- Email: [email protected]
Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.)
Plant Science 165 (2003) 1193–1199
Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.) Samart Wanchana a , Theerayut Toojinda a , Somvong Tragoonrung b , Apichart Vanavichit a,∗ a
b
Rice Gene Discovery, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus, Nakorn Pathom 73140, Thailand DNA Technology Laboratory, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus, Nakorn Pathom 73140, Thailand Received 21 June 2003; received in revised form 21 June 2003; accepted 12 July 2003
Abstract Rice starch consists of amylopectin and amylose, the latter component being controlled by the Waxy (Wx) gene. Two alleles Wxa and Wxb were found to regulate the quantitative level of the Wx protein as well as the amylose content. A comparison of the genomic sequences of rice Wx genes responsible for the synthesis of grain amylose was made between two pairs of glutinous and non-glutinous reverse mutants. By comparing their 5 splice codons in the first intron, the low-amylose and glutinous rices were characterized as the Wxb allele based on the G-to-T base substitution, which caused an aberrant splicing. When the entire genomic sequences of Wxb were compared, a unique duplication of 23 bp was found to be present only in the glutinous mutants. This 23 bp insertion was truly unique for tropical glutinous rice because of its similarity between the 800 bp sequences around the duplicated sequences of 24 glutinous varieties and two annual diploid wild rice accessions. This in-frame duplication created a premature translation stop codon at 78 bp downstream. The insertion was unique and none of the structure was identical to any transposon or retrotransposon ever reported in rice before. This unique duplicated sequence opens up opportunities to develop PCR-based markers useful for classifying grain amylose in rice. © 2003 Elsevier Ireland Ltd. All rights reserved. Keywords: Waxy; Glutinous rice; Oryza sativa; Splice site; Duplicated sequence; (CT)n repeat; PCR-based markers
1. Introduction The amylose content in endosperm starch is a major determinant of processing, cooking and consumption of rice grains. Rice varieties may be classified as glutinous (or waxy), low, intermediate and high with 0–2, <20, 20–25 and >25% of apparent amylose, respectively [1]. The rice Waxy gene (Wx) encodes a granule-bound starch synthase (GBSS) necessary for the synthesis of endosperm amylose. Although the inheritance of amylose content is rather complicated, the GBSS alleles, Wx protein, and Wx gene expression were found to be highly correlated and associated with the variation of amylose content [2]. Genetic studies have showed that the Wx gene consists of 13 exons with a 1.1 kb untranslated leader intron [2–4]. The amylose content of rice endosperm is regulated post-transcriptionally. It ∗
Corresponding author. Tel.: +66-34-355192; fax: +66-34-355196. E-mail address: [email protected] (A. Vanavichit).
was found that sequence variation in the 5 splice site of the leader intron affected the amylose content among the rice varieties [2]. Two alleles Wxa and Wxb were found to regulate the quantitative level of the gene product as well as the amylose content. The Wxa allele contains an efficient intron 1 splice site (AGGTATA) for normal gene expression and plants expressing¯ this allele contain intermediate to high grain amylose content [2]. The Wxb allele commonly carries a single nucleotide variation at the first intron splice site (AG(G/T)TATA). The G-to-T base substitution reduces ¯ ¯ of the first intron splicing, and subsequently the efficiency depresses GBSS expression [2,5–7]. Recently, it has been learned that the amylose content is influenced by the temperature and that the splicing aberrant of the Wxb allele is affected by extreme temperatures. Therefore, the amylose content can be enhanced at low temperatures but depressed at high temperatures [8,9]. The waxy rice was first reported as a loss-of-function mutation in the gene Wxa encoding GBSS which caused
0168-9452/$ – see front matter © 2003 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/S0168-9452(03)00326-1
1194
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
a low-amylose content [2]. Molecular characterization of wx mutations, by uses of EMS-induction and gamma-ray-induction, revealed base substitutions in several exons and introns, and base deletion in intron 4. In addition, a spontaneous wx mutation, in the japonica traditional cultivar ‘Kinoshita-mochi’, showed that exon 2 had a 23 bp duplication in the coding sequence [10]. In Indochina, particularly in Thailand and Laos, glutinous rice is popularly grown for in-house consumption. In addition to direct consumption, its unique starch quality makes it to be in high demand by modified food manufacturers for the production of such things as rice crackers. Glutinous rice is not only interesting for its origin but also for its adaptability to lowland rainfed fields, where growing conditions are harsh and diverse. In Thailand, 70% of the rice grown is on lowland rainfed fields. Here, glutinous rice production is constrained by salinity, low soil fertility, drought and submergence. Most of the glutinous rice varieties are photoperiod sensitive landraces. Being photoperiod sensitive landraces, most of these glutinous rice varieties have to be improved genetically emphasizing in a specific starch quality. There have been a few studies conducted on the regulation of starch quality of glutinous rice. The objective of these studies is to identify a correlation between the amylose content and a coding sequence in the waxy allele in tropical glutinous rice. In addition, a hypothesis of the phenomenon that halted the translation and accumulation of grain amylose in all tropical glutinous rice was proposed. An efficient PCR-based marker was also developed to diagnose the glutinous from normal starchy rice and this in turn will benefit rice breeding programs.
Table 1 List of rice varieties and accession numbers used in the experiment Accession number
Cultivar
(CT)n
Leader intron 5 splice site
5149 6738 5725 9380 6684 6730 7498 10125 6735 10665 9043 6626 9041 6728 3101 6726 3370 4045
Hom Thong Hom Udom Thai Fa mui Dam Tab Moo Hom Lao Hom Lai Prae Hom Hom Udom Hom Intok Hom Tung Dao Hom Huan Glam Hom Hom Dao Hom Daeng Noi Do Mana Kam Pun Nang Nuan Hom Prateep RD6 RD8 RD10 San Pa Tong Doi Saket (aromatic) Doi Saket (non-aromatic) Lai Hen Kao Dok Mali 105 Jao Hom Nin Neaw Hom Nin O. nivara O. rufipogon
18 18 17 17 18 18 17 17 17 18 18 17 18 17 18 18 17 18 17 18 17 17 17 17 17 17 18 17
AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA
18223 16226
The (CT) repeating units and 5 splice site of the leader intron are also presented.
2. Materials and methods
of genomic DNA using a CTAB extraction procedure [12].
2.1. Plant materials
2.3. Sequencing strategy
To determine the extent of changes in the amylose content, two strains of low-amylose (KDML105 and Jao Hom Nin) and glutinous lowland rice (RD6 and Neaw Hom Nin) were utilized as reference varieties for sequence comparison of their Wx genes. The KDML105, RD6, Oryza rufipogon and Oryza nivara, the two accessions of annual wild rice which are believed to be the ancestors of cultivated indica rice [11], and additional tropical glutinous rice varieties were supplied either by the Rice Research Institute (RRI) in Thailand, or collected from farmers’ fields. The majority of the glutinous and landrace rice is popularly grown in the north and northeast of Thailand. The names and accession numbers of rice varieties were listed in Table 1.
The full 7.5 kb fragment of a rice Wx gene was retrieved by BLAST search using the NCBIs non-redundant database (http://ncbi.nlm.nih.gov/blast). The overlapping PCR strategy was applied in order to sequence the whole gene. Sixteen primer’ pairs were designed using Primer3 program to generate sixteen 800 bp overlapping templates optimum for direct PCR sequencing (http://www.genome.wi.mit.edu/cgibin/primer/primer3 www.cgi). The Wx gene structure with PCR primer positions is shown in Fig. 1. The PCR templates were sequenced from both directions by ABI 377 XL using Big-dye terminator chemistry® (ABI). After sequencing, the sequences of each fragment were assembled using Phred/Phrap/Consed programs (http://www.phrap.org/). The assembled sequences were compared using the multiple-sequence-alignment program, ClustalW (http://clustalw.genome.ad.jp/). The difference between non-glutinous and glutinous reference varieties in each of the specific region were further confirmed by
2.2. Genomic DNA isolation All the rice plants were grown in a greenhouse. Later leaves of 3-week-old plants were collected for isolation
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
1195 1 kb
1F
2F
3F
4F
4nF 5F
Exon
1
2R
3R
AF
BF
CF
DF
EF FF
GF
HF IF
10
11 12 13
JF
(A)
1R
ATG 2
4R
4nR 5R AR
3
4 5 6
BR
7
CR
8
9
DR ER
FR
GR
TGA AATAAA HR IR
JR
(B)
Fig. 1. (A) Primer positions and directions (triangles) of the rice Wx gene. The template sequence was retrieved by BLAST searching using the NCBIs non-redundant database. Sixteen primer pairs were designed to generate overlapping templates of approximately 800 bp for direct PCR sequencing. (B) Bars indicate the expected amplified DNA fragments. The position of all exons, the start codon (ATG), stop codon (TGA) and poly (A) signal are also marked where appropriate.
sequencing 24 cultivated glutinous varieties using the same primer sets and sequencing chemistry.
measured. The amylose content was determined based on a standard curve or conversion factor.
2.4. Development of Wx allele-specific markers 3. Results and discussion The newly developed primer pair referred as Glu-23F (5 -TGCAGAGATCTTCCACAGCA-3 ) and Glu-23R (5 -GCTGGTCGTCACGCTGAG-3 ), were used to generate amplicons specific for glutinous/non-glutinous alleles. The basic procedure of the PCR analysis was as follows: 20 l reaction mixture containing 20 ng of genomic DNA as the template, 0.2 mM of dNTPs, 0.2 M of each primer, 0.5 U of Taq DNA polymerase, 50 mM KCl, 2.0 mM MgCl2 , and 10 mM Tris–HCl (pH 8.3), and deionized H2 O were added to make 20 l final volume. The amplification reactions were carried out by the following profile: 94 ◦ C pre-denaturation for 2 min following by 35 cycles of (94 ◦ C denaturation for 30 s, 60 ◦ C annealing for 30 s and 72 ◦ C extension for 1 min) and the final extension at 72 ◦ C for 5 min. The amplification products including 196 and 173 bp for glutinous and non-glutinous, were then resolved in 4.5% polyacrylamide gel electrophoresis. 2.5. Determination of apparent amylose content The apparent amylose content was determined according to the Juliano method [1]. One hundred milligrams of rice powder was homogenized with 1 ml of 95% ethanol and 9 ml of 1N NaOH. The sample was heated for 10 min in a boiling water bath to gelatinize the starch. Subsequently, it was cooled and transferred into a 100 ml volumetric flask and filled to full volume with water. Two milliliters of iodine solution (0.2% I2 , 2% KI) was added to 5 ml of the starch solution. The solution was made up to 100 ml with water, shaken, and let it stand for 20 min. By using a spectrophotometer, the solution absorbance at 620 nm (A620 ) was
3.1. Variation in (CT)n repeats The complete sequence of the entire 7.5 kb Wx gene of the two non-glutinous and the two glutinous reversed mutants revealed several characteristics of the Wx gene. These characteristics are the short 137 bp exon 1 and the long 1.13 kb intron 1 (Fig. 2a). The variation in dinucleotide repeats (CT)n in the truncated exon 1, was identified. The alignment showed that Jao Hom Nin and RD6 shared the (CT)18 repeat while Neaw Hom Nin and KDML105 contained the (CT)17 repeat (Fig. 2b). However, both (CT)17 and (CT)18 repeats were present in the short exon 1 among the 24 tropical glutinous landraces (Table 1). To date, eight (CT)n repeat variants in the first exon of Wx gene have been used to classify US rice cultivars differing in cooking quality [13]. However, the results from the (CT)n repeat variation in glutinous varieties showed insignificant difference between the glutinous and the low-amylose groups. Therefore, the simple sequence repeat is not a reliable marker for amylose content in rice, especially in the low-amylose group. 3.2. All glutinous rice strains carry Wxb allele The first intron 5 splice acceptor motif AGTTATA, which exists at 53 bp downstream from the (CT)n ¯repeats, was found in both pairs of glutinous and non-glutinous alleles (Fig. 2b). This aberrant splice codon, representing the G-to-T base substitution, is one of the characteristics of the Wxb allele commonly found among japonica and low-amylose indica rice strains [2]. Furthermore, 24
1196
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
Fig. 2. (a) Comparison of nucleotide sequences of Wx from the 5 regulatory region to exon 2 among four rice varieties differing in amylose content. KDML105 and Jao Hom Nin are non-glutinous rice, RD6 and Neaw Hom Nin are glutinous rice. TATA box (CT)n repeats, 5 splice site, start codon and 23 bp duplicated sequence are enclosed in boxes. Exons are shown in underlined capital letters, and the intron sequences are shown as lower-case letters. Similar nucleotides are shown in dots. (b) Variation of the number of (CT)n repeat located in the 55 bp upstream of first consensus splice site, AGTTATA, were presented. Both Jao Hom Nin and RD6 have (CT)18 but KDML105 and Neaw Hom Nin have (CT)17 . The 5 splice site of the first intron is also enclosed in a box. (c) The duplication of 23 bp sequence, ACGGGTTCCAGGGCCTCAAGCCC, present in glutinous rice, RD6 and Neaw Hom Nin, is compared to the corresponding sequence in non-glutinous varieties, KDML105 and Jao Hom Nin.
tropical glutinous landraces were investigated for sequence variation. The results revealed that none of them showed sequence variation in the 100 bp encompassing the first intron of Wxb allele (Table 1). Several reports showed that partial aberrant splicing of the first intron resulted in the reduction of the Wx gene expression in low-amylose strains carrying G-to-T mutation in splice codon [2,5–7]. This
study showed that both glutinous and low-amylose content varieties carried not only the identical G-to-T mutation at the first intron 5 splice site, but also all splice sites (data not shown). According to these results, it is possible that both glutinous and low-amylose strains accumulated a small amount of fully spliced mRNA. This idea was consistent with another study by Isshiki et al. which showed that two
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
rice wx mutations in the japonica background contained approximately 20% of the fully spliced wx mRNA relative to the wild type [14]. Although G-to-T mutation could be used to explain the amylose content variation among highand low-amylose groups (data not shown), this explanation was not relevant to the low-amylose and glutinous rice since their amylose contents varied from 0 to 16%. In this study, the amylose contents of RD6, Neaw Hom Nin, Jao Hom Nin and KDML105 were 0, 0, 13 and 16%, respectively.
1197
glutinous varieties was conducted. Interestingly, the same 23 bp duplicated motifs were found exactly in the same exon 2 of all glutinous rices (Fig. 4.). This result was not only unique in tropical glutinous varieties but also in other spontaneous wx mutants [10,14]. The presence of premature translation termination codons in the exons indicated that the lower accumulation of fully spliced mRNA in the mutants was caused by a nonsense-mediated decay (NMD), which is an RNA surveillance system universally found in eukaryotes [14].
3.3. Unusual duplication in a coding region of Wx gene in glutinous rice
3.4. Molecular marker for glutinous rice
The result of the sequence alignment between low-amylose and glutinous rice revealed the most interesting region located 108 bp downstream from the translation start site in the exon 2 (Fig. 2a and c). From position 108–131, the 23 bp sequence motif, ACGGGTTCCAGGGCCTCAAGCCC, was found to duplicate only in glutinous strains, RD6 and Neaw Hom Nin. When translation was predicted to be initiated from the first ATG, this 23 bp insert motif was in-frame and the translation was terminated prematurely at nucleotide 172 in exon 2 (Fig. 3). In contrast with Wx genes from RD6 and Neaw Hom Nin, one copy of the 23 bp insert motif from Wx genes of KDML105 and Jao Hom Nin was not prematurely terminated. To examine further whether the duplicated sequence in a tropical glutinous rice was a common phenomenon, the sequence analysis of 24 tropical
Since the 23 bp insertion in the exon 2 was uniquely present among all glutinous rice varieties, a pair of oligomers (Glu-23F and Glu-23R) flanking the duplication was used to verify glutinous and non-glutinous classes of rice varieties. Using the Glu-23F/R primers, 196 and 173 bp fragments were amplified from the glutinous and non-glutinous varieties, respectively. As expected, the 196 bp fragments were present in all glutinous rice strains, including 12 landraces and one newly improved glutinous rice, RD10 (Fig. 5). In the non-glutinous rice, the 173 bp was present in a wide variety of rice strains such as japonica (Nipponbare, Xuahao, Heibao), high-amylose lowland rice (IR64, Abhaya), high-amylose upland rice (Azucena, CT9993), red-kernel deepwater rice (FR13A) and two annual wild rices (O. rufipogon and O. nivara). In some glutinous rice accessions, the
Fig. 3. Predicted reading frame of Wx genes from the start codon to 342 bp in the non-glutinous (KDML105 and Jao Hom Nin) and glutinous rice (RD6 and Neaw Hom Nin). The stop codon was found at nucleotide 172 in the exon 2 of the glutinous varieties.
1198
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
Fig. 4. The 318 bp fragments, amplified with primers BF and AR, were sequenced and compared. The alignment of 100 nucleotide sequences, a part of the 318 bp sequence, of 25 tropical glutinous rice varieties are shown. The 23 bp duplicated sequences were found in all tropical glutinous rice.
173 bp fragments were weakly present along with the main 196 bp fragments (Fig. 5). This result was possibly due to a trace amount of natural mutation usually found in sticky rice germplasms. Such contamination has been a problem in quality control of rice exportation for a long time. The development of the specific marker for glutinous rice into a higher throughput diagnosis will be utilized as a tool for improving the quality control of rice exportation. 3.5. The origin of tropical glutinous rice One possible explanation for the lack of amylose and Wx protein in a glutinous rice was the presence of 23 bp duplicated sequence in the exon 2 resulting in a chain termination. Umeda et al. found that the lack of amylose and Wx protein was related to a short interspersed elements (SINE) element [4]. From their study, a wx mutant of O. glaberrima con-
tained 139 bp SINE in intron 10. The same SINE elements were found in glutinous O. sativa, where Wx protein and amylose were absent. Such elements had no similarity to the 23 bp sequence found in all tropical glutinous rice in this study. To determine whether the 23 bases were a member of a transposable element family, the sequence was searched through BLAST against the non-redundant database of GenBank and all public transposon/retrotransposon databases. No similarity between the 23 bp sequence and the transposons/retrotransposons database was found. The genomic sequences of Wx genes of two annual wild rices (O. rufipogon and O. nivara) were investigated in order to understand when the insertional mutagenesis emerged. The result showed that the 23 bp duplicated sequence was absent in both wild progenitors. By using pairs of reversed mutants including KDML105/RD6, Jao hom nin/Neaw hom nin and all 24 glutinous varieties, the result showed that
Fig. 5. Amplified products from glutinous and non-glutinous rice varieties using specific primers (Glu-23F and Glu-23R) flanking 23 bp repeat. All glutinous varieties generated 196 bp amplified fragments while 173 bp fragments were found in all non-glutinous rice varieties and two annual wild rice accessions.
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
these reversed mutants carried the same aberrant 5 splice codon and the similar sets of (CT)n repeats. It is likely that all tropical glutinous varieties, which originated from the Wxb group were similar to those low-amylose rice strains. Although the glutinous rice carrying Wxa allele has never been detected so far, it seems that all tropical glutinous rices may have evolved from low-amylose rice, by a duplicating mutagenesis, carrying the Wxb allele. Finally, the use of such unique duplicated sequence methods will greatly enhance the ability to develop PCR-based markers and will improve the efficiency of amylose classification in rice grain. Acknowledgements This project was jointly funded by the Royal Golden Jubilee Ph.D. Program, DNA Technology Laboratory, Rice Gene Discovery and Kasetsart University. We are very grateful to the Rice Research Institute for supplying several tropical glutinous rice landraces for experiments. These experiments complied with the current Biosafety guidelines of the country in which the experiments were performed.
References [1] B.O. Juliano, A simplified assay for milled-rice amylose, Cereal Sci. Today 16 (1971) 334–340. [2] Z.Y. Wang, F.Q. Zheng, G.Z. Shen, J.P. Gao, D.P. Snustad, M.G. Li, J.L. Zhang, M.M. Hong, The amylose content in rice endosperm is related to the post-transcriptional regulation of the Waxy gene, Plant J. 7 (1995) 613–622.
1199
[3] H.Y. Hirano, Y. Sano, Molecular characterization of the waxy locus of rice (Oryza sativa), Plant Cell Physiol. 32 (1991) 989–997. [4] M. Umeda, H. Ohtsubo, E. Ohtsubo, Diversification of the rice Waxy gene by insertion of mobile DNA elements into introns, Jpn. J. Genet. 66 (1991) 569–586. [5] H.F.J. Bligh, P.D. Larkin, P.S. Roach, C.A. Jones, H. Fu, W.D. Park, Use of alternate splice sites in granule-bound starch synthase mRNA from low-amylose rice varieties, Plant Mol. Biol. 38 (1998) 407–415. [6] X. Cai, Z. Wang, Y. Xing, J. Zhang, M. Hong, Aberrant splicing of intron 1 leads to the heterogeneous 5 UTR and decreased expression of Waxy gene in rice cultivars of intermediate amylose content, Plant J. 14 (1998) 459–465. [7] M. Isshiki, K. Morino, M. Nakajima, R.O. Okagaki, S.R. Wessler, T. Izawa, K. Shimamoto, A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5 splice site of the first intron, Plant J. 15 (1998) 133–138. [8] H.Y. Hirano, Y. Sano, Enhancement of Wx gene expression and the accumulation of amylose in response to cool temperature during seed development in rice, Plant Cell Physiol. 39 (1998) 807–812. [9] P.D. Larkin, W.D. Park, Transcript accumulation and utilization of alternate and non-consensus splice sites in rice granule-bound starch synthase are temperature-sensitive and controlled by a single nucleotide polymorphism, Plant J. 40 (1999) 719–727. [10] T. Inukai, A. Sako, H.Y. Hirano, Y. Sano, Analysis of intragenic recombination at wx in rice: correlation between the molecular and genetic map within the locus, Genome 43 (2000) 589–596. [11] H.Y. Hirano, M. Eiguchi, A single base change altered the regulation of the Waxy gene at the post-transcriptional level during the domestication of rice, Mol. Biol. Evol. 15 (1998) 978–987. [12] S.O. Rogers, A.J. Bendich, Extraction of total cellular DNA from plants, algae and fungi, Plant Mol. Biol. Manual D 2 (1994) 1–8. [13] N.M. Ayres, A.M. McClung, P.D. Larkin, H.F. Bligh, C.A. Jones, W.D. Park, Microsatellites and a single-nucleotide polymorphism differentiate apparent amylose classes in an extended pedigree of US rice germplasm, Theor. Appl. Genet. 94 (1997) 773–781. [14] M. Isshiki, Y. Yamamoto, H. Satoh, K. Shimamoto, Nonsensemediated decay of mutant Waxy mRNA in rice, Plant Physiol. 125 (2001) 1388–1395.
Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.) Samart Wanchana a , Theerayut Toojinda a , Somvong Tragoonrung b , Apichart Vanavichit a,∗ a
b
Rice Gene Discovery, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus, Nakorn Pathom 73140, Thailand DNA Technology Laboratory, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus, Nakorn Pathom 73140, Thailand Received 21 June 2003; received in revised form 21 June 2003; accepted 12 July 2003
Abstract Rice starch consists of amylopectin and amylose, the latter component being controlled by the Waxy (Wx) gene. Two alleles Wxa and Wxb were found to regulate the quantitative level of the Wx protein as well as the amylose content. A comparison of the genomic sequences of rice Wx genes responsible for the synthesis of grain amylose was made between two pairs of glutinous and non-glutinous reverse mutants. By comparing their 5 splice codons in the first intron, the low-amylose and glutinous rices were characterized as the Wxb allele based on the G-to-T base substitution, which caused an aberrant splicing. When the entire genomic sequences of Wxb were compared, a unique duplication of 23 bp was found to be present only in the glutinous mutants. This 23 bp insertion was truly unique for tropical glutinous rice because of its similarity between the 800 bp sequences around the duplicated sequences of 24 glutinous varieties and two annual diploid wild rice accessions. This in-frame duplication created a premature translation stop codon at 78 bp downstream. The insertion was unique and none of the structure was identical to any transposon or retrotransposon ever reported in rice before. This unique duplicated sequence opens up opportunities to develop PCR-based markers useful for classifying grain amylose in rice. © 2003 Elsevier Ireland Ltd. All rights reserved. Keywords: Waxy; Glutinous rice; Oryza sativa; Splice site; Duplicated sequence; (CT)n repeat; PCR-based markers
1. Introduction The amylose content in endosperm starch is a major determinant of processing, cooking and consumption of rice grains. Rice varieties may be classified as glutinous (or waxy), low, intermediate and high with 0–2, <20, 20–25 and >25% of apparent amylose, respectively [1]. The rice Waxy gene (Wx) encodes a granule-bound starch synthase (GBSS) necessary for the synthesis of endosperm amylose. Although the inheritance of amylose content is rather complicated, the GBSS alleles, Wx protein, and Wx gene expression were found to be highly correlated and associated with the variation of amylose content [2]. Genetic studies have showed that the Wx gene consists of 13 exons with a 1.1 kb untranslated leader intron [2–4]. The amylose content of rice endosperm is regulated post-transcriptionally. It ∗
Corresponding author. Tel.: +66-34-355192; fax: +66-34-355196. E-mail address: [email protected] (A. Vanavichit).
was found that sequence variation in the 5 splice site of the leader intron affected the amylose content among the rice varieties [2]. Two alleles Wxa and Wxb were found to regulate the quantitative level of the gene product as well as the amylose content. The Wxa allele contains an efficient intron 1 splice site (AGGTATA) for normal gene expression and plants expressing¯ this allele contain intermediate to high grain amylose content [2]. The Wxb allele commonly carries a single nucleotide variation at the first intron splice site (AG(G/T)TATA). The G-to-T base substitution reduces ¯ ¯ of the first intron splicing, and subsequently the efficiency depresses GBSS expression [2,5–7]. Recently, it has been learned that the amylose content is influenced by the temperature and that the splicing aberrant of the Wxb allele is affected by extreme temperatures. Therefore, the amylose content can be enhanced at low temperatures but depressed at high temperatures [8,9]. The waxy rice was first reported as a loss-of-function mutation in the gene Wxa encoding GBSS which caused
0168-9452/$ – see front matter © 2003 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/S0168-9452(03)00326-1
1194
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
a low-amylose content [2]. Molecular characterization of wx mutations, by uses of EMS-induction and gamma-ray-induction, revealed base substitutions in several exons and introns, and base deletion in intron 4. In addition, a spontaneous wx mutation, in the japonica traditional cultivar ‘Kinoshita-mochi’, showed that exon 2 had a 23 bp duplication in the coding sequence [10]. In Indochina, particularly in Thailand and Laos, glutinous rice is popularly grown for in-house consumption. In addition to direct consumption, its unique starch quality makes it to be in high demand by modified food manufacturers for the production of such things as rice crackers. Glutinous rice is not only interesting for its origin but also for its adaptability to lowland rainfed fields, where growing conditions are harsh and diverse. In Thailand, 70% of the rice grown is on lowland rainfed fields. Here, glutinous rice production is constrained by salinity, low soil fertility, drought and submergence. Most of the glutinous rice varieties are photoperiod sensitive landraces. Being photoperiod sensitive landraces, most of these glutinous rice varieties have to be improved genetically emphasizing in a specific starch quality. There have been a few studies conducted on the regulation of starch quality of glutinous rice. The objective of these studies is to identify a correlation between the amylose content and a coding sequence in the waxy allele in tropical glutinous rice. In addition, a hypothesis of the phenomenon that halted the translation and accumulation of grain amylose in all tropical glutinous rice was proposed. An efficient PCR-based marker was also developed to diagnose the glutinous from normal starchy rice and this in turn will benefit rice breeding programs.
Table 1 List of rice varieties and accession numbers used in the experiment Accession number
Cultivar
(CT)n
Leader intron 5 splice site
5149 6738 5725 9380 6684 6730 7498 10125 6735 10665 9043 6626 9041 6728 3101 6726 3370 4045
Hom Thong Hom Udom Thai Fa mui Dam Tab Moo Hom Lao Hom Lai Prae Hom Hom Udom Hom Intok Hom Tung Dao Hom Huan Glam Hom Hom Dao Hom Daeng Noi Do Mana Kam Pun Nang Nuan Hom Prateep RD6 RD8 RD10 San Pa Tong Doi Saket (aromatic) Doi Saket (non-aromatic) Lai Hen Kao Dok Mali 105 Jao Hom Nin Neaw Hom Nin O. nivara O. rufipogon
18 18 17 17 18 18 17 17 17 18 18 17 18 17 18 18 17 18 17 18 17 17 17 17 17 17 18 17
AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA AGTTATA
18223 16226
The (CT) repeating units and 5 splice site of the leader intron are also presented.
2. Materials and methods
of genomic DNA using a CTAB extraction procedure [12].
2.1. Plant materials
2.3. Sequencing strategy
To determine the extent of changes in the amylose content, two strains of low-amylose (KDML105 and Jao Hom Nin) and glutinous lowland rice (RD6 and Neaw Hom Nin) were utilized as reference varieties for sequence comparison of their Wx genes. The KDML105, RD6, Oryza rufipogon and Oryza nivara, the two accessions of annual wild rice which are believed to be the ancestors of cultivated indica rice [11], and additional tropical glutinous rice varieties were supplied either by the Rice Research Institute (RRI) in Thailand, or collected from farmers’ fields. The majority of the glutinous and landrace rice is popularly grown in the north and northeast of Thailand. The names and accession numbers of rice varieties were listed in Table 1.
The full 7.5 kb fragment of a rice Wx gene was retrieved by BLAST search using the NCBIs non-redundant database (http://ncbi.nlm.nih.gov/blast). The overlapping PCR strategy was applied in order to sequence the whole gene. Sixteen primer’ pairs were designed using Primer3 program to generate sixteen 800 bp overlapping templates optimum for direct PCR sequencing (http://www.genome.wi.mit.edu/cgibin/primer/primer3 www.cgi). The Wx gene structure with PCR primer positions is shown in Fig. 1. The PCR templates were sequenced from both directions by ABI 377 XL using Big-dye terminator chemistry® (ABI). After sequencing, the sequences of each fragment were assembled using Phred/Phrap/Consed programs (http://www.phrap.org/). The assembled sequences were compared using the multiple-sequence-alignment program, ClustalW (http://clustalw.genome.ad.jp/). The difference between non-glutinous and glutinous reference varieties in each of the specific region were further confirmed by
2.2. Genomic DNA isolation All the rice plants were grown in a greenhouse. Later leaves of 3-week-old plants were collected for isolation
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
1195 1 kb
1F
2F
3F
4F
4nF 5F
Exon
1
2R
3R
AF
BF
CF
DF
EF FF
GF
HF IF
10
11 12 13
JF
(A)
1R
ATG 2
4R
4nR 5R AR
3
4 5 6
BR
7
CR
8
9
DR ER
FR
GR
TGA AATAAA HR IR
JR
(B)
Fig. 1. (A) Primer positions and directions (triangles) of the rice Wx gene. The template sequence was retrieved by BLAST searching using the NCBIs non-redundant database. Sixteen primer pairs were designed to generate overlapping templates of approximately 800 bp for direct PCR sequencing. (B) Bars indicate the expected amplified DNA fragments. The position of all exons, the start codon (ATG), stop codon (TGA) and poly (A) signal are also marked where appropriate.
sequencing 24 cultivated glutinous varieties using the same primer sets and sequencing chemistry.
measured. The amylose content was determined based on a standard curve or conversion factor.
2.4. Development of Wx allele-specific markers 3. Results and discussion The newly developed primer pair referred as Glu-23F (5 -TGCAGAGATCTTCCACAGCA-3 ) and Glu-23R (5 -GCTGGTCGTCACGCTGAG-3 ), were used to generate amplicons specific for glutinous/non-glutinous alleles. The basic procedure of the PCR analysis was as follows: 20 l reaction mixture containing 20 ng of genomic DNA as the template, 0.2 mM of dNTPs, 0.2 M of each primer, 0.5 U of Taq DNA polymerase, 50 mM KCl, 2.0 mM MgCl2 , and 10 mM Tris–HCl (pH 8.3), and deionized H2 O were added to make 20 l final volume. The amplification reactions were carried out by the following profile: 94 ◦ C pre-denaturation for 2 min following by 35 cycles of (94 ◦ C denaturation for 30 s, 60 ◦ C annealing for 30 s and 72 ◦ C extension for 1 min) and the final extension at 72 ◦ C for 5 min. The amplification products including 196 and 173 bp for glutinous and non-glutinous, were then resolved in 4.5% polyacrylamide gel electrophoresis. 2.5. Determination of apparent amylose content The apparent amylose content was determined according to the Juliano method [1]. One hundred milligrams of rice powder was homogenized with 1 ml of 95% ethanol and 9 ml of 1N NaOH. The sample was heated for 10 min in a boiling water bath to gelatinize the starch. Subsequently, it was cooled and transferred into a 100 ml volumetric flask and filled to full volume with water. Two milliliters of iodine solution (0.2% I2 , 2% KI) was added to 5 ml of the starch solution. The solution was made up to 100 ml with water, shaken, and let it stand for 20 min. By using a spectrophotometer, the solution absorbance at 620 nm (A620 ) was
3.1. Variation in (CT)n repeats The complete sequence of the entire 7.5 kb Wx gene of the two non-glutinous and the two glutinous reversed mutants revealed several characteristics of the Wx gene. These characteristics are the short 137 bp exon 1 and the long 1.13 kb intron 1 (Fig. 2a). The variation in dinucleotide repeats (CT)n in the truncated exon 1, was identified. The alignment showed that Jao Hom Nin and RD6 shared the (CT)18 repeat while Neaw Hom Nin and KDML105 contained the (CT)17 repeat (Fig. 2b). However, both (CT)17 and (CT)18 repeats were present in the short exon 1 among the 24 tropical glutinous landraces (Table 1). To date, eight (CT)n repeat variants in the first exon of Wx gene have been used to classify US rice cultivars differing in cooking quality [13]. However, the results from the (CT)n repeat variation in glutinous varieties showed insignificant difference between the glutinous and the low-amylose groups. Therefore, the simple sequence repeat is not a reliable marker for amylose content in rice, especially in the low-amylose group. 3.2. All glutinous rice strains carry Wxb allele The first intron 5 splice acceptor motif AGTTATA, which exists at 53 bp downstream from the (CT)n ¯repeats, was found in both pairs of glutinous and non-glutinous alleles (Fig. 2b). This aberrant splice codon, representing the G-to-T base substitution, is one of the characteristics of the Wxb allele commonly found among japonica and low-amylose indica rice strains [2]. Furthermore, 24
1196
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
Fig. 2. (a) Comparison of nucleotide sequences of Wx from the 5 regulatory region to exon 2 among four rice varieties differing in amylose content. KDML105 and Jao Hom Nin are non-glutinous rice, RD6 and Neaw Hom Nin are glutinous rice. TATA box (CT)n repeats, 5 splice site, start codon and 23 bp duplicated sequence are enclosed in boxes. Exons are shown in underlined capital letters, and the intron sequences are shown as lower-case letters. Similar nucleotides are shown in dots. (b) Variation of the number of (CT)n repeat located in the 55 bp upstream of first consensus splice site, AGTTATA, were presented. Both Jao Hom Nin and RD6 have (CT)18 but KDML105 and Neaw Hom Nin have (CT)17 . The 5 splice site of the first intron is also enclosed in a box. (c) The duplication of 23 bp sequence, ACGGGTTCCAGGGCCTCAAGCCC, present in glutinous rice, RD6 and Neaw Hom Nin, is compared to the corresponding sequence in non-glutinous varieties, KDML105 and Jao Hom Nin.
tropical glutinous landraces were investigated for sequence variation. The results revealed that none of them showed sequence variation in the 100 bp encompassing the first intron of Wxb allele (Table 1). Several reports showed that partial aberrant splicing of the first intron resulted in the reduction of the Wx gene expression in low-amylose strains carrying G-to-T mutation in splice codon [2,5–7]. This
study showed that both glutinous and low-amylose content varieties carried not only the identical G-to-T mutation at the first intron 5 splice site, but also all splice sites (data not shown). According to these results, it is possible that both glutinous and low-amylose strains accumulated a small amount of fully spliced mRNA. This idea was consistent with another study by Isshiki et al. which showed that two
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
rice wx mutations in the japonica background contained approximately 20% of the fully spliced wx mRNA relative to the wild type [14]. Although G-to-T mutation could be used to explain the amylose content variation among highand low-amylose groups (data not shown), this explanation was not relevant to the low-amylose and glutinous rice since their amylose contents varied from 0 to 16%. In this study, the amylose contents of RD6, Neaw Hom Nin, Jao Hom Nin and KDML105 were 0, 0, 13 and 16%, respectively.
1197
glutinous varieties was conducted. Interestingly, the same 23 bp duplicated motifs were found exactly in the same exon 2 of all glutinous rices (Fig. 4.). This result was not only unique in tropical glutinous varieties but also in other spontaneous wx mutants [10,14]. The presence of premature translation termination codons in the exons indicated that the lower accumulation of fully spliced mRNA in the mutants was caused by a nonsense-mediated decay (NMD), which is an RNA surveillance system universally found in eukaryotes [14].
3.3. Unusual duplication in a coding region of Wx gene in glutinous rice
3.4. Molecular marker for glutinous rice
The result of the sequence alignment between low-amylose and glutinous rice revealed the most interesting region located 108 bp downstream from the translation start site in the exon 2 (Fig. 2a and c). From position 108–131, the 23 bp sequence motif, ACGGGTTCCAGGGCCTCAAGCCC, was found to duplicate only in glutinous strains, RD6 and Neaw Hom Nin. When translation was predicted to be initiated from the first ATG, this 23 bp insert motif was in-frame and the translation was terminated prematurely at nucleotide 172 in exon 2 (Fig. 3). In contrast with Wx genes from RD6 and Neaw Hom Nin, one copy of the 23 bp insert motif from Wx genes of KDML105 and Jao Hom Nin was not prematurely terminated. To examine further whether the duplicated sequence in a tropical glutinous rice was a common phenomenon, the sequence analysis of 24 tropical
Since the 23 bp insertion in the exon 2 was uniquely present among all glutinous rice varieties, a pair of oligomers (Glu-23F and Glu-23R) flanking the duplication was used to verify glutinous and non-glutinous classes of rice varieties. Using the Glu-23F/R primers, 196 and 173 bp fragments were amplified from the glutinous and non-glutinous varieties, respectively. As expected, the 196 bp fragments were present in all glutinous rice strains, including 12 landraces and one newly improved glutinous rice, RD10 (Fig. 5). In the non-glutinous rice, the 173 bp was present in a wide variety of rice strains such as japonica (Nipponbare, Xuahao, Heibao), high-amylose lowland rice (IR64, Abhaya), high-amylose upland rice (Azucena, CT9993), red-kernel deepwater rice (FR13A) and two annual wild rices (O. rufipogon and O. nivara). In some glutinous rice accessions, the
Fig. 3. Predicted reading frame of Wx genes from the start codon to 342 bp in the non-glutinous (KDML105 and Jao Hom Nin) and glutinous rice (RD6 and Neaw Hom Nin). The stop codon was found at nucleotide 172 in the exon 2 of the glutinous varieties.
1198
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
Fig. 4. The 318 bp fragments, amplified with primers BF and AR, were sequenced and compared. The alignment of 100 nucleotide sequences, a part of the 318 bp sequence, of 25 tropical glutinous rice varieties are shown. The 23 bp duplicated sequences were found in all tropical glutinous rice.
173 bp fragments were weakly present along with the main 196 bp fragments (Fig. 5). This result was possibly due to a trace amount of natural mutation usually found in sticky rice germplasms. Such contamination has been a problem in quality control of rice exportation for a long time. The development of the specific marker for glutinous rice into a higher throughput diagnosis will be utilized as a tool for improving the quality control of rice exportation. 3.5. The origin of tropical glutinous rice One possible explanation for the lack of amylose and Wx protein in a glutinous rice was the presence of 23 bp duplicated sequence in the exon 2 resulting in a chain termination. Umeda et al. found that the lack of amylose and Wx protein was related to a short interspersed elements (SINE) element [4]. From their study, a wx mutant of O. glaberrima con-
tained 139 bp SINE in intron 10. The same SINE elements were found in glutinous O. sativa, where Wx protein and amylose were absent. Such elements had no similarity to the 23 bp sequence found in all tropical glutinous rice in this study. To determine whether the 23 bases were a member of a transposable element family, the sequence was searched through BLAST against the non-redundant database of GenBank and all public transposon/retrotransposon databases. No similarity between the 23 bp sequence and the transposons/retrotransposons database was found. The genomic sequences of Wx genes of two annual wild rices (O. rufipogon and O. nivara) were investigated in order to understand when the insertional mutagenesis emerged. The result showed that the 23 bp duplicated sequence was absent in both wild progenitors. By using pairs of reversed mutants including KDML105/RD6, Jao hom nin/Neaw hom nin and all 24 glutinous varieties, the result showed that
Fig. 5. Amplified products from glutinous and non-glutinous rice varieties using specific primers (Glu-23F and Glu-23R) flanking 23 bp repeat. All glutinous varieties generated 196 bp amplified fragments while 173 bp fragments were found in all non-glutinous rice varieties and two annual wild rice accessions.
S. Wanchana et al. / Plant Science 165 (2003) 1193–1199
these reversed mutants carried the same aberrant 5 splice codon and the similar sets of (CT)n repeats. It is likely that all tropical glutinous varieties, which originated from the Wxb group were similar to those low-amylose rice strains. Although the glutinous rice carrying Wxa allele has never been detected so far, it seems that all tropical glutinous rices may have evolved from low-amylose rice, by a duplicating mutagenesis, carrying the Wxb allele. Finally, the use of such unique duplicated sequence methods will greatly enhance the ability to develop PCR-based markers and will improve the efficiency of amylose classification in rice grain. Acknowledgements This project was jointly funded by the Royal Golden Jubilee Ph.D. Program, DNA Technology Laboratory, Rice Gene Discovery and Kasetsart University. We are very grateful to the Rice Research Institute for supplying several tropical glutinous rice landraces for experiments. These experiments complied with the current Biosafety guidelines of the country in which the experiments were performed.
References [1] B.O. Juliano, A simplified assay for milled-rice amylose, Cereal Sci. Today 16 (1971) 334–340. [2] Z.Y. Wang, F.Q. Zheng, G.Z. Shen, J.P. Gao, D.P. Snustad, M.G. Li, J.L. Zhang, M.M. Hong, The amylose content in rice endosperm is related to the post-transcriptional regulation of the Waxy gene, Plant J. 7 (1995) 613–622.
1199
[3] H.Y. Hirano, Y. Sano, Molecular characterization of the waxy locus of rice (Oryza sativa), Plant Cell Physiol. 32 (1991) 989–997. [4] M. Umeda, H. Ohtsubo, E. Ohtsubo, Diversification of the rice Waxy gene by insertion of mobile DNA elements into introns, Jpn. J. Genet. 66 (1991) 569–586. [5] H.F.J. Bligh, P.D. Larkin, P.S. Roach, C.A. Jones, H. Fu, W.D. Park, Use of alternate splice sites in granule-bound starch synthase mRNA from low-amylose rice varieties, Plant Mol. Biol. 38 (1998) 407–415. [6] X. Cai, Z. Wang, Y. Xing, J. Zhang, M. Hong, Aberrant splicing of intron 1 leads to the heterogeneous 5 UTR and decreased expression of Waxy gene in rice cultivars of intermediate amylose content, Plant J. 14 (1998) 459–465. [7] M. Isshiki, K. Morino, M. Nakajima, R.O. Okagaki, S.R. Wessler, T. Izawa, K. Shimamoto, A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5 splice site of the first intron, Plant J. 15 (1998) 133–138. [8] H.Y. Hirano, Y. Sano, Enhancement of Wx gene expression and the accumulation of amylose in response to cool temperature during seed development in rice, Plant Cell Physiol. 39 (1998) 807–812. [9] P.D. Larkin, W.D. Park, Transcript accumulation and utilization of alternate and non-consensus splice sites in rice granule-bound starch synthase are temperature-sensitive and controlled by a single nucleotide polymorphism, Plant J. 40 (1999) 719–727. [10] T. Inukai, A. Sako, H.Y. Hirano, Y. Sano, Analysis of intragenic recombination at wx in rice: correlation between the molecular and genetic map within the locus, Genome 43 (2000) 589–596. [11] H.Y. Hirano, M. Eiguchi, A single base change altered the regulation of the Waxy gene at the post-transcriptional level during the domestication of rice, Mol. Biol. Evol. 15 (1998) 978–987. [12] S.O. Rogers, A.J. Bendich, Extraction of total cellular DNA from plants, algae and fungi, Plant Mol. Biol. Manual D 2 (1994) 1–8. [13] N.M. Ayres, A.M. McClung, P.D. Larkin, H.F. Bligh, C.A. Jones, W.D. Park, Microsatellites and a single-nucleotide polymorphism differentiate apparent amylose classes in an extended pedigree of US rice germplasm, Theor. Appl. Genet. 94 (1997) 773–781. [14] M. Isshiki, Y. Yamamoto, H. Satoh, K. Shimamoto, Nonsensemediated decay of mutant Waxy mRNA in rice, Plant Physiol. 125 (2001) 1388–1395.