, and allogeneic irradiated feeder cells were added at a concentration of 106 cells/ml. One to three weeks after the second stimulation, the growing wells were screened for CTL activity against peptide-coated autologous B-EBV cell line, using uncoated B-EBV as control. Flow cytometry analysis demonstrated that the 141 cell line was 99.8% CD3/ CD40 CD8/ TCRab/ TCRgd0 (Fig. 1 and data not shown). Within peptide 25-17, the 9-mer sequence QASQEVKNW (peptide 5045, aa 308–316) was the shortest sequence recognized, and the lowest peptide concentration required for maximal target cell sensitization was 1 ng/ml for the 9-mer. Presentation of antigenic peptide to CTL line 141 is restricted by an MHC class I molecule, HLA-C, not yet defined or detected by genetic or serologic techniques (Buseyne et al., submitted). Using a panel of antibodies specific for TCR-Vb chains the uniform expression of TCR Vb13 was stable over several months (Figs. 1A and 1B). To further characterize the clonality of the 141 Vb13 T cells, both CDR3 size distribution of the Vb13 transcripts and the Jb segments associated with Vb13 were analyzed in a run-off method previously described (30). By contrast to the classical Gaussian-like profile obtained from a control donor’s PBMC, the Vb13-Cb CDR3 size profile obtained from 141 T cells consisted in a single peak with a CDR3 size corresponding to 9 amino acids (Fig. 1C). When the 13 Jb primers were used to refine the molecular analysis of 141 Vb13-Cb transcripts, only Jb1.2 yielded a signal, also composed of a peak corresponding to the expected size of 9 amino acids, whereas Gaussian-like patterns were obtained from control PBMC with all Jb primers (Fig. 1D). Altogether, these results provide evidence of clonality for 141 CTL cells. To determine the capacity of the HIV-specific CTL clone 141 to suppress viral replication, CD4/ T cell lines were infected with HIV-1 and mixed with CD8/ T cell clone 141 restimulated 7 days before. HIV production was monitored by the presence of RT activity in the supernatant (31). CD4/ T cell lines were derived from HIV1-infected patient EM47 and from an HIV-seronegative adult (S26). EM47 CD4/ T cells expressed HLA-A30, A68, B53, and Cw4; S26 CD4/ T cells expressed HLAA29, A32, B7, B17, and Cw7. When clone 141 was added to autologous HIV-infected CD4/ T targets, no viral production could be detected at CD8 to CD4 ratios of 10/1 or 3/1, and at a ratio of 1/1 viral production was delayed (Fig. 2A). CTL were also able to reduce viral replication in HLA-class I mismatched CD4/ T cells, but with a reduced efficiency (Fig. 2B). As an example, inhibition of viral replication at a CD8 to CD4 ratio of 3 was complete in autologous CD4/ T cells, but partial in heterologous cells (Fig. 2). This difference in HIV inhibitory activity against autologous and heterologous CD4/ T cell lines
FIG. 1. Phenotypical and molecular characterization of the TCR from clone 141. (A) The expression of Vb13 TCR element among 141 cells was determined by FACS analysis, using the FITC-conjugated diversiT bV13 mAb (T cell diagnostic; Bioadvance, Emerainville, France). Samples were analyzed on a FACScan cytometer using Lysis II software (Becton Dickinson). The histogram profile of Vb13 fluorescence and that of an irrelevant control mAb are shown in black and white, respectively. (B) The coexpression of TCR Vb13 region and CD8 molecule by two-color immunofluorescence using FITC-conjugated anti-TCR Vb13 and PE-conjugated Leu2a (anti-CD8; Becton Dickinson, Le Pont de Claix, France) specific mAbs is represented on the dot plot analysis. (C and D) Distribution, measured as relative fluorescence intensity, of the aa size of the CDR3 for the run-off reaction products using Cb (C) or the Jb1.2 (D) fluorescent primers. Each peak corresponds to a defined CDR3 size. Patterns on the bottom left correspond to the profile of 141 and patterns in the insets correspond to fresh donor’s profiles. Total RNA from CTL clone 141 was prepared as previously described (26) and reverse transcribed using the Boerhinger Mannheim cDNA synthesis kit. cDNA was amplified by PCR using Vb13 5* primer and Cb 3* primers (27). PCR products were subjected to a run-off reaction using a fluorescent Cb (5* GGTGTGGGAGAATTCTGCTTCTGA 3*) or Jb1.2 3* primer (28) as previously described (29). Separation and analysis of the size of the runoff products, depending on the CDR3 size, were performed using Applied Biosystem 373A DNA sequencer and specially designed software (Immunoscope; C. Pannetier, Paris, France).
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
250
SHORT COMMUNICATION
FIG. 2. CD8/ CTL clone 141 inhibits HIV replication in autologous and heterologous CD4/ T cell lines. In order to derive CD4/ T cell lines, PBMC were depleted of CD8/ T cells using magnetic beads coated with anti-CD8 mAb (Immunotech, Marseille, France) following the manufacturer’s instructions, then seeded at 5 1 105 cells in 24-well plates and stimulated with PHA-p (2 mg/ml) and allogeneic irradiated feeder cells (106/ml). They were restimulated every 3 or 4 weeks with PHA-p. Cell lines were 99% CD4/CD3/ as shown by flow cytometry. CD8/ T cell clone and the CD4/ T cell lines were cultured in RPMI 1640 supplemented with 5% human AB serum (ETS, Les Ulis, France), 2 mM L-glutamine, nonessential amino acids (Gibco BRL), 1 mM sodium pyruvate (Gibco BRL), and 100 IU/ml rIL2 (RU49637, a generous gift from Dr. D. Lando, Roussel Uclaf, Romainville, France). A stock of HIV-1Lai grown in PHA-p-activated PBMC from an HIV-seronegative donor was used to infect the CD4/ T cell lines. CD4/ T cell lines were incubated with HIV (3 to 10 1 104 cpm of RT activity for 106 cells) and polybrene (5 mg/ml), in a small volume for 2 hr at 377 and washed. Infected cells (105) were seeded in 24-well plates and CD8/ T cell clone was added at various concentrations in a final volume of 1 ml. Uninfected CD4/ or CD8/ T lymphocytes were used as negative control, and HIV-infected CD4/ T cell lines alone were used as positive control. Culture supernatants were changed two or three times a week and stored at 0207 until RT activity was assayed using the technique described by Schwartz et al. (31). RT activity is expressed in cpm per 50 ml. Results from one representative experiment are shown. Background RT activity in wells containing CD8/ or uninfected CD4/ alone was 1100 cpm. (A) Clone 141 cocultured with HIVLAI-infected autologous EM47 CD4/ T cell line. (B) Clone 141 cocultured with HIVLAI-infected heterologous S26 CD4/ T cell line.
was observed in five independent experiments where both CD4/ T cells were tested in parallel. But both CD4/ T cell lines were equally sensitive to HIV inhibition by other CD8/ T populations, derived from unrelated uninfected subjects (data not shown). So the higher reverse transcriptase (RT) activity produced by CD4/ T cell line S26 had probably no major influence on HIV inhibition by CD8/ T cell clone 141. The control of HIV replication was also observed when clone 141 was separated from autologous or heterologous CD4/ T cell lines by a 0.4-mm pore size filter in transwell cultures (Fig. 3). In both situations where clone 141 and HIV-infected CD4/ T cell line were HLA matched (Fig. 3A) or mismatched (Fig. 3B), viral production was observed at CD8 to CD4 ratios of 3 to 1 and 1 to 1. The inhibition of viral replication was only observed at a CD8 to CD4 ratio of 10 to 1. Thus, clone 141 was able to control HIV replication in a MHC-independent manner and secretion of soluble inhibitor(s) was involved in this activity. A recent report suggested that the chemokines Rantes, MIP-1a, and MIP-1b are responsible for the antiviral activity of CD8/ T cells (16). We have been able to detect the secretion of RANTES and MIP-1b by ELISA in the supernatants of clone 141 (between 1 and 2 ng/ml at cell concentration of 106/ml). However, it is very unlikely that these chemokines are the suppressive factors in this system because the T-cell-adapted HIVLai strain tested here uses fusin as the coreceptor and is therefore insensitive to RANTES, MIP-1a, and MIP-1b inhibition (16, 32–34).
The mode of action of HIV-inhibitory CD8/ cells is still a matter of debate. Both MHC-restricted and non-MHCrestricted mechanisms have been reported; in most reports suppressive activity was higher in MHC-restricted conditions (11, 13, 19, 20, 35–37). Some investigators reported no contribution of soluble factors (35) or these mediators alone were active but less than CD8/ T cells themselves (12, 13, 37, 38). Here we report that a monoclonal CD8/ T cell population reproducibly exhibited higher inhibitory activity against autologous CD4/ T cells than against heterologous CD4/ T cells or CD4/ T cells separated by a semipermeable membrane (Figs. 2 and 3), and this phenomenon was reproducible (data not shown). As these HIV inhibition assays were conducted in parallel, neither interindividual variations (39) nor laboratory differences in protocols could be invoked to explain these differences. In conclusion, cell contact and MHC compatibility with HIV-infected CD4/ increase the suppressive activity of T cell clone 141. It could be argued that the control of viral replication in autologous CD4/ T cell line occurred because infected cells were lysed by CTL clone 141. As shown in Fig. 4, clone 141 lysed autologous CD4/ T cell line coated with the cognate peptide (Fig. 4A) or autologous HIV-infected CD4/ T cells (Fig. 4B), but was unable to lyse the HLA-class I mismatched CD4/ T cell line that has been used in HIV inhibition assay, coated with the cognate peptide or infected with HIV (Fig. 4). Thus in our experimental system, allogeneic or nonspecific lytic mechanisms do not account for the suppression of HIV
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
SHORT COMMUNICATION
251
FIG. 3. CD8/ CTL clone 141 inhibits HIV replication: involvement of diffusible factors. CD4/ T cell lines were infected with HIV and cultured in the bottom chamber of a transwell culture device (Ref. 3427; Costar, Osi, Maurepas, France). CD8/ cells were added in the top chamber at different ratios. The experiment was otherwise similar to those described for Fig. 2. RT activity is expressed as cpm/50 ml supernatants. Results from one representative experiment are shown. Background RT activity in wells containing CD8/ or uninfected CD4/ alone was 1800 cpm. (A) Clone 141 and HIVLAI-infected autologous EM47 CD4/ T cell line were separated by a semipermeable membrane. (B) Clone 141 and HIVLAI-infected heterologous S26 CD4/ T cell line were separated by a semipermeable membrane.
replication in heterologous CD4/ T cell line, whereas autologous HIV-infected CD4/ T cell line was susceptible to direct lysis by clone 141. Cytotoxic activity was measured 7 days after antigenspecific stimulation and at various time points after the
FIG. 4. Lysis of CD4/ T cell lines by clone 141. CTL assays were conventional 4-hr chromium-51 release assays (40). For peptide assays, target cells were labeled for 1 hr with 3.7 MBq of Na251CrO4 (1 1 106 cells) and washed, and synthetic peptides were added just before mixing the target and effector cells. (A) Autologous (EM47) and heterologous (S26) CD4/ T cells were incubated with medium or peptide 25-17 (KTLRAEQASQEVKNWMTET, aa 302–320 from HIV p24gag) at 1 mg/ml and used as target cells. (B) CD4/ T cells were infected with HIVLAI for 13 days and used as target cells.
setting of coculture experiments and was found to remain constant for several weeks. At the end of HIV-inhibitory assays, the CD8/ T cells present in the coculture had high lytic activity against autologous targets coated with the cognate peptide (data not shown). Flow cytometry analysis demonstrated that both CD4/ and CD8/ T cells remained viable during the coculture, showing that inhibition of viral replication was not due to the suppression of CD4/ T cell lines. When direct lysis of HIV-producing cells was not allowed, i.e., against heterologous HIVproducing cells, HIV inhibition ceased 2 or 3 weeks after the beginning of the coculture (Fig. 2B), whereas HIV inhibition against autologous CTL-sensitive CD4/ T cell line was maintained until the end of the coculture experiment (Fig. 2A). These results suggest that CTL-mediated lysis may reduce viral replication, although direct demonstration would require an HIV-specific CTL clone that does not produce a suppressive factor(s). The implication of lysis of infected cells in the control of HIV replication was refuted by HIV replication after removal of CD8/ T cells from cocultures (11, 37). However, CTL lysis requires synthesis of viral proteins in target cells, and factors secreted by CD8/ T cells inhibit viral transcription (41–44). So, it is possible that in the presence of soluble inhibitor(s), HIV-infected cells could not synthesize viral antigens, and could not present them to CTL and thus avoid a physical destruction by a cytolytic mechanism. The ability of CD8/ T cells from HIV-infected individuals to suppress viral replication was first described by Walker et al. (11) and confirmed by several workers. The inhibition of HIV production is, at least in part, mediated by diffusible factor(s) (12, 13). However, these experiments were conducted with CD8/ polyclonal T cell lines and an important question remains unanswered: does a monoclonal CD8/ T cell population possess both antigen-specific cytolytic activity and the ability to secrete
AID
vira
VY 8223
/
6a21$$$442
10-04-96 03:37:47
AP: Virology
252
SHORT COMMUNICATION
HIV-suppressive factor(s)? We addressed this question using HIV-specific CD8/ CTL clone 141. Clone 141 inhibited viral replication in autologous and heterologous CD4/ T cells acutely infected in vitro with HIV. When CTL 141 and HIV-infected CD4/ T cell lines were cultured in the same well but separated by a semipermeable membrane, inhibition of HIV production was observed. In conclusion, a clonal CD8/ T cell population is able to lyse HIV-infected cells and to secrete a soluble inhibitor(s) of HIV. Toso et al. (38) screened a panel of clonal CD8/ T cell populations derived from HIV-infected patients for suppressing activity. Some suppressive clones lysed target cells expressing HIV proteins, whereas others did not. Bollinger also reported partial inhibition of HIV replication in PBMC blasts by supernatant from CD8/ CTL population (23). These results are in agreement with our data in that CTL-mediated lysis and HIV-suppressive activities are not mutually exclusive properties of individual CD8/ T cell clones. In the autologous system, with cell contact, specific interactions between TCR and MHC peptide (by endogenous presentation) were allowed and this may maintain a continuously activated state of CD8/ T cells. In transwell assays, we observed a reduced HIV-inhibitory activity (Fig. 3). As neither a cytolytic mechanism nor direct contact necessary for T cell stimulation is allowed under this experimental condition, this result suggests that production of HIV-suppressive factor(s) was initially induced by cell activation before the coculture, but that it disappeared in absence of adequate stimulation during the coculture experiment. Indeed CD8/ T cells isolated from HIV-infected patients might be susceptible to TCR-mediated stimulation by HIV-infected CD4/ T cells, inducing the secretion of soluble HIV inhibitor(s). This could explain why CD8/ T cells from infected patients are more efficient than those from uninfected donors in HIV suppression assays (13, 37, 45). In conclusion, our data demonstrate that both CTL activity and HIV inhibitory factor(s) secretion are mediated by a clonal CD8/ T cell population. These results underlined the critical role of cytotoxic CD8/ T cells in preventing progression to disease following HIV infection and highlighted the possible mechanisms for controling HIV replication in vivo. ACKNOWLEDGMENTS We are grateful to Dr. M. McChesney and Dr. M. Emerman for helpful discussions. This work was supported by research grants from Institut Pasteur and Agence Nationale de Recherches sur le SIDA. Y. Rivie`re is an Elisabeth Glaser Scientist supported by the Pediatric AIDS Foundation. S. Garcia is supported by grants from the Fondation pour la Recherche Me´dicale (Sidaction).
REFERENCES 1. Mims, C. A., and White, D. O., In ‘‘Viral Pathogenesis and Immunology,’’ p. 87–131. Blackwell Sci., Oxford, 1984.
AID
VY 8223
/
6a21$$$442
10-04-96 03:37:47
2. Zinkernagel, R. M., and Doherty, P. C., J. Exp. Med. 141, 1427–1436 (1975). 3. Klein, J. R., Raulet, D. H., Pasternak, M. S., and Bevan, M. J., J. Exp. Med. 155, 1198–1203 (1982). 4. Morris, A. G., Lin, Y.-L., and Askonas, B. A., Nature 295, 150–152 (1982). 5. Johnson, R. P., and Walker, B. D., Curr. Top. Microbiol. Immunol. 189, 35–63 (1994). 6. Rivie`re, Y., Robertson, M., and Buseyne, F., Curr. Top. Microbiol. Immunol. 189, 65–74 (1994). 7. Yasutomi, Y., Reimann, K. A., Lord, C. I., Miller, M. D., and Letvin, N. L., J. Virol. 67, 1707–1711 (1993). 8. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., and Oldstone, M. B. A., J. Virol. 68, 6103–6110 (1994). 9. Koup, R. A., Safrit, J. T., Cao, Y., Andrews, C. A., McLeod, G., Borkowsky, W., Farthing, C., and Ho, D. D., J. Virol. 68, 4650–4655 (1994). 10. Rivie`re, Y., McChesney, M. B., Porrot, F., Tanneau-Salvadori, F., Sansonetti, P., Lopez, O., Pialoux, G., Feuillie, V., Mollereau, M., Chamaret, S., Tekaia, F., and Montagnier, L., AIDS Res. Hum. Retroviruses 11, 903–907 (1995). 11. Walker, C. M., Moody, D. J., Stites, P., and Levy, J. A., Science 234, 1563–1566 (1986). 12. Walker, C. M., and Levy, J. A., Immunology 66, 628–630 (1989). 13. Brinchmann, J. E., Gaudernack, G., and Vartdal, F., J. Immunol. 144, 2961–2966 (1990). 14. Mackewicz, C. E., Ortega, H., and Levy, J. A., Cell. Immunol. 153, 329–343 (1994). 15. Baier, M., Werner, A., Bannert, N., Metzner, K., and Kurth, R., Nature 378, 563–560 (1995). 16. Cocchi, F., DeVico, A. L., Garnizo-Demo, A., Arya, S. K., Gallo, R. C., and Lusso, P., Science 270, 1811–1815 (1995). 17. Walker, C. M., Semin. Immunol. 5, 195–201 (1993). 18. Buseyne, F., and Rivie`re, Y., AIDS 7(Suppl. 2), S81–S85 (1993). 19. Tsubota, H., Ringler, D. J., Kannagi, M., King, N. W., Solomon, K. R., MacKey, J. J., Walsh, D. G., and Letvin, N. L., J. Immunol. 143, 858–863 (1989). 20. Bagasra, O., and Pomerantz, R. J., Immunol. Lett. 35, 83–92 (1993). 21. Jassoy, C., Harrer, T., Rosenthal, T., Navia, B. A., Worth, J., Johnson, R. P., and Walker, B. D., J. Virol. 67, 2844–2852 (1993). 22. Price, P., Johnson, R. P., Scadden, D. T., Jassoy, C., Rosenthal, T., Kalams, S., and Walker, B. D., Clin. Immunol. Immunopathol. 74, 100–106 (1995). 23. Bollinger, R. C., Quinn, T. C., Liu, A. Y., Stanhope, P. E., Hammond, S. A., Viveen, R., Clements, M. L., and Siliciano, R. F., AIDS Res. Hum. Retroviruses 9, 1067–1077 (1993). 24. Buseyne, F., Blanche, S., Schmitt, D., Griscelli, C., and Rivie`re, Y., J. Immunol. 150, 3569–3581 (1993). 25. Buseyne, F., Janvier, G., Fleury, B., Schmidt, D., and Rivie`re, Y., Clin. Exp. Immunol. 97, 353–360 (1994). 26. Chomczynski, P., and Sacchi, N., Anal. Biochem. 162, 156–159 (1987). 27. Genevee, C., Diu, A., Nierat, J., Caignard, A., Dietrich, P. Y., Ferradini, L., Roman-Roman, S., Triebel, F., and Hercend, T., Eur. J. Immunol. 22, 1261–1269 (1992). 28. Toyonaga, B., Yoshikai, Y., Vadasz, V., Chin, B., and Mak, T. W., Proc. Natl. Acad. Sci. USA 82, 8624–8628 (1985). 29. Cochet, M., Pannetier, C., Regnault, A., Darche, S., Leclerc, C., and Kourilsky, P., Eur. J. Immunol. 22, 2639–2647 (1992). 30. Pannetier, C., Even, J., and Kourilsky, P., Immunol. Today 16, 176– 181 (1995). 31. Schwartz, O., Henin, Y., Marechal, V., and Montagnier, L., AIDS Res. Hum. Retroviruses 4, 441–448 (1988). 32. Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marnon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., Schall, T. J., Littman, D. R., and Landau, N. R., Nature 381, 661–666 (1996). 33. Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Naga-
vira
AP: Virology
SHORT COMMUNICATION
34. 35. 36. 37. 38.
39.
shima, K. A., Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A., Nature 381, 667–673 (1996). Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A., Science 272, 872–876 (1996). Go´mez, A. M., Smaill, F. M., and Rosenthal, K. L., Clin. Exp. Immunol. 97, 68–75 (1994). Mackewicz, C. E., Ortega, H. W., and Levy, J. A., J. Clin. Invest. 87, 1462–1466 (1991). Walker, C. M., Erickson, A. L., Hsueh, F. C., and Levy, J. A., J. Virol. 65, 5921–5927 (1991). Toso, J. F., Chen, C.-H., Mohr, J. R., Piglia, L., Oei, C., Ferrari, G., Greenberg, M. L., and Weinhold, K. J., J. Infect. Dis. 172, 964– 973 (1995). Walker, C. M., Moody, D. J., Stites, D. P., and Levy, J. A., Cell. Immunol. 119, 470–475 (1989).
AID
VY 8223
/
6a21$$$443
10-04-96 03:37:47
253
40. Buseyne, F., McChesney, M., Porrot, F., Kovarik, S., Guy, B., and Rivie`re, Y., J. Virol. 67, 694–702 (1993). 41. Chen, C.-H., Weinhold, K. J., Bartlett, J. A., Bolognesi, D. P., and Greenberg, M. L., AIDS Res. Hum. Retroviruses 9, 1079–1086 (1993). 42. Knuchel, M., Bednarik, D. P., Chikkala, N., and Ansari, A. A., J. Acquired Immune Defic. Syndr. 7, 438–446 (1994). 43. Mackewicz, C. E., Blackbourn, D. J., and Levy, J. A., Proc. Natl. Acad. Sci. USA 92, 2308–2312 (1995). 44. Powell, J. D., Bednarik, D. P., Folks, T. M., Jehuda-Cohen, T., Villinger, F., Sell, K. W., and Ansari, A. A., Clin. Exp. Immunol. 91, 473–481 (1993). 45. Kannagi, M., Chalifoux, L. V., Lord, C. I., and Letvin, N. L., J. Immunol. 140, 2237–2242 (1988).
vira
AP: Virology