- Email: [email protected]
Dual signal amplification strategy for specific detection of Circulating microRNAs based on Thioflavin T
Sensors and Actuators B 249 (2017) 1–7
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Dual signal amplification strategy for specific detection of Circulating microRNAs based on Thioflavin T Tingting Fan a,b,1 , Yu Mao b,c,1 , Feng Liu b , Wei Zhang b , Jingxian Yin a,b , Yuyang Jiang a,b,∗ a
Department of Chemistry, Tsinghua University, Beijing, 100084, China The Ministry-Province Jointly Constructed Base for State Key Lab-Shenzhen Key Laboratory of Chemical Biology, The Graduate School at Shenzhen, Tsinghua University, Shenzhen 518055, China c Laboratory of Chemical Genomics, School of Chemical Biology and Biotechnology, Peking University Shenzhen Graduate School, Shenzhen 518055, China b
a r t i c l e
i n f o
Article history: Received 16 December 2016 Received in revised form 1 April 2017 Accepted 12 April 2017 Available online 13 April 2017 Keywords: Dual signal amplification Circulating microRNAs Thioflavin T CHA-RCA Target recycling
a b s t r a c t Circulating microRNAs (c-miRNAs) are emerging as new non-invasive biomarkers for human cancers diagnosis and prognosis. Herein, in this study, an ideal biosensing system with highly sensitivity and excellent selectivity for rapid and facile detection of c-miRNAs has been developed. The sensing system mainly consists of two unlabeled hairpin probes (HP1 and HP2) and a circular probe. Upon binding with the target miRNA, HP1 is opened, which serves as a toehold to hybridize with HP2. Since HP1-HP2 duplex is more stable than HP1-miRNA duplex, the target miRNA can be displaced from HP1, and again binds with a new HP1 to initiate another reaction cycle. Moreover, the newly formed HP1-HP2 duplex can be further used as a primer to initiate rolling circle amplification (RCA) with the circular probe, producing extremely long single-stranded DNA molecules with repetitive sequence units which can form into a large number of G-quadruplexes. These G-quadruplexes can bind with ThT, resulting in a significantly enhanced fluorescent signal. This newly developed sensing system has great potential to be applied in biochemical research and clinical diagnosis based on the high-performance of circulating miR-21 detection in this study. © 2017 Published by Elsevier B.V.
1. Introduction microRNAs (miRNAs) are a class of short (18–24 nt), endogenous, non-coding RNA molecules that regulate the expression of over 60% target genes through sequence-specific hybridization to the 3 untranslated region (UTR) of messenger RNAs [1,2]. It has been demonstrated that miRNAs are involved in various biological processes, such as cell proliferation, differentiation, stress resistance, and cell death [3–5]. There is now compelling evidence that miRNAs regulate all aspects of the so-called “hallmarks of cancer” that enable tumor growth and metastatic dissemination [6]. Recently the discovery of circulating microRNAs (c-miRNAs) in cancer patients holds great promise for the use of miRNAs as distinctive, non-invasive cancer biomarkers [7]. c-miRNAs are a group of miRNAs, which can be readily detected in plasma [8], serum or whole blood [9]. Despite some interesting and exciting findings, the
∗ Corresponding author at: Department of Chemistry, Tsinghua University, Beijing, 100084, China. Tel./fax: +86 755 2603 2094. E-mail address: [email protected] (Y. Jiang). 1 The two authors contributed equally to the work. http://dx.doi.org/10.1016/j.snb.2017.04.079 0925-4005/© 2017 Published by Elsevier B.V.
field of c-miRNAs has been hindered by measurement-associated inconsistency and irreproducibility. Several traditional methods have been utilized for miRNAs detection, including northern blotting [10], microarrays [11], and real-time PCR (Q-PCR) [12,13]. However, these miRNAs detection techniques have irreparable limitations, such as low sensitivity, low selectivity, and labor-intensive steps. The unique characteristics of miRNAs, including their short length, low abundance, and sequence homology among the miRNAs family, also make them difficult to analyze [14]. In order to improve the sensitivity, specificity, and simplicity of miRNAs assay, a variety of new strategies have been developed, such as electrochemical sensors [15,16], immunosensors [17], nanopore sensors [18,19], and sequence-based amplification [20,21]. Among these methods, rolling circle amplification (RCA) has attracted much attention in miRNAs detection due to its sensitivity, good specificity and simplicity [22,23]. Rolling circle amplification (RCA) is an isothermal enzymatic process where a short DNA/RNA primer is amplified to form a long single stranded DNA/RNA using a circular DNA template and special DNA/RNA polymerases. The RCA product is a concatemer containing tens to hundreds of tandem repeats that are complementary to the circular template [24,25]. The power, simplicity, and versatility
2
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Table 1 Sequences of the oligonucleotides used in this study.a Oligonucleotides
Sequence (from 5 to 3 )
Hairpin Probe1 (HP1) Hairpin Probe2 (HP2) Circular Probe (CP) microRNA21 (miR-21) Single-base mismatched miR-21 (M1) Two-bases mismatched miR-21 (M2) Three-bases mismatched miR-21 (M3) Four-bases mismatched miR-21 (M4) Five-bases mismatched miR-21 (M5) miR-21 with one additional base (A1) miR-21 with two additional bases (A2) miR-21 with three additional bases (A3)
TCAACATCAGTCTGATAAGCTACGATGTGTAGATAGCTTATCAGACT TAAGCTATCTACACATGGTAGCTTATCAGACTCCATGTGTAGAGGT TACACAATCTCGACTAGTCAGACCCTAACCCTAACCCTAACCCTACAACATGTCTTTGATACCTC UAGCU UAUCA GACUG AUGUU GA UAGCU UAUCA GACCG AUGUU GA UAGCA UAUCA GACCG AUGUU GA UAGCA AAUCA GACCG AUGUU GA AAGCA AAUCA GACCG AUGUU GA AAGCA AAUCA GACCG AUGUC GA TUAGC UUAUC AGACU GAUGU UGA TTUAG CUUAU CAGAC UGAUG UUGA GTTUA GCUUA UCAGA CUGAU GUUGA
a In HP1 and HP2, the underlined letters indicate the sequences complementary to each other to form the stems of the hairpin probes, respectively. In HP1, the boldface letters indicate the sequences complementary to the target miRNA (miR-21). In HP2, the boldface letters indicate the sequences complementary to HP1. In CP, the boldface letters indicate the sequences complementary to HP2, and the underlined letters indicate the sequences to form a G-quadruplex, which can bind with ThT and light up fluorescent signal. In M1, M2, M3, M4, M5, the underlined-boldface letters indicate the mutation sites of miR-21. In A1, A2, A3, the letters shown in bold italics indicate the additional bases of miR-21.
Scheme 1. Schematic illustration of dual signal amplification strategy for specific detection of circulating microRNAs based on Thioflavin T. (For interpretation of the references to color in the text, the reader is referred to the web version of this article.)
of the nucleic acid amplification technique have made it an attractive tool for biomedical research [26,27] and nanobiotechnology [28]. Recently, target catalyzed hairpin assembly (CHA) was developed for DNA nanostructure organization and also as a promising signal amplification strategy for DNA detection on account of its significant advantages such as simple, cost-effective, isothermal and high sensitive [29,30]. Therefore, we examined the combination of these two amplification strategies (CHA-RCA) to detect c-miRNAs. G-quadruplexes can be formed from guanine-rich DNA and RNA sequences, usually effectively induced by Na+/K+ [31,32], small molecules, or certain cationic dyes [33,34]. Recently, Mohanty et al. [35] reported for the first time that water-soluble Thioflavin T (ThT) was a G-quadruplex specific fluorescent indicator among other DNA forms including single-strand, duplexes or triplexes. What’s more, it has a weakly fluorescence by itself, while exhibit great fluorescence enhancement upon binding with G-quadruplex DNA structure under physiological salt conditions. The special structural selectivity of ThT for G-quadruplexes may improve the specificity of sensing. Spurred on by all the above findings, herein, for the first time, we have developed a simple, specific and label-free biosensing sys-
tem that ingeniously combines CHA and RCA for rapid and facile detection of c-miRNAs. The dual signal amplification strategy not only improves the sensitivity of the biosensing system but also provides a new way for c-miRNAs detection. As proof of concept, the detection of miR-21 is demonstrated in this study. The assay does not involve any chemical modification, which is simple and cost-effective. With the significant dual signal amplifications, the detection limit of the newly developed sensing system is lower than previous reported ThT-based methods. Importantly, the sensing system offers high selectivity for the determination between perfectly matched miRNA and single-base mismatched miRNA. Moreover, this sensing system has a good detection performance in real biological samples, which holding a great potential for further applications in the clinical diagnosis of cancers. 2. Experiments 2.1. Chemicals and reagents All of the chemicals and reagents used in this study were analytical grade and used without further purification. The
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
3
ride (MgCl2 ), 40% Acrylamide/bis-acrylamide (29:1) mixture, Tris base, N,N,N,N -tetramethyl-ethylenediamine (TEMED), Boric acid, and Ammonium persulfate (APS) were purchased from Sangon Biotech Co., Ltd (Shanghai, China). The human serum samples were obtained from Peking University Shenzhen Hospital (Shenzhen, China). The oligonucleotides were synthesized by Invitrogen Biotechnology Co.,Ltd (Shanghai, China) and their sequences are shown in (Table 1). The stock solution of HP1 and HP2 were prepared by dissolving the lyophilized powder in 20 mM Tris-HCl buffer (100 mM NaCl, 5 mM MgCl2 , pH 7.4). The HP1 and HP2 solution were heated to 95 ◦ C for 5 min and then allowed to cool down to room temperature to form designed hairpin structure before use. All of the pipette tips and centrifuge tubes were treated with Diethylpyrocarbonate (DEPC) and autoclaved to protect miRNAs from RNase degradation. 2.2. Apparatus All fluorescence measurements were carried out in a 96-well assay plate (Costar, Washington, DC, USA) using a microplate reader (Tecan infinite M1000 Pro, Männedorf, Switzerland) under room temperature. The excitation wavelength of the solution was set at 425 nm, and the emission spectra were collected from 450 to 600 nm with a step of 2 nm. The maximum emission observed at 485 nm, which was used to determine the fluorescence intensity. Gel electrophoresis images were obtained on a Molecular Imager Pharos FXTM Plus system (Bio-Rad, Hercules, CA, USA). 2.3. Procedure of circulating miRNAs assay The experiments were carried out in 20 L of solution containing 2 L of HP1 (1 M), 2 L of HP2 (1 M), 0.5 L RNase inhibitor (40 U/L), 2 L Tris-HCl buffer (200 mM), 10 L of target miRNA (varying concentrations), and 3.5 L of RNase-free water, followed by incubating at 37 ◦ C for 2 h. Subsequently, 5 L of dNTPs (10 mM), 0.5 L phi29 DNA polymerase (10 U/L), 10 L of circular probe (1 M), 10 L of ThT (100 M), 10 L of RCA buffer (10×) and 44.5 L of ddH2 O were added into the above solution to yield a total volume of 100 L and incubated at 37 ◦ C for 40 min. After incubation, the resulting samples were used for fluorescence measurements. 3. Results and discussion 3.1. The principle of dual signal amplification strategy for circulating miRNA detection
Fig. 1. (A) A 20% native PAGE for the detection of catalyzed hairpin assembly (CHA). M is a DNA marker, lane (1) miR-21, (2) HP1, (3) HP2, (4) miR–21 + HP1, (5) miR–21 + HP2, (6) HP1 + HP2, (7) miR–21 + HP1 + HP2, respectively. (B) A 0.5% agarose gel for the detection of amplified products by catalyzed hairpin assembly coupled with rolling circle amplification (CHA-RCA). M is a DNA marker, lanes (1) and (2) are CHA-RCA products in the absence and presence of miR-21, respectively.
phi29 DNA polymerase and deoxynucleotide solution mixture (dNTPs) were purchased from New England Biolabs (NEB, Beijing, China). RNase-free water, RNase inhibitor, DNA markers (20 bp and 15,000 bp) and 6 × Loading buffer were purchased from TaKaRa Biotechnology Co., Ltd (Shiga, Japan). Thioflavin T (ThT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Agarose was purchased from Invitrogen Biotechnology Co., Ltd (Carlsbad, CA, USA). Sodium chloride (NaCl), Magnesium chlo-
The new label-free sensing system for amplified detection of c-miRNA is illustrated in (Scheme 1). The sensing system mainly consists of two unlabeled hairpin probes (HP1 and HP2) and a circular probe. HP1 has the recognition domain for the target miRNA, HP2 contains two domains, domain I (dark blue) is complementary to HP1, and domain II (red) is complementary to circular probe. The circular probe is functionalized with the complimentary sequence of G-quadruplex at its medium position. In the absence of the target miRNA, the two hairpin probes (HP1 and HP2) can coexist in solution and keep their stable hairpin conformation, which provides a low background for the sensing system. Conversely, in the presence of the target miRNA, upon the interaction of HP1 with the target miRNA, HP1 is opened, resulting in the exposure of whole sequence. The exposed sequence serves as a toehold to hybridize with HP2, since HP1-HP2 duplex is more stable than HP1-miRNA duplex, the target miRNA can be displaced from HP1 by HP2 through a process similar to DNA branch migration [36]. The displaced target miRNA again binds with a new HP1 to initiate the target recycling amplification cycle. As a result, each copy of target miRNA
4
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Fig. 2. (A) Optimization of hairpin probes (HP1 and HP2) concentration. (B) Optimization of incubation time (CHA time). (C) Optimization of circular probe concentration. (D) Optimization of rolling circle amplification time (RCA time). (E) Optimization of ThT concentration. The error bars represent the standard deviations of three independent experiments.
can trigger numerous assembly processes between HP1 and HP2. Moreover, the newly formed HP1-HP2 duplex can be further used as a primer to initiate rolling circle amplification (RCA) with the circular probe, generating a large number of G-quadruplex structures. As mentioned above, ThT is a water-soluble fluorogenic dye characterized by a pronounced structural selectivity for G-quadruplexes but not for single, double or triplexes stranded DNA. Thus, these
G-quadruplexes can bind with ThT, which lead to significantly enhance the fluorescent signal. Using this sensing platform of catalyzed hairpin assembly coupled with rolling circle amplification (CHA-RCA) and Thioflavin T as a signal indicator, an ultra-highly selective, sensitive, simple and rapid sensor for the amplified detection of c-miRNAs has been developed.
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
5
Fig. 3. (A) Typical fluorescence emission spectra upon addition of miR-21 (0, 0.1 nM, 0.2 nM, 0.4 nM, 0.6 nM, 0.8 nM, 1 nM, 1.5 nM, 2 nM, 2.5 nM). (B) The calibration curve between the miR-21 concentrations and fluorescence intensity. Experimental conditions: HP1 100 nM, HP2 100 nM, incubation time 2 h, circular probe 100 nM, ThT 10 M, and RCA time 40 min. The error bars show the standard deviation of three replicate determinations.
3.2. Investigation of the feasibility of the detection method Since the c-miRNAs detection based on CHA-RCA and ThT is a novel method reported for the first time in the present study, the feasibility for catalyzed hairpin assembly coupled with rolling circle amplification were verified at the initial stage, and the results were exhibited in (Fig. 1). 20% native-PAGE were performed to evaluate catalyzed hairpin assembly, as presented in (Fig. 1A). Lane 1, 2, 3, indicate the positions of miR-21, HP1 and HP2, respectively. When HP1 was mixed with target miR-21, a new clearly band appears as shown in line 4, indicating the formation of miR-21-HP1 duplexes. Lane 5 demonstrates no interaction between target miR-21 and HP2. Strikingly, as shown in lane 7, the coexistence of target miR-21, HP1and HP2 in the sensing system, there appears a very bright new band in the top of the lane 7 with high molecular weight, and the band of target miR-21 doesn’t disappear. In contrast, when the system has no target miR-21, there is not any band at the top position with high molecular weight (lane 6), confirming that the process of CHA is directly associated with target miR-21 hybridization. These results indicate the feasibility of target recycling using catalyzed hairpin assembly. Additional evidence for the CHA-RCA was obtained by 0.5% agarose gel electrophoresis. As shown in (Fig. 1B) miR-21 successfully triggered the CHA-RCA reaction to give a very bright band in agarose gel (lane 2). Conversely, there was only a shadow band without target miR-21 (lane 1). These facts were consistent with the proposed mechanism shown in (Scheme 1), and strongly indicate that the dual signal amplification strategy is efficient for amplified detection of target miRNA. 3.3. Optimization of detection conditions According to the principle of circulating miRNAs detection, experimental conditions such as the amount of hairpin probes, the concentration of circular probe, the amount of ThT, CHA incubation time and RCA time have a great effect on the sensitivity of the detection system. Hence, a series of systematic optimization experiments were carried out to obtain the optimal assay conditions. As shown in (Fig. 2), where F and F0 are the fluorescence intensity (ex = 425 nm, em = 485 nm) in the presence and in the absence of target miRNA, respectively. Firstly, optimization of the hairpin probes (HP1 and HP2) concentration (10–1000 nM range) was carried out. As shown in (Fig. 2A), the best signal was obtained when100 nM of each hairpin probes (HP1 and HP2) was
used. Next, we optimized the concentration of the CHA incubation time (0.5–2.5 h range). As shown in (Fig. 2B), the F/F0 reached a maximum value at 2 h, thus, subsequent work employed 2 h of incubation time. We further optimized the concentration of the circular probe (20–400 nM). The experimental results in (Fig. 2C) showed that 100 nM performed better than the other concentrations, thus, 100 nM circular probe was used for the following experiments. In this assay, the RCA time is another important factor that can significantly affect the performance of the sensing system. As shown in (Fig. 2D), the value of F/F0 raised distinctly from 10 to 40 min, and reached a plateau after 40 min. So the RCA time of 40 min was selected for the following experiments. Finally, we investigated the concentration of ThT (0.1–100 M range). The results in (Fig. 2E) demonstrated that 10 M is the optimal concentrations for ThT.
3.4. Sensitivity for circulating miRNAs detection system Under the optimal conditions, we investigated the sensitivity of the proposed method upon addition of different concentrations of miR-21. As shown in (Fig. 3A), a dramatic increase in the fluorescence emission spectrum was observed with the increasing miR-21 concentrations from 0 to 1.5 nM, and reached a plateau after 1.5 nM. The value of fluorescence intensity has a linear correlation with the concentration of miR-21 over the range from 0 to 1 nM (Fig. 3B). The regression equation is Y = 41.031 + 88.382C with a correlation coefficient of 0.994, where Y is the value of fluorescence intensity, C is the concentration of miR-21. The limit of detection is estimated to be 10 pM on the basis of 3/k (Eq. (S1)). Compared with the reported miRNA detection biosensors (Table S3), the detection limit and linear range of our work is comparable to or even better than that of the previous works. More importantly, compared with the works previously reported using Thioflavin T as a fluorescent indicator for biosensor fabrication by Tan et al. [37] (the LOD of DNA detection = 6.5 nM, the LOD of RNA detection = 5.7 nM, the LOD of protein detection = 13 nM), Tong et al. [38] (the LOD of cysteine detection = 8.4 nM, the LOD of glutathione detection = 13.9 nM), Wang et al. [39] (the LOD of ATP detection = 5 M), our sensor has much higher sensitivity. This can be attributed to the target recycling by catalyzed hairpin assembly (Scheme S1) and the extremely high amplification efficiency of RCA. The result suggests that the sensor has excellent sensitivity for target c-miRNAs.
6
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Table 2 Detection of miR-21 in human serum samples compared with qRT-PCR. CHA-RCA assay
qRT-PCR assay
Sample
Added/ (nM)
Mean founda /(nM)
Mean Recoveryb (%)
RSDc
Added/ (nM)
Mean found/(nM)
Mean Recovery (%)
RSD
1 2 3
0.60 0.80 1.00
0.66 0.82 1.01
110 102 101
0.28 0.50 0.65
0.60 0.80 1.00
0.90 0.94 1.08
150 117 108
0.21 0.20 0.23
a b c
Mean concentration of three replicates. Mean recovery (%) = 100 × (Cmeanfound /Cadded ). Relative standard deviation of three determinations.
For comparison, a commercial kit based on quantitative realtime PCR (qRT-PCR), a standard miRNA detection method, was used to detect a series of miR-21 (as shown in Fig. S3) in human serum samples together with the proposed sensor (as shown in Table 2). Herein, 10% human serums were diluted with 20 mM Tris–HCl buffer and injected with the miR-21 at three different concentrations (0.6 nM, 0.8 nM and 1 nM) prior to measuring. The result is presented in (Table 2), it can be seen clearly that our sensing system exhibits the acceptable recovery rates of standard addition from 101% to 110% compared with qRT-PCR, demonstrating that this proposed sensor has substantial potential in clinical diagnosis of cancers. 4. Conclusion
Fig. 4. Specificity of miRNA assay. Variance of fluorescence intensity in response to the miR-21, M1 (single-base mismatched), M2 (two-bases mismatched), M3 (threebases mismatched), M4 (four-bases mismatched), M5 (five-bases mismatched). Experimental conditions: HP1 100 nM, HP2 100 nM, incubation time 2 h, circular probe 100 nM, ThT 10 M, and RCA time 40 min. The error bars represent the standard deviations of three independent experiments.
3.5. Selectivity of the circulating miRNAs detection system A great challenge for an excellent miRNA assay is its ability to distinguish the miRNA family members with high sequence homology (1 or 2 nucleotide difference). Thus, we performed a series of contrast experiments using five kinds of miRNA, including perfectly matched miR-21, single-base mismatched miR-21 (M1), two-bases mismatched miR-21 (M2), three-bases mismatched miR-21 (M3), four-bases mismatched miR-21 (M4) and five-bases mismatched miR-21 (M5). The results were displayed in (Fig. 4). Judging from the histogram (Fig. 4), we can see the fluorescent value F–F0 (F0 is the fluorescent intensity of blank sample) for M1, M2, M3, M4, and M5 was only about 10.2%, 0.5%, −0.5%, −2% and −4.4% comparing to the perfectly matched miR-21, respectively. We further tested the specificity of the proposed method (Fig. S1). The miRNA has the same base pair with miR-21 but is longer, such as with 1, 2, or 3 additional base pairs. These results demonstrate the sensing system has the capability to significantly discriminate perfectly matched miRNA target from mismatched or longer miRNAs, even sing-base mismatched or miRNA with 1 additional base compared to miR-21, suggesting the high specificity of the sensing system for c-miRNA assay. 3.6. Application in real sample In order to identify whether the proposed method can be applied to quantitative detection of miRNAs of interest in complex biological samples, we further tested the proposed method in human breast cancer cell line (MCF-7) and breast cancer tissues. The results (as shown in Fig. S2) indicate that our miRNA detection method can detect miRNAs in cancer cells and tumor tissues.
In summary, we have developed a simple, rapid, facile, highly sensitive and selective biosensor for amplified detection of circulating miRNAs by catalyzed hairpin assembly coupled with rolling circle amplification using ThT as a signal indicator. The biosensing system possessed four excellent advantages. Firstly, the assay does not need any chemical modification and sophisticated instrumentation, which makes it simple and cost-effective. Secondly, this sensing system has an excellent capability to discriminate singlebase mismatched miRNA. Thirdly, the newly developed sensing system exhibits highly sensitivity toward target miRNA with a detection limit of 10 pM using a dual amplification strategy. Finally, This system has a good detection performance in real biological samples. With the demonstration of this label-free and dual amplified approach for circulating miR-21 detection in this study, it can be further expanded for detecting more nucleic acid biomarkers with this sensing system. Given the high-performance for miR-21 analysis, this sensing system has great potential to be applied in biochemical research and clinical diagnosis. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 21402105), and ShenZhen municipal government SZSITIC (CXB201104210013). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.snb.2017.04.079. References [1] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2009) 215–233. [2] R.C. Friedman, K.K. Farh, C.B. Burge, D.P. Bartel, Most mammalian mRNAs are conserved targets of microRNAs, Genome Res. 19 (2009) 92–105. [3] M.V. Iorio, C.M. Croce, MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review, EMBO Mol. Med. 4 (2012) 143–159.
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7 [4] X. Wu, Y. Chai, R. Yuan, Y. Zhuo, Y. Chen, Dual signal amplification strategy for enzyme-free electrochemical detection of microRNAs, Sens. Actuators B 203 (2014) 296–302. [5] S. Lin, R.I. Gregory, MicroRNA biogenesis pathways in cancer, Nat. Rev. Cancer 15 (2015) 321–333. [6] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674. [7] Y. He, J. Lin, D. Kong, M. Huang, C. Xu, T.K. Kim, et al., Current state of circulating MicroRNAs as cancer biomarkers, Clin. Chem. 61 (2015) 1138–1155. [8] M. Azimzadeh, M. Rahaie, N. Nasirizadeh, K. Ashtari, H. Naderi-Manesh, An electrochemical nanobiosensor for plasma miRNA-155, based on graphene oxide and gold nanorod, for early detection of breast cancer, Biosens. Bioelectron. 77 (2016) 99–106. [9] C.Y. Hong, X. Chen, J. Li, J.H. Chen, G. Chen, H.H. Yang, Direct detection of circulating microRNAs in serum of cancer patients by coupling protein-facilitated specific enrichment and rolling circle amplification, Chem. Commun. (Camb.) 50 (2014) 3292–3295. [10] A. Valoczi, C. Hornyik, N. Varga, J. Burgyan, S. Kauppinen, Z. Havelda, Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes, Nucleic Acids Res. 32 (2004) e175. [11] W. Li, K. Ruan, MicroRNA detection by microarray, Anal. Bioanal. Chem. 394 (2009) 1117–1124. [12] Z. Hu, J. Dong, L.E. Wang, H. Ma, J. Liu, Y. Zhao, et al., Serum microRNA profiling and breast cancer risk: the use of miR-484/191 as endogenous controls, Carcinogenesis 33 (2012) 828–834. [13] J. Yan, N. Zhang, C. Qi, X. Liu, D. Shangguan, One-step real time RT-PCR for detection of microRNAs, Talanta 110 (2013) 190–195. [14] B.C. Yin, Y.Q. Liu, B.C. Ye, One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification, J. Am. Chem. Soc. 134 (2012) 5064–5067. [15] L. Liu, Y. Gao, H. Liu, N. Xia, An ultrasensitive electrochemical miRNAs sensor based on miRNAs-initiated cleavage of DNA by duplex-specific nuclease and signal amplification of enzyme plus redox cycling reaction, Sens. Actuators B 208 (2015) 137–142. [16] Z. Gao, Y. Yu, A microRNA biosensor based on direct chemical ligation and electrochemically amplified detection, Sens. Actuators B 121 (2007) 552–559. [17] H.S. Yin, Y.L. Zhou, B.C. Li, X. Li, Z.Q. Yang, S.Y. Ai, et al., Photoelectrochemical immunosensor for microRNA detection based on gold nanoparticles-functionalized g-C3N4 and anti-DNA: RNA antibody, Sens. Actuators B–Chem. 222 (2016) 1119–1126. [18] J. Wan, X. Liu, Y. Zhang, Q. Gao, H. Qi, C. Zhang, Sensitive impedimetric detection of microRNAs using a hairpin probe based on DNAzyme-functionalized gold nanoparticle tag-initiated deposition of an insulating film on gold electrode, Sens. Actuators B 213 (2015) 409–416. [19] Q. Wang, R.J. Liu, X.H. Yang, K.M. Wang, J.Q. Zhu, L.L. He, et al., Surface plasmon resonance biosensor for enzyme-free amplified microRNA detection based on gold nanoparticles and DNA supersandwich, Sens. Actuators B–Chem. 223 (2016) 613–620. [20] H. Li, J. Xu, Z. Wang, Z.S. Wu, L. Jia, Increasingly branched rolling circle amplification for the cancer gene detection, Biosens. Bioelectron. 86 (2016) 1067–1073. [21] K. Zhang, K. Wang, X. Zhu, M. Xie, A one-pot strategy for the sensitive detection of miRNA by catalyst–oligomer-mediated enzymatic amplification-based fluorescence biosensor, Sens. Actuators B 223 (2016) 586–590. [22] M.M. Ali, F. Li, Z. Zhang, K. Zhang, D.K. Kang, J.A. Ankrum, et al., Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine, Chem. Soc. Rev. 43 (2014) 3324–3341. [23] C. Hong, A. Baek, S.S. Hah, W. Jung, D.E. Kim, Fluorometric detection of MicroRNA using isothermal gene amplification and graphene oxide, Anal. Chem. 88 (2016) 2999–3003. [24] G.D. Hamblin, K.M. Carneiro, J.F. Fakhoury, K.E. Bujold, H.F. Sleiman, Rolling circle amplification-templated DNA nanotubes show increased stability and cell penetration ability, J. Am. Chem. Soc. 134 (2012) 2888–2891. [25] Y. Mao, M. Liu, K. Tram, J. Gu, B.J. Salena, Y. Jiang, et al., Optimal DNA templates for rolling circle amplification revealed by in vitro selection, Chemistry 21 (2015) 8069–8074. [26] J. Wen, W. Li, J. Li, B. Tao, Y. Xu, H. Li, et al., Study on rolling circle amplification of Ebola virus and fluorescence detection based on graphene oxide, Sens. Actuators B 227 (2016) 655–659. [27] H. Chen, S. Wu, F. Dong, W. Cheng, Q. Li, S. Ding, et al., A novel chemiluminescence immunoassay for highly sensitive and specific detection of protein using rolling circle amplification and the multiplex binding system, Sens. Actuators B 221 (2015) 328–333.
7
[28] Z. Deng, Y. Tian, S.H. Lee, A.E. Ribbe, C. Mao, DNA-encoded self-assembly of gold nanoparticles into one-dimensional arrays, Angew. Chem. Int. Ed. Engl. 44 (2005) 3582–3585. [29] P. Yin, H.M. Choi, C.R. Calvert, N.A. Pierce, Programming biomolecular self-assembly pathways, Nature 451 (2008) 318–322. [30] B. Li, Y. Jiang, X. Chen, A.D. Ellington, Probing spatial organization of DNA strands using enzyme-free hairpin assembly circuits, J. Am. Chem. Soc. 134 (2012) 13918–13921. [31] K.W. Lim, S. Amrane, S. Bouaziz, W. Xu, Y. Mu, D.J. Patel, et al., Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers, J. Am. Chem. Soc. 131 (2009) 4301–4309. [32] Z. Zhang, J. Dai, E. Veliath, R.A. Jones, D. Yang, Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures, Nucleic Acids Res. 38 (2009) 1009–1021. [33] A.C. Bhasikuttan, J. Mohanty, H. Pal, Interaction of malachite green with guanine-rich single-stranded DNA: preferential binding to a G-quadruplex, Angew. Chem. Int. Ed. Engl. 46 (2007) 9305–9307. [34] V. Dhamodharan, S. Harikrishna, C. Jagadeeswaran, K. Halder, P.I. Pradeepkumar, Selective G-quadruplex DNA stabilizing agents based on bisquinolinium and bispyridinium derivatives of 1,8-naphthyridine, J. Org. Chem. 77 (2012) 229–242. [35] J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, P.I. Pradeepkumar, A.C. Bhasikuttan, Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA, J. Am. Chem. Soc. 135 (2013) 367–376. [36] B. Li, A.D. Ellington, X. Chen, Rational, modular adaptation of enzyme-free DNA circuits to multiple detection methods, Nucleic Acids Res. 39 (2011) e110. [37] X. Tan, Y. Wang, B.A. Armitage, M.P. Bruchez, Label-free molecular beacons for biomolecular detection, Anal. Chem. 86 (2014) 10864–10869. [38] L.L. Tong, L. Li, Z. Chen, Q. Wang, B. Tang, Stable label-free fluorescent sensing of biothiols based on ThT direct inducing conformation-specific G-quadruplex, Biosens. Bioelectron. 49 (2013) 420–425. [39] H. Wang, P. Peng, S. Liu, T. Li, Thioflavin T behaves as an efficient fluorescent ligand for label-free ATP aptasensor, Anal. Bioanal. Chem. 408 (2016) 7927–7934.
Biographies Tingting Fan received her B.S. degree from college of life science, Henan Normal University in 2015, and now she is pursuing for M.S. degree in department of chemistry, Tsinghua University. Her main research interests are in design and application of biosensors and fluorescent chemosensor for the detection of various biomolecules. Yu Mao received her B.S. degree from University of Science & Technology Beijing in 2011. She is currently pursuing for Ph.D. degree in school of chemical biology and biotechnology, Peking University. Her main research focuses on expanding utility of functional DNA molecules for biosensing applications. Feng Liu received his Ph.D. degree from Tsinghua University in 2011, and now he is a lecturer in Tsinghua University. His research interests focused on molecular recognition and signaling pathways in cancers. Wei Zhang received her M.S. degree from China Medical University in 2012. She is currently pursuing for Ph.D. degree in school of medicine, Tsinghua University. Her research interests focus on tumor therapy. Jingxian Yin received her B.S. degree from Jilin University in 2016. She is currently pursuing for M.S. degree in department of chemistry, Tsinghua University. Her research interests focus on the design and application of self-assembling of DNA. Yuyang Jiang received his Ph.D. degree in microbiology from Shenyang Institute of Applied Ecology, Chinese Academy of Sciences (CAS) in 1996. Presently, he worked as professor in Tsinghua University. His research scope covers biosensors, fluorescent chemosensors, organic synthesis, drug discovery, metabonomics, and signaling pathways in cancers.
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Dual signal amplification strategy for specific detection of Circulating microRNAs based on Thioflavin T Tingting Fan a,b,1 , Yu Mao b,c,1 , Feng Liu b , Wei Zhang b , Jingxian Yin a,b , Yuyang Jiang a,b,∗ a
Department of Chemistry, Tsinghua University, Beijing, 100084, China The Ministry-Province Jointly Constructed Base for State Key Lab-Shenzhen Key Laboratory of Chemical Biology, The Graduate School at Shenzhen, Tsinghua University, Shenzhen 518055, China c Laboratory of Chemical Genomics, School of Chemical Biology and Biotechnology, Peking University Shenzhen Graduate School, Shenzhen 518055, China b
a r t i c l e
i n f o
Article history: Received 16 December 2016 Received in revised form 1 April 2017 Accepted 12 April 2017 Available online 13 April 2017 Keywords: Dual signal amplification Circulating microRNAs Thioflavin T CHA-RCA Target recycling
a b s t r a c t Circulating microRNAs (c-miRNAs) are emerging as new non-invasive biomarkers for human cancers diagnosis and prognosis. Herein, in this study, an ideal biosensing system with highly sensitivity and excellent selectivity for rapid and facile detection of c-miRNAs has been developed. The sensing system mainly consists of two unlabeled hairpin probes (HP1 and HP2) and a circular probe. Upon binding with the target miRNA, HP1 is opened, which serves as a toehold to hybridize with HP2. Since HP1-HP2 duplex is more stable than HP1-miRNA duplex, the target miRNA can be displaced from HP1, and again binds with a new HP1 to initiate another reaction cycle. Moreover, the newly formed HP1-HP2 duplex can be further used as a primer to initiate rolling circle amplification (RCA) with the circular probe, producing extremely long single-stranded DNA molecules with repetitive sequence units which can form into a large number of G-quadruplexes. These G-quadruplexes can bind with ThT, resulting in a significantly enhanced fluorescent signal. This newly developed sensing system has great potential to be applied in biochemical research and clinical diagnosis based on the high-performance of circulating miR-21 detection in this study. © 2017 Published by Elsevier B.V.
1. Introduction microRNAs (miRNAs) are a class of short (18–24 nt), endogenous, non-coding RNA molecules that regulate the expression of over 60% target genes through sequence-specific hybridization to the 3 untranslated region (UTR) of messenger RNAs [1,2]. It has been demonstrated that miRNAs are involved in various biological processes, such as cell proliferation, differentiation, stress resistance, and cell death [3–5]. There is now compelling evidence that miRNAs regulate all aspects of the so-called “hallmarks of cancer” that enable tumor growth and metastatic dissemination [6]. Recently the discovery of circulating microRNAs (c-miRNAs) in cancer patients holds great promise for the use of miRNAs as distinctive, non-invasive cancer biomarkers [7]. c-miRNAs are a group of miRNAs, which can be readily detected in plasma [8], serum or whole blood [9]. Despite some interesting and exciting findings, the
∗ Corresponding author at: Department of Chemistry, Tsinghua University, Beijing, 100084, China. Tel./fax: +86 755 2603 2094. E-mail address: [email protected] (Y. Jiang). 1 The two authors contributed equally to the work. http://dx.doi.org/10.1016/j.snb.2017.04.079 0925-4005/© 2017 Published by Elsevier B.V.
field of c-miRNAs has been hindered by measurement-associated inconsistency and irreproducibility. Several traditional methods have been utilized for miRNAs detection, including northern blotting [10], microarrays [11], and real-time PCR (Q-PCR) [12,13]. However, these miRNAs detection techniques have irreparable limitations, such as low sensitivity, low selectivity, and labor-intensive steps. The unique characteristics of miRNAs, including their short length, low abundance, and sequence homology among the miRNAs family, also make them difficult to analyze [14]. In order to improve the sensitivity, specificity, and simplicity of miRNAs assay, a variety of new strategies have been developed, such as electrochemical sensors [15,16], immunosensors [17], nanopore sensors [18,19], and sequence-based amplification [20,21]. Among these methods, rolling circle amplification (RCA) has attracted much attention in miRNAs detection due to its sensitivity, good specificity and simplicity [22,23]. Rolling circle amplification (RCA) is an isothermal enzymatic process where a short DNA/RNA primer is amplified to form a long single stranded DNA/RNA using a circular DNA template and special DNA/RNA polymerases. The RCA product is a concatemer containing tens to hundreds of tandem repeats that are complementary to the circular template [24,25]. The power, simplicity, and versatility
2
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Table 1 Sequences of the oligonucleotides used in this study.a Oligonucleotides
Sequence (from 5 to 3 )
Hairpin Probe1 (HP1) Hairpin Probe2 (HP2) Circular Probe (CP) microRNA21 (miR-21) Single-base mismatched miR-21 (M1) Two-bases mismatched miR-21 (M2) Three-bases mismatched miR-21 (M3) Four-bases mismatched miR-21 (M4) Five-bases mismatched miR-21 (M5) miR-21 with one additional base (A1) miR-21 with two additional bases (A2) miR-21 with three additional bases (A3)
TCAACATCAGTCTGATAAGCTACGATGTGTAGATAGCTTATCAGACT TAAGCTATCTACACATGGTAGCTTATCAGACTCCATGTGTAGAGGT TACACAATCTCGACTAGTCAGACCCTAACCCTAACCCTAACCCTACAACATGTCTTTGATACCTC UAGCU UAUCA GACUG AUGUU GA UAGCU UAUCA GACCG AUGUU GA UAGCA UAUCA GACCG AUGUU GA UAGCA AAUCA GACCG AUGUU GA AAGCA AAUCA GACCG AUGUU GA AAGCA AAUCA GACCG AUGUC GA TUAGC UUAUC AGACU GAUGU UGA TTUAG CUUAU CAGAC UGAUG UUGA GTTUA GCUUA UCAGA CUGAU GUUGA
a In HP1 and HP2, the underlined letters indicate the sequences complementary to each other to form the stems of the hairpin probes, respectively. In HP1, the boldface letters indicate the sequences complementary to the target miRNA (miR-21). In HP2, the boldface letters indicate the sequences complementary to HP1. In CP, the boldface letters indicate the sequences complementary to HP2, and the underlined letters indicate the sequences to form a G-quadruplex, which can bind with ThT and light up fluorescent signal. In M1, M2, M3, M4, M5, the underlined-boldface letters indicate the mutation sites of miR-21. In A1, A2, A3, the letters shown in bold italics indicate the additional bases of miR-21.
Scheme 1. Schematic illustration of dual signal amplification strategy for specific detection of circulating microRNAs based on Thioflavin T. (For interpretation of the references to color in the text, the reader is referred to the web version of this article.)
of the nucleic acid amplification technique have made it an attractive tool for biomedical research [26,27] and nanobiotechnology [28]. Recently, target catalyzed hairpin assembly (CHA) was developed for DNA nanostructure organization and also as a promising signal amplification strategy for DNA detection on account of its significant advantages such as simple, cost-effective, isothermal and high sensitive [29,30]. Therefore, we examined the combination of these two amplification strategies (CHA-RCA) to detect c-miRNAs. G-quadruplexes can be formed from guanine-rich DNA and RNA sequences, usually effectively induced by Na+/K+ [31,32], small molecules, or certain cationic dyes [33,34]. Recently, Mohanty et al. [35] reported for the first time that water-soluble Thioflavin T (ThT) was a G-quadruplex specific fluorescent indicator among other DNA forms including single-strand, duplexes or triplexes. What’s more, it has a weakly fluorescence by itself, while exhibit great fluorescence enhancement upon binding with G-quadruplex DNA structure under physiological salt conditions. The special structural selectivity of ThT for G-quadruplexes may improve the specificity of sensing. Spurred on by all the above findings, herein, for the first time, we have developed a simple, specific and label-free biosensing sys-
tem that ingeniously combines CHA and RCA for rapid and facile detection of c-miRNAs. The dual signal amplification strategy not only improves the sensitivity of the biosensing system but also provides a new way for c-miRNAs detection. As proof of concept, the detection of miR-21 is demonstrated in this study. The assay does not involve any chemical modification, which is simple and cost-effective. With the significant dual signal amplifications, the detection limit of the newly developed sensing system is lower than previous reported ThT-based methods. Importantly, the sensing system offers high selectivity for the determination between perfectly matched miRNA and single-base mismatched miRNA. Moreover, this sensing system has a good detection performance in real biological samples, which holding a great potential for further applications in the clinical diagnosis of cancers. 2. Experiments 2.1. Chemicals and reagents All of the chemicals and reagents used in this study were analytical grade and used without further purification. The
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
3
ride (MgCl2 ), 40% Acrylamide/bis-acrylamide (29:1) mixture, Tris base, N,N,N,N -tetramethyl-ethylenediamine (TEMED), Boric acid, and Ammonium persulfate (APS) were purchased from Sangon Biotech Co., Ltd (Shanghai, China). The human serum samples were obtained from Peking University Shenzhen Hospital (Shenzhen, China). The oligonucleotides were synthesized by Invitrogen Biotechnology Co.,Ltd (Shanghai, China) and their sequences are shown in (Table 1). The stock solution of HP1 and HP2 were prepared by dissolving the lyophilized powder in 20 mM Tris-HCl buffer (100 mM NaCl, 5 mM MgCl2 , pH 7.4). The HP1 and HP2 solution were heated to 95 ◦ C for 5 min and then allowed to cool down to room temperature to form designed hairpin structure before use. All of the pipette tips and centrifuge tubes were treated with Diethylpyrocarbonate (DEPC) and autoclaved to protect miRNAs from RNase degradation. 2.2. Apparatus All fluorescence measurements were carried out in a 96-well assay plate (Costar, Washington, DC, USA) using a microplate reader (Tecan infinite M1000 Pro, Männedorf, Switzerland) under room temperature. The excitation wavelength of the solution was set at 425 nm, and the emission spectra were collected from 450 to 600 nm with a step of 2 nm. The maximum emission observed at 485 nm, which was used to determine the fluorescence intensity. Gel electrophoresis images were obtained on a Molecular Imager Pharos FXTM Plus system (Bio-Rad, Hercules, CA, USA). 2.3. Procedure of circulating miRNAs assay The experiments were carried out in 20 L of solution containing 2 L of HP1 (1 M), 2 L of HP2 (1 M), 0.5 L RNase inhibitor (40 U/L), 2 L Tris-HCl buffer (200 mM), 10 L of target miRNA (varying concentrations), and 3.5 L of RNase-free water, followed by incubating at 37 ◦ C for 2 h. Subsequently, 5 L of dNTPs (10 mM), 0.5 L phi29 DNA polymerase (10 U/L), 10 L of circular probe (1 M), 10 L of ThT (100 M), 10 L of RCA buffer (10×) and 44.5 L of ddH2 O were added into the above solution to yield a total volume of 100 L and incubated at 37 ◦ C for 40 min. After incubation, the resulting samples were used for fluorescence measurements. 3. Results and discussion 3.1. The principle of dual signal amplification strategy for circulating miRNA detection
Fig. 1. (A) A 20% native PAGE for the detection of catalyzed hairpin assembly (CHA). M is a DNA marker, lane (1) miR-21, (2) HP1, (3) HP2, (4) miR–21 + HP1, (5) miR–21 + HP2, (6) HP1 + HP2, (7) miR–21 + HP1 + HP2, respectively. (B) A 0.5% agarose gel for the detection of amplified products by catalyzed hairpin assembly coupled with rolling circle amplification (CHA-RCA). M is a DNA marker, lanes (1) and (2) are CHA-RCA products in the absence and presence of miR-21, respectively.
phi29 DNA polymerase and deoxynucleotide solution mixture (dNTPs) were purchased from New England Biolabs (NEB, Beijing, China). RNase-free water, RNase inhibitor, DNA markers (20 bp and 15,000 bp) and 6 × Loading buffer were purchased from TaKaRa Biotechnology Co., Ltd (Shiga, Japan). Thioflavin T (ThT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Agarose was purchased from Invitrogen Biotechnology Co., Ltd (Carlsbad, CA, USA). Sodium chloride (NaCl), Magnesium chlo-
The new label-free sensing system for amplified detection of c-miRNA is illustrated in (Scheme 1). The sensing system mainly consists of two unlabeled hairpin probes (HP1 and HP2) and a circular probe. HP1 has the recognition domain for the target miRNA, HP2 contains two domains, domain I (dark blue) is complementary to HP1, and domain II (red) is complementary to circular probe. The circular probe is functionalized with the complimentary sequence of G-quadruplex at its medium position. In the absence of the target miRNA, the two hairpin probes (HP1 and HP2) can coexist in solution and keep their stable hairpin conformation, which provides a low background for the sensing system. Conversely, in the presence of the target miRNA, upon the interaction of HP1 with the target miRNA, HP1 is opened, resulting in the exposure of whole sequence. The exposed sequence serves as a toehold to hybridize with HP2, since HP1-HP2 duplex is more stable than HP1-miRNA duplex, the target miRNA can be displaced from HP1 by HP2 through a process similar to DNA branch migration [36]. The displaced target miRNA again binds with a new HP1 to initiate the target recycling amplification cycle. As a result, each copy of target miRNA
4
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Fig. 2. (A) Optimization of hairpin probes (HP1 and HP2) concentration. (B) Optimization of incubation time (CHA time). (C) Optimization of circular probe concentration. (D) Optimization of rolling circle amplification time (RCA time). (E) Optimization of ThT concentration. The error bars represent the standard deviations of three independent experiments.
can trigger numerous assembly processes between HP1 and HP2. Moreover, the newly formed HP1-HP2 duplex can be further used as a primer to initiate rolling circle amplification (RCA) with the circular probe, generating a large number of G-quadruplex structures. As mentioned above, ThT is a water-soluble fluorogenic dye characterized by a pronounced structural selectivity for G-quadruplexes but not for single, double or triplexes stranded DNA. Thus, these
G-quadruplexes can bind with ThT, which lead to significantly enhance the fluorescent signal. Using this sensing platform of catalyzed hairpin assembly coupled with rolling circle amplification (CHA-RCA) and Thioflavin T as a signal indicator, an ultra-highly selective, sensitive, simple and rapid sensor for the amplified detection of c-miRNAs has been developed.
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
5
Fig. 3. (A) Typical fluorescence emission spectra upon addition of miR-21 (0, 0.1 nM, 0.2 nM, 0.4 nM, 0.6 nM, 0.8 nM, 1 nM, 1.5 nM, 2 nM, 2.5 nM). (B) The calibration curve between the miR-21 concentrations and fluorescence intensity. Experimental conditions: HP1 100 nM, HP2 100 nM, incubation time 2 h, circular probe 100 nM, ThT 10 M, and RCA time 40 min. The error bars show the standard deviation of three replicate determinations.
3.2. Investigation of the feasibility of the detection method Since the c-miRNAs detection based on CHA-RCA and ThT is a novel method reported for the first time in the present study, the feasibility for catalyzed hairpin assembly coupled with rolling circle amplification were verified at the initial stage, and the results were exhibited in (Fig. 1). 20% native-PAGE were performed to evaluate catalyzed hairpin assembly, as presented in (Fig. 1A). Lane 1, 2, 3, indicate the positions of miR-21, HP1 and HP2, respectively. When HP1 was mixed with target miR-21, a new clearly band appears as shown in line 4, indicating the formation of miR-21-HP1 duplexes. Lane 5 demonstrates no interaction between target miR-21 and HP2. Strikingly, as shown in lane 7, the coexistence of target miR-21, HP1and HP2 in the sensing system, there appears a very bright new band in the top of the lane 7 with high molecular weight, and the band of target miR-21 doesn’t disappear. In contrast, when the system has no target miR-21, there is not any band at the top position with high molecular weight (lane 6), confirming that the process of CHA is directly associated with target miR-21 hybridization. These results indicate the feasibility of target recycling using catalyzed hairpin assembly. Additional evidence for the CHA-RCA was obtained by 0.5% agarose gel electrophoresis. As shown in (Fig. 1B) miR-21 successfully triggered the CHA-RCA reaction to give a very bright band in agarose gel (lane 2). Conversely, there was only a shadow band without target miR-21 (lane 1). These facts were consistent with the proposed mechanism shown in (Scheme 1), and strongly indicate that the dual signal amplification strategy is efficient for amplified detection of target miRNA. 3.3. Optimization of detection conditions According to the principle of circulating miRNAs detection, experimental conditions such as the amount of hairpin probes, the concentration of circular probe, the amount of ThT, CHA incubation time and RCA time have a great effect on the sensitivity of the detection system. Hence, a series of systematic optimization experiments were carried out to obtain the optimal assay conditions. As shown in (Fig. 2), where F and F0 are the fluorescence intensity (ex = 425 nm, em = 485 nm) in the presence and in the absence of target miRNA, respectively. Firstly, optimization of the hairpin probes (HP1 and HP2) concentration (10–1000 nM range) was carried out. As shown in (Fig. 2A), the best signal was obtained when100 nM of each hairpin probes (HP1 and HP2) was
used. Next, we optimized the concentration of the CHA incubation time (0.5–2.5 h range). As shown in (Fig. 2B), the F/F0 reached a maximum value at 2 h, thus, subsequent work employed 2 h of incubation time. We further optimized the concentration of the circular probe (20–400 nM). The experimental results in (Fig. 2C) showed that 100 nM performed better than the other concentrations, thus, 100 nM circular probe was used for the following experiments. In this assay, the RCA time is another important factor that can significantly affect the performance of the sensing system. As shown in (Fig. 2D), the value of F/F0 raised distinctly from 10 to 40 min, and reached a plateau after 40 min. So the RCA time of 40 min was selected for the following experiments. Finally, we investigated the concentration of ThT (0.1–100 M range). The results in (Fig. 2E) demonstrated that 10 M is the optimal concentrations for ThT.
3.4. Sensitivity for circulating miRNAs detection system Under the optimal conditions, we investigated the sensitivity of the proposed method upon addition of different concentrations of miR-21. As shown in (Fig. 3A), a dramatic increase in the fluorescence emission spectrum was observed with the increasing miR-21 concentrations from 0 to 1.5 nM, and reached a plateau after 1.5 nM. The value of fluorescence intensity has a linear correlation with the concentration of miR-21 over the range from 0 to 1 nM (Fig. 3B). The regression equation is Y = 41.031 + 88.382C with a correlation coefficient of 0.994, where Y is the value of fluorescence intensity, C is the concentration of miR-21. The limit of detection is estimated to be 10 pM on the basis of 3/k (Eq. (S1)). Compared with the reported miRNA detection biosensors (Table S3), the detection limit and linear range of our work is comparable to or even better than that of the previous works. More importantly, compared with the works previously reported using Thioflavin T as a fluorescent indicator for biosensor fabrication by Tan et al. [37] (the LOD of DNA detection = 6.5 nM, the LOD of RNA detection = 5.7 nM, the LOD of protein detection = 13 nM), Tong et al. [38] (the LOD of cysteine detection = 8.4 nM, the LOD of glutathione detection = 13.9 nM), Wang et al. [39] (the LOD of ATP detection = 5 M), our sensor has much higher sensitivity. This can be attributed to the target recycling by catalyzed hairpin assembly (Scheme S1) and the extremely high amplification efficiency of RCA. The result suggests that the sensor has excellent sensitivity for target c-miRNAs.
6
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7
Table 2 Detection of miR-21 in human serum samples compared with qRT-PCR. CHA-RCA assay
qRT-PCR assay
Sample
Added/ (nM)
Mean founda /(nM)
Mean Recoveryb (%)
RSDc
Added/ (nM)
Mean found/(nM)
Mean Recovery (%)
RSD
1 2 3
0.60 0.80 1.00
0.66 0.82 1.01
110 102 101
0.28 0.50 0.65
0.60 0.80 1.00
0.90 0.94 1.08
150 117 108
0.21 0.20 0.23
a b c
Mean concentration of three replicates. Mean recovery (%) = 100 × (Cmeanfound /Cadded ). Relative standard deviation of three determinations.
For comparison, a commercial kit based on quantitative realtime PCR (qRT-PCR), a standard miRNA detection method, was used to detect a series of miR-21 (as shown in Fig. S3) in human serum samples together with the proposed sensor (as shown in Table 2). Herein, 10% human serums were diluted with 20 mM Tris–HCl buffer and injected with the miR-21 at three different concentrations (0.6 nM, 0.8 nM and 1 nM) prior to measuring. The result is presented in (Table 2), it can be seen clearly that our sensing system exhibits the acceptable recovery rates of standard addition from 101% to 110% compared with qRT-PCR, demonstrating that this proposed sensor has substantial potential in clinical diagnosis of cancers. 4. Conclusion
Fig. 4. Specificity of miRNA assay. Variance of fluorescence intensity in response to the miR-21, M1 (single-base mismatched), M2 (two-bases mismatched), M3 (threebases mismatched), M4 (four-bases mismatched), M5 (five-bases mismatched). Experimental conditions: HP1 100 nM, HP2 100 nM, incubation time 2 h, circular probe 100 nM, ThT 10 M, and RCA time 40 min. The error bars represent the standard deviations of three independent experiments.
3.5. Selectivity of the circulating miRNAs detection system A great challenge for an excellent miRNA assay is its ability to distinguish the miRNA family members with high sequence homology (1 or 2 nucleotide difference). Thus, we performed a series of contrast experiments using five kinds of miRNA, including perfectly matched miR-21, single-base mismatched miR-21 (M1), two-bases mismatched miR-21 (M2), three-bases mismatched miR-21 (M3), four-bases mismatched miR-21 (M4) and five-bases mismatched miR-21 (M5). The results were displayed in (Fig. 4). Judging from the histogram (Fig. 4), we can see the fluorescent value F–F0 (F0 is the fluorescent intensity of blank sample) for M1, M2, M3, M4, and M5 was only about 10.2%, 0.5%, −0.5%, −2% and −4.4% comparing to the perfectly matched miR-21, respectively. We further tested the specificity of the proposed method (Fig. S1). The miRNA has the same base pair with miR-21 but is longer, such as with 1, 2, or 3 additional base pairs. These results demonstrate the sensing system has the capability to significantly discriminate perfectly matched miRNA target from mismatched or longer miRNAs, even sing-base mismatched or miRNA with 1 additional base compared to miR-21, suggesting the high specificity of the sensing system for c-miRNA assay. 3.6. Application in real sample In order to identify whether the proposed method can be applied to quantitative detection of miRNAs of interest in complex biological samples, we further tested the proposed method in human breast cancer cell line (MCF-7) and breast cancer tissues. The results (as shown in Fig. S2) indicate that our miRNA detection method can detect miRNAs in cancer cells and tumor tissues.
In summary, we have developed a simple, rapid, facile, highly sensitive and selective biosensor for amplified detection of circulating miRNAs by catalyzed hairpin assembly coupled with rolling circle amplification using ThT as a signal indicator. The biosensing system possessed four excellent advantages. Firstly, the assay does not need any chemical modification and sophisticated instrumentation, which makes it simple and cost-effective. Secondly, this sensing system has an excellent capability to discriminate singlebase mismatched miRNA. Thirdly, the newly developed sensing system exhibits highly sensitivity toward target miRNA with a detection limit of 10 pM using a dual amplification strategy. Finally, This system has a good detection performance in real biological samples. With the demonstration of this label-free and dual amplified approach for circulating miR-21 detection in this study, it can be further expanded for detecting more nucleic acid biomarkers with this sensing system. Given the high-performance for miR-21 analysis, this sensing system has great potential to be applied in biochemical research and clinical diagnosis. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 21402105), and ShenZhen municipal government SZSITIC (CXB201104210013). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.snb.2017.04.079. References [1] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2009) 215–233. [2] R.C. Friedman, K.K. Farh, C.B. Burge, D.P. Bartel, Most mammalian mRNAs are conserved targets of microRNAs, Genome Res. 19 (2009) 92–105. [3] M.V. Iorio, C.M. Croce, MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review, EMBO Mol. Med. 4 (2012) 143–159.
T. Fan et al. / Sensors and Actuators B 249 (2017) 1–7 [4] X. Wu, Y. Chai, R. Yuan, Y. Zhuo, Y. Chen, Dual signal amplification strategy for enzyme-free electrochemical detection of microRNAs, Sens. Actuators B 203 (2014) 296–302. [5] S. Lin, R.I. Gregory, MicroRNA biogenesis pathways in cancer, Nat. Rev. Cancer 15 (2015) 321–333. [6] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674. [7] Y. He, J. Lin, D. Kong, M. Huang, C. Xu, T.K. Kim, et al., Current state of circulating MicroRNAs as cancer biomarkers, Clin. Chem. 61 (2015) 1138–1155. [8] M. Azimzadeh, M. Rahaie, N. Nasirizadeh, K. Ashtari, H. Naderi-Manesh, An electrochemical nanobiosensor for plasma miRNA-155, based on graphene oxide and gold nanorod, for early detection of breast cancer, Biosens. Bioelectron. 77 (2016) 99–106. [9] C.Y. Hong, X. Chen, J. Li, J.H. Chen, G. Chen, H.H. Yang, Direct detection of circulating microRNAs in serum of cancer patients by coupling protein-facilitated specific enrichment and rolling circle amplification, Chem. Commun. (Camb.) 50 (2014) 3292–3295. [10] A. Valoczi, C. Hornyik, N. Varga, J. Burgyan, S. Kauppinen, Z. Havelda, Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes, Nucleic Acids Res. 32 (2004) e175. [11] W. Li, K. Ruan, MicroRNA detection by microarray, Anal. Bioanal. Chem. 394 (2009) 1117–1124. [12] Z. Hu, J. Dong, L.E. Wang, H. Ma, J. Liu, Y. Zhao, et al., Serum microRNA profiling and breast cancer risk: the use of miR-484/191 as endogenous controls, Carcinogenesis 33 (2012) 828–834. [13] J. Yan, N. Zhang, C. Qi, X. Liu, D. Shangguan, One-step real time RT-PCR for detection of microRNAs, Talanta 110 (2013) 190–195. [14] B.C. Yin, Y.Q. Liu, B.C. Ye, One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification, J. Am. Chem. Soc. 134 (2012) 5064–5067. [15] L. Liu, Y. Gao, H. Liu, N. Xia, An ultrasensitive electrochemical miRNAs sensor based on miRNAs-initiated cleavage of DNA by duplex-specific nuclease and signal amplification of enzyme plus redox cycling reaction, Sens. Actuators B 208 (2015) 137–142. [16] Z. Gao, Y. Yu, A microRNA biosensor based on direct chemical ligation and electrochemically amplified detection, Sens. Actuators B 121 (2007) 552–559. [17] H.S. Yin, Y.L. Zhou, B.C. Li, X. Li, Z.Q. Yang, S.Y. Ai, et al., Photoelectrochemical immunosensor for microRNA detection based on gold nanoparticles-functionalized g-C3N4 and anti-DNA: RNA antibody, Sens. Actuators B–Chem. 222 (2016) 1119–1126. [18] J. Wan, X. Liu, Y. Zhang, Q. Gao, H. Qi, C. Zhang, Sensitive impedimetric detection of microRNAs using a hairpin probe based on DNAzyme-functionalized gold nanoparticle tag-initiated deposition of an insulating film on gold electrode, Sens. Actuators B 213 (2015) 409–416. [19] Q. Wang, R.J. Liu, X.H. Yang, K.M. Wang, J.Q. Zhu, L.L. He, et al., Surface plasmon resonance biosensor for enzyme-free amplified microRNA detection based on gold nanoparticles and DNA supersandwich, Sens. Actuators B–Chem. 223 (2016) 613–620. [20] H. Li, J. Xu, Z. Wang, Z.S. Wu, L. Jia, Increasingly branched rolling circle amplification for the cancer gene detection, Biosens. Bioelectron. 86 (2016) 1067–1073. [21] K. Zhang, K. Wang, X. Zhu, M. Xie, A one-pot strategy for the sensitive detection of miRNA by catalyst–oligomer-mediated enzymatic amplification-based fluorescence biosensor, Sens. Actuators B 223 (2016) 586–590. [22] M.M. Ali, F. Li, Z. Zhang, K. Zhang, D.K. Kang, J.A. Ankrum, et al., Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine, Chem. Soc. Rev. 43 (2014) 3324–3341. [23] C. Hong, A. Baek, S.S. Hah, W. Jung, D.E. Kim, Fluorometric detection of MicroRNA using isothermal gene amplification and graphene oxide, Anal. Chem. 88 (2016) 2999–3003. [24] G.D. Hamblin, K.M. Carneiro, J.F. Fakhoury, K.E. Bujold, H.F. Sleiman, Rolling circle amplification-templated DNA nanotubes show increased stability and cell penetration ability, J. Am. Chem. Soc. 134 (2012) 2888–2891. [25] Y. Mao, M. Liu, K. Tram, J. Gu, B.J. Salena, Y. Jiang, et al., Optimal DNA templates for rolling circle amplification revealed by in vitro selection, Chemistry 21 (2015) 8069–8074. [26] J. Wen, W. Li, J. Li, B. Tao, Y. Xu, H. Li, et al., Study on rolling circle amplification of Ebola virus and fluorescence detection based on graphene oxide, Sens. Actuators B 227 (2016) 655–659. [27] H. Chen, S. Wu, F. Dong, W. Cheng, Q. Li, S. Ding, et al., A novel chemiluminescence immunoassay for highly sensitive and specific detection of protein using rolling circle amplification and the multiplex binding system, Sens. Actuators B 221 (2015) 328–333.
7
[28] Z. Deng, Y. Tian, S.H. Lee, A.E. Ribbe, C. Mao, DNA-encoded self-assembly of gold nanoparticles into one-dimensional arrays, Angew. Chem. Int. Ed. Engl. 44 (2005) 3582–3585. [29] P. Yin, H.M. Choi, C.R. Calvert, N.A. Pierce, Programming biomolecular self-assembly pathways, Nature 451 (2008) 318–322. [30] B. Li, Y. Jiang, X. Chen, A.D. Ellington, Probing spatial organization of DNA strands using enzyme-free hairpin assembly circuits, J. Am. Chem. Soc. 134 (2012) 13918–13921. [31] K.W. Lim, S. Amrane, S. Bouaziz, W. Xu, Y. Mu, D.J. Patel, et al., Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers, J. Am. Chem. Soc. 131 (2009) 4301–4309. [32] Z. Zhang, J. Dai, E. Veliath, R.A. Jones, D. Yang, Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures, Nucleic Acids Res. 38 (2009) 1009–1021. [33] A.C. Bhasikuttan, J. Mohanty, H. Pal, Interaction of malachite green with guanine-rich single-stranded DNA: preferential binding to a G-quadruplex, Angew. Chem. Int. Ed. Engl. 46 (2007) 9305–9307. [34] V. Dhamodharan, S. Harikrishna, C. Jagadeeswaran, K. Halder, P.I. Pradeepkumar, Selective G-quadruplex DNA stabilizing agents based on bisquinolinium and bispyridinium derivatives of 1,8-naphthyridine, J. Org. Chem. 77 (2012) 229–242. [35] J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, P.I. Pradeepkumar, A.C. Bhasikuttan, Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA, J. Am. Chem. Soc. 135 (2013) 367–376. [36] B. Li, A.D. Ellington, X. Chen, Rational, modular adaptation of enzyme-free DNA circuits to multiple detection methods, Nucleic Acids Res. 39 (2011) e110. [37] X. Tan, Y. Wang, B.A. Armitage, M.P. Bruchez, Label-free molecular beacons for biomolecular detection, Anal. Chem. 86 (2014) 10864–10869. [38] L.L. Tong, L. Li, Z. Chen, Q. Wang, B. Tang, Stable label-free fluorescent sensing of biothiols based on ThT direct inducing conformation-specific G-quadruplex, Biosens. Bioelectron. 49 (2013) 420–425. [39] H. Wang, P. Peng, S. Liu, T. Li, Thioflavin T behaves as an efficient fluorescent ligand for label-free ATP aptasensor, Anal. Bioanal. Chem. 408 (2016) 7927–7934.
Biographies Tingting Fan received her B.S. degree from college of life science, Henan Normal University in 2015, and now she is pursuing for M.S. degree in department of chemistry, Tsinghua University. Her main research interests are in design and application of biosensors and fluorescent chemosensor for the detection of various biomolecules. Yu Mao received her B.S. degree from University of Science & Technology Beijing in 2011. She is currently pursuing for Ph.D. degree in school of chemical biology and biotechnology, Peking University. Her main research focuses on expanding utility of functional DNA molecules for biosensing applications. Feng Liu received his Ph.D. degree from Tsinghua University in 2011, and now he is a lecturer in Tsinghua University. His research interests focused on molecular recognition and signaling pathways in cancers. Wei Zhang received her M.S. degree from China Medical University in 2012. She is currently pursuing for Ph.D. degree in school of medicine, Tsinghua University. Her research interests focus on tumor therapy. Jingxian Yin received her B.S. degree from Jilin University in 2016. She is currently pursuing for M.S. degree in department of chemistry, Tsinghua University. Her research interests focus on the design and application of self-assembling of DNA. Yuyang Jiang received his Ph.D. degree in microbiology from Shenyang Institute of Applied Ecology, Chinese Academy of Sciences (CAS) in 1996. Presently, he worked as professor in Tsinghua University. His research scope covers biosensors, fluorescent chemosensors, organic synthesis, drug discovery, metabonomics, and signaling pathways in cancers.