Dynamics of cardiomyocyte and muscle stem cell proliferation in pig

Journal Pre-proof Dynamics of cardiomyocyte and muscle stem cell proliferation in pig Binxu Yin, Hongyan Ren, Hao Cai, Yunqi Jiang, Shuhong Zhao, Heng Wang PII:

S0014-4827(20)30048-3

DOI:

https://doi.org/10.1016/j.yexcr.2020.111854

Reference:

YEXCR 111854

To appear in:

Experimental Cell Research

Received Date: 4 October 2019 Revised Date:

19 December 2019

Accepted Date: 15 January 2020

Please cite this article as: B. Yin, H. Ren, H. Cai, Y. Jiang, S. Zhao, H. Wang, Dynamics of cardiomyocyte and muscle stem cell proliferation in pig, Experimental Cell Research (2020), doi: https:// doi.org/10.1016/j.yexcr.2020.111854. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Inc.

Credit Author Statement Binxu Yin, Heng Wang: Conceptualization, Methodology Binxu Yin, Hongyan Ren, Hao Cai, Yunqi Jiang, Shuhong Zhao: Data curation, Visualization, Investigation. Binxu Yin, Heng Wang: Writing- Reviewing and Editing,

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Title: Dynamics of cardiomyocyte and muscle stem cell proliferation in pig Binxu Yin 1, Hongyan Ren 2, Hao Cai 1, Yunqi Jiang 1, Shuhong Zhao 1, Heng Wang 1, * 1

Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of the Ministry of Education, College of Animal Sciences and Technology, Huazhong Agricultural University, Wuhan 430070, China 2

Key Laboratory of Animal Embryo & Molecular Breeding of Hubei Province, Institute of Veterinary and Animal Science, Hubei Academy of Agricultural Science, Wuhan 430064, China *Correspondence Heng Wang College of Animal Sciences and Technology, Huazhong Agricultural University, Wuhan 430070, China [email protected]

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70

Abstract The cardiac and skeletal muscle tissues are both striated and contractile but their intrinsic cellular properties are distinct. The minimal cardiomyocyte proliferation and the lack of cardiac stem cells directly leads to poor heart repair in adult. But in skeletal muscle, the robust proliferation of widespread muscle stem cells support efficient muscle regeneration. The endogenous cardiomyocyte and muscle stem cell proliferation has been analyzed in common laboratory animals but not in large mammals including pigs, which are more comparable to human. In this study, we rigorously examined the cell cycle dynamics of porcine cardiomyocytes and muscle stem cells through different developmental stages. Proliferative cardiomyocytes and muscle stem cells were broadly observed in the embryonic heart and limb muscle respectively. Muscle stem cells continue to proliferate postnatally but cardiomyocyte proliferation was drastically reduced after birth. However, robust cardiac cell cycle activity was detected around postnatal day 20, which could be attributed to the binucleation but not cell division. Increased proliferating cells were detected in maternal heart during early pregnancy but they represent non-cardiomyocyte cell types. The islet1 expressing cells were only identified in the embryonic and new born porcine hearts. Furthermore, the accumulated oxidative DNA damage in the cardiac but not skeletal muscle during development could be responsible for the diminished cardiomyocyte proliferation in adult pig. Similarities and differences in the proliferation of heart and skeletal muscle cells are identified in pigs across different developmental stages. Such cellular proliferative features must be taken into account when using porcine models for cardiovascular and muscular research. Keywords: cell proliferation, cardiomyocyte, muscle stem cell, pig 1. INTRODUCTION The mammalian bodies have three types of muscles: skeletal muscle, cardiac muscle and smooth muscle. Both skeletal and cardiac muscle cells show striated sarcomere histologically and are highly contractile. But different types of muscle tissues are inherently different in the developmental dynamics and cellular characteristics [1]. Heart is among the least regenerative organs in mammalian body, whereas the skeletal muscle retains remarkable regenerative capacity throughout life. The major causes of the poor heart repair are the diminished cardiomyocyte proliferation and lack of cardiac progenitors in adult hearts [2]. The inability of heart to regenerate stands in sharp contrast to skeletal muscle, which is capable of considerable tissue repair though the reconstruction of myofibers. The proliferation and differentiation of resident muscle stem cells (satellite cells) are necessary for the new myofiber formation and muscle regeneration [3]. Studies in zebrafish and mice have identified invaluable cues for promoting cardiac regeneration [4]. But the molecular and cellular mechanisms controlling cardiomyocytes proliferation are likely variable across mammalian species including human, thus hindering the potential clinical applications. Pigs provide a clinically relevant large animal model in this respect as the molecular and cellular properties can be examined in detail, which is simply not feasible in human [5]. Recent studies also showed that pig heart could regenerate after myocardial infarction, but only before postnatal day 3 when endogenous cardiomyocytes are still cycling [6,7]. Thus, it is essential to thoroughly examine the cell proliferative behavior during pig heart development to appreciate the full potential of heart regeneration, as well as validate the pig models for pre-clinical trials of new drugs and

71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106

devices for heart disease. There is also considerable agricultural interest in the improvement of meat production by modulating the muscle stem cell proliferation and differentiation.

107 108 109 110 111 112 113 114 115 116 117 118 119 120

retrieval was performed in 10mM Tri-Sodium Citrate (Sinopharm) pH 6.0 in 75°C water for 30 minutes. The sections were incubated with primary antibodies overnight at 4 °C and the corresponding secondary antibodies conjugated to Alexa Fluor 488 or 555 (Invitrogen) for 1 hour. The sections were washed in PBS three times between different treatments. Primary antibodies used are following: anti-Cardiac Troponin T(Invitrogen MA5-12960, 1:500), antiki-67(Abcam ab15580,1:200), anti-ki67 (Millipore AB9260,1:200), anti-phospho histone H3 Ser10 (Millipore 06-570, 1:200), anti-aurora B (Abcam ab2254, 1:200), antiminichromosome Maintenance Complex Component 2 (Abcam ab4461,1:200), anti-αSmooth Muscle (Sigma C6198,1:500), anti-islet1 (Abcam ab20670,1:100), anti-islet1(DSHB 40.2D6,1:100), anti-Pax7 (DSHB,1:100), anti-MHC (DSHB, MF20, 1:500), anti-vimentin (Santa Cruz Biotechnology sc-6260, 1:500), anti-8-OHdG(Santa Cruz Biotechnology sc66036, 1:500). DAPI was used for the nuclear staining.

In this study, we systematically examined the proliferation of cardiomyocytes and muscle stem cells in pig heart and limb during embryonic development, postnatal and adulthood. A panel of proliferation markers including ki67 (G1 phase to anaphase), aurora B (Aurora-B kinase, G2/M to cytokinesis), MCM2 (Minichromosome Maintenance Complex Component 2, G1 to telophase) and pH3 (Phospho-Histone H3, G2/M to anaphase) were utilized to precisely determine the cell cycle activity of cardiac and skeletal muscle cells. Our data revealed novel cell proliferation dynamics during pig heart and limb muscle development respectively. Furthermore, the presence of Islet1 (Isl+) expressing cardiac progenitors in pigs was also confirmed. 2. MATERIALS AND METHODS 2.1 Sample collection Heart and forelimbs samples were collected from crossbred pigs derived from Yorkshire × Landrace at different developmental stages, including embryonic days (E30, E35, E45, E55, E95) and postnatal days (P0, P1, P3, P5, P7, P9, P11, P15, P20, P30, P45, P180, P720). Only female piglets were used in this study and they were allowed access to feed and water ad libitum and were housed under identical conditions before slaughtering. The piglets were weaned at 28 days. The pregnant animals (P720) were sacrificed at the selected stages. At each stage, hearts and limb skeletal muscle tissues from more than three individuals were harvested as biological replicates. All animal procedures were performed according to the protocols of the Huazhong Agricultural University and the Institutional Animal Care and Use Committee. 2.2 Immunofluorescent staining Hearts were dissected under a stereo microscope and different parts of the heart components including left ventrical (LV), right ventrical (RV), left atrium (LA), right atrium (RA) and outflow tract region (OFT), were isolated and fixed in 4% paraformaldehyde overnight at 4°C. Tissues were then incubated in 30% sucrose in PBS overnight before cryopreservation in Tissue Tek O.C.T. compound (Sakura Finetek Europe B.V.). Skeletal muscle tissues were imbedded in OCT and snap frozen in isopentane (2-methylbutane) cooled with liquid nitrogen. All the samples were cut in a Leica 1950 cyostat at 5-10 µm thickness. Tissue sections were air-dried and re-fixed in 4% paraformaldehyde. Permeabilization was performed in 0.2% TritonX in PBS and blocking was done with 5% donkey serum. Antigen

2.3 Quantitative RT-PCR

121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170

Total RNA was extracted from pig embryonic heart tissue by using Trizol reagent (Simgen). The cDNA was synthesized by using Taqman MicroRNA Reverse Transcription Kit and PrimeScript® RT reagent kit (Takara, Tokyo, Japan). RT-qRCR assay was performed by using 2x SYBR Green qPCR Master Mix(Bimake). In brief, 1 µg total RNA was subjected to reverse transcription in 20 µl final volume containing 10 mM dNTP mix and 2 M of anchored oligo-dt. The mixture was incubated at 42 °C for 2 min, then mixed with 5× RT buffer and 200 U/µl reverse transcriptase at 37 °C for 15 min, 85°C for 5s. Real-time PCR was performed using SYBR Green PCR MasterMix on BIO-RAD CFX96 real-time PCR system. The RT-qPCR conditions were: initial denaturation at 95 °C for 5 min, followed by 39 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 20 s. The relative amount of ki67 mRNA was normalized to the amount of gapdh, respectively. The 2−∆∆Ct method was used for evaluation of relative quantification of target gene expression. Primers are described below: pig-gapdh-F: GTGTGTTCCGTGCATTGCC, pig-gapdh-R: TGCCGTGGGTGGAATCATAC, pig-ki67-F: GGTGACTTGAAAACGGACGC, pig-ki67-R: TGGGATTTTCGGCTCCATCC, pig-cdk1-F: ACACGTTGTATCAAGAACAGATAGT, pig-cdk1-R: AGGTTGTTACAGTGGAATCTACA, pig-cdk2-F: GGGGGTAGAGGGGAGCAATA, pigcdk2-R: ATGGCAATCCCTGTGTGGTG, pig-p21-F: AGGACCATGTGGACCTGTTG, pig-p21-R: TTAGGGCTTCCTCTTGGAGA. 2.4 Data analysis At least five sections were selected from each sample and all the cells from three random fields (200µm × 200µm) were counted. The cell numbers or ratios from each section of the same sample were averaged. Data are presented as the mean ± standard error of the mean (SEM). Statistical differences were analyzed by Student’s t test. GraphPad Prism software was used for statistical analysis. p < 0.05 was considered significant. 3. RESULTS 3.1 Cardiomyocyte proliferation during pig embryonic heart development We first aimed to identify the proliferating cardiomyocytes by monitoring co-expression of ki67 and sarcomeric cTNT in the embryonic pig heart. Massive ki67/cTNT double positive cells were found in E30 hearts (Figure 1A). The proliferative cardiomyocytes were indeed undergoing mitosis as shown by the different subcellular localization of aurora B and pH3 in the dividing cardiomyocytes, which indicate different phases within mitosis (Figure 1B). The mitotic cardiomyocytes were mostly in prophase as demonstrated by the nuclear localization of aurora B and pH3 (Figure 1B). Furthermore, quantitative PCR showed that the gene expression of the proliferation marker ki67 in the cardiac tissues was elevated during embryonic heart formation and peaked at around E55 (Figure 1C). We also found that the expression of positive cell cycle regulators (cdk1, cdk2) were higher in the embryonic than than postnatal stages, whereas the negative cell cycle regulators (p21) were upregulated during pig heart development (Figure 1C). Thus, the pig cardiomyocyte proliferate robustly during early embryonic development. 3.2 Cardiomyocyte proliferation and binucleation in pig neonatal heart Since the cardiomyocytes exit cell cycle drastically during the first few days in other mammalian species [8], we then examined cardiomyocyte proliferation in neonatal porcine heart at different days after birth. The ki67-positive cardiomyocytes were quantitatively analyzed in individual chambers of the developing heart (Figure 2A). A sharp decrease in cardiomyocyte proliferation was observed in all the different heart regions compared to the embryonic heart (0.42%- 0.68% in P1, 18.75% in E50). Nevertheless, a considerable proliferating cells were still identified in the out flow tract region after birth, these cells were

171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219

mostly SMA+ but never cTNT+ (Figure 2A). However, we were intrigued by the progressive increase of ki67+/cTnT+ cells within a short period (around P20) during neonatal heart development (Figure 2B). The enhanced cardiomyocyte proliferation was also corroborated by other proliferation markers including mcm2 and pH3 (Figure S1, S2). To further authenticate the short burst of proliferating cells, we scrutinized the different phases of the cell cycle by analyzing aurora B subcellular localization, particularly during mitosis. The successful mitosis requires the complete cytokinesis, which is defective during the binucleation of cardiomyocyte. During cytokinesis, the irregular (asymmetrical) distribution of midbody Aurora B protein between the two separating nuclei signify the binucleation but not cytokinesis [9,10]. Therefore, we carefully examined the aurora B distribution to distinguish the binucleation from successful cytokinesis, which couldn’t be detected by other proliferative markers. As shown in Figure 2C of the mitotic cardiomyocytes, we frequently observed irregular aurora B protein located between the two separating nuclei. Quantification of regular/irregular midbodies revealed that the overall mitotic cardiomyocytes increased but the successful cytokinesis decreased over the neonatal period. The majority of mitotic cardiomyocytes are undergoing binucleation instead of cytokinesis during the proliferation burst (Figure 2D). Therefore, the cellular binucleation but not division contribute to the increased cell cycle activity of neonatal cardiomyocytes in pig. Nevertheless, no aurora B+ cardiomyocytes was found from the hearts older than 6 month, indicate that binucleation process is negligible in the adult. 3.3 Cell proliferation in maternal heart during early pregnancy In the adult stage, we never found any evidence of proliferating cardiomyocytes from either male or female hearts. Nevertheless, we analyzed the cell proliferation features in the maternal heart during early pregnancy when the embryonic cardiomyocytes are highly proliferative. Compare to the control animals, more proliferating cells were detected in the maternal heart during early pregnancy but none of them are cardiomyocytes (Figure 3AB). The proliferating cells in the pregnant maternal heart were mostly vimentin+ cardiac fibroblasts (Figure 3A). Thus, the physiological changes in pregnancy could stimulate the proliferation in non-myocyte cells in the maternal heart. 3.4 Islet1 positive cells in fetal and postnatal heart The cardiac progenitor cells are a heterogeneous group of cells distributed throughout the heart. The fate mapping experiments in mice identified varies types of cardiac progenitor cells could differentiate into cardiomyocytes during heart development. Nevertheless, the identity of cardiac progenitor cells in the postnatal heart remain elusive [2]. Islet1 (Isl1) has been well known as the multipotent cardiac progenitor cell marker in mice and human [11,12]. In the pig embryos, scattered Isl1+ cells were found in different regions of the developing heart but they did not express any mature cardiomyocyte markers such as cTnT or MHC (Figure 4A-D). A bigger amount of Isl1+ cells were located in the out flow tract region and they also express the smooth muscle markers (α-SMA) (Figure 4E). However, in the postnatal hearts, Isl1+ cells were only found in the out flow tract of the P0 hearts (Figure 4F). After careful examination, no Isl1+ cells were identified in other regions of the heart of any stage after P0. 3.5 Muscle stem cell proliferation in skeletal muscle development

220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269

In contrast to the heart, skeletal muscle maintain robust regenerative capacity throughout life. The Pax7 expressing muscle stem cells are the major cellular source contributing to skeletal muscle development and regeneration in mammals [3,13]. We collected limb muscle tissue from different developmental stages and utilized pax7/ki67 co-immunostaining to identify proliferating muscle stem cells. Similar to the embryonic heart, abundant proliferating muscle stem cells were found in the limb skeletal muscle in the pig embryos (Figure 5A). We also detected relatively persistent proliferating muscle stem cells in limb muscle tissues at different postnatal stages, though the proportion of proliferating cells is much lower than in the embryos (Figure 5B). Concomitantly, there was a significant increase in proliferating muscle stem cells during pregnancy (Figure 5B). 3.6 Oxidative DNA damage during cardiac and skeletal muscle development Both intrinsic and extrinsic signals could restrain the cardiomyocyte proliferation Oxidative stress has been implicated in the postnatal cardiomyocyte cell-cycle arrest in mice [14]. Therefore, we examined the oxidative stress response in the pig cardiac and skeletal muscles with the 8-OHdG, which is used as a reliable maker of oxidative DNA damage [15]. Immunohistochemistry of 8-OHdG showed a more extensive and intense staining in the postnatal cardiac muscle than the skeletal muscle (Figure 6), indicate that the accumulation of oxidative DNA damage may prevent the cardiomyocyte proliferation in adult pig. 4 DISCUSSION Both cardiac and skeletal muscles are composed of striated contractile cells, but their selfrenew potentials are strikingly different. Cardiomyocytes are among the least renewable cells in the mammalian body, while skeletal muscle fibers could be efficiently repaired by the proliferation and differentiation of muscle stem cells [16]. Therefore, it is tempting to speculate whether it is possible to exploit the proliferative competency of muscle stem cells to enhance the cardiomyocytes replication and cardiac progenitor cell action for heart repair. We take the first step to achieve this goal by longitudinally characterize the proliferation dynamics of cardiomyocytes and muscle stem cells during different developmental stages in pig, which is the most preferable large animal model in biomedical research. The evaluation of cell proliferation within tissue sections is reliable. But during heart development the cardiomyocytes may go through different cell cycle variants other than regular division and thus deviate into alternative cell states, such as binucleation. These cellular variants might account for some of the conflicting results in the literature of cardiac regeneration [9]. In this study, we utilized multiple proliferation markers to identify the authentic mitosis as well as binucleation events in cardiomyocytes. In keeping with the reports in rodents, the cycling cardiomyocytes rapidly reduced shortly after birth in pigs. The remaining proliferative cardiomyocytes could be the major source for the neonatal porcine heart regeneration after myocardial infarction [6,7]. Surprisingly, increased cardiomyocyte proliferation during the first postnatal month was noticed in porcine heart, which is concomitant to the increased cardiomyocyte proliferation in neonatal mice [17] and sheep [18]. However, with rigorous positioning of the AuroraB+ midbody in the dividing cardiomyocytes in the neonatal porcine heart, we could unequivocally attribute the enhanced proliferation to the increased binucleation but not successful mitosis. Thus, we provide new evidence to support the existence of a transient increase of cardiomyocyte cell cycle activity but not cell division during preadolescence heart development in mammals [19,20]. Our study also highlight the importance of quantifying authentic cardiomyocyte division events separately from binucleation when investigating cardiomyocyte proliferation.

270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319

The Isl1+ cells are one of the most characterized endogenous cardiac progenitors that can contribute to the majority of the cells of the cardiovascular system in the rodent heart [21]. Current report is the first to demonstrate the existence and distribution of Isl1+ cardiac progenitors in pigs. Similar to rodents, the porcine Isl1+ cells are widely distributed in different parts of the heart during the embryonic stage and the Isl1 protein is expressed in some cells that have started to differentiate into mature smooth muscle cells. In the murine hearts, the Isl1+ cell persists into juvenile through adulthood [12,22,23], which might serve as the endogenous cellular sources for repairing damaged myocardium. However, in the pigs, Isl1+ progenitors were never presented in the hearts from postnatal day 1 to adult. Our study raised cautionary perspective about the possibility of heart repair by endogenous adult stem cells in large animals. The skeletal and cardiac muscle share many common developmental, structural and metabolic regulatory proteins. But the molecular and cellular mechanisms delineate these two lineages of striated muscle during development remain poorly understood. In contrast to the scarcity of cardiac progenitor cells, the muscle stem cells are abundant in both developing and adult skeletal muscle tissues. We show that in the pig, the proliferation of cardiomyocytes and muscle stem cells occurs in apparently different waves to construct the mature organ. Similar to the cardiomyocyte, the porcine muscle stem cells proliferation also reduced dramatically right after birth. However, a proportion of muscle stem cells remain proliferative during the postnatal muscle development, which support the accretion of myofiber nuclei and muscle hypertrophy in pigs [24]. Studies in the mice identified the oxygen-rich postnatal environment induced DNA damage contribute to the cell-cycle arrest in cardiomyocytes [14]. We observed the similar oxidative DNA damage in the pig cardiac muscle but not in the skeletal muscle, which could prevent the proliferation of cardiomyocytes but not muscle stem cells. Further insights into the muscle stem cell activity are necessary to enhance the pig muscle growth and extrapolate from muscle to the heart to stimulate cardiomyocyte proliferation. Our data showed that in the pregnant animals, one or several potential circulating factors could induce the proliferation of both satellite cells in the skeletal muscle and non-myocytes in the heart of the same animals. Further experiments are needed to identify and utilize these pro-proliferative factors and their corresponding receptors to drive cardiomyocyte proliferation. On the other hand, uncontrolled cardiomyocytes proliferation elicited by exogenous stimuli could result in heart malfunction in pigs [25]. The conserved and unique characteristics of cell proliferation among different species need to be better understood before pig models can be fully employed in cardiovascular and muscular research. ACKNOWLEDGMENT This study was supported by the National Natural Science Foundation of China (31771617) and Fundamental Research Funds for the Central Universities (2662018PY031). CONFLICT OF INTERESTS The authors declare that there is no conflict of interests. AUTHOR CONTRIBUTIONS B. Y and H. W conceived the research. B. Y, H. R, H. C, Y. J and H. W performed the experiments and collected data. B.Y and H. W wrote the manuscript. All authors participated in discussion and revision of the manuscript.

320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369

DATA ACCESSIBILITY The data that support the findings of this study are available from the corresponding author upon reasonable request. FIGURE LEGENDS Figure 1. Cardiomyocyte proliferation in the pig embryonic heart. (A) Proliferating cardiomyocytes identified with ki67/cTnT co-immunostaining in the E30 pig heart. Arrows point to ki67+ cardiomyocytes. Scale bar: 20 µm. (B) Representative pictures showing the E30 proliferating cardiomyocytes are in different cell cycle phases as identified by Aurora B (upper pannels) and pH3 (bottom panels) protein localization. Quantification of the Aurora B+/cTnT+ and pH3+/cTnT+ cells suggestion that most of the proliferating cardiomyocytes in E30 pig hearts are in prophase. Scale bar: 20 µm. (C) The ki67, cdk1, cdk2 gene expression in the heart increased dramatically during early embryonic heart development but rapidly downregulated before birth. In contrast, the p21 gene expression increased during heart development. Data are presented as mean ± SEM (n=3). Figure 2. Cardiomyocyte proliferation and binucleation in pig neonatal heart. (A) Representative pictures showing the proliferating cells in different regions of the P20 hearts. The ki67+/cTnT+ proliferating cardiomyocytes were identified in left ventrical (LV), right ventrical (RV), left atrium (LA), right atrium (RA), but not in the outflow tract (OFT) region. The ki67+/SMA+ proliferating smooth muscle cells were found in the OFT region. Arrows point to ki67+ cells. Scale bar: 20 µm. (B) Quantification of proliferating cardiomyocytes (CM) and smooth muscle cells (SMC) in different parts of the hearts during heart development. Note the ki67+/cTnT+ cells in LV, RV, LA, RA regions and ki67+/SMA+ cells in OFT regions of the E95 and postnatal hearts were counted. In E30, E50 the whole section of the heart were counted. (C) Representative figures showing the proliferating cardiomyocytes are undergoing cell division or binucleation as identified with regular or irregular aurora B localization respectively. The symmetrical midbody positioning, where aurora B localization is detected centrally between the two nuclei, indicated true cardiomyocyte division was to follow. Alternatively, an asymmetrical midbody, where aurora B localization is seen at the periphery of the cleavage furrow, indicated that only binucleation would occur. Scale bar: 20 µm. (D) Quantification of the regular and irregular aurora B localization in the proliferating cardiomyocytes through the neonatal heart development. Data are presented as mean ± SEM (n=3). Figure 3. Cell proliferation in maternal heart during early pregnancy in pigs. (A) Representative pictures showing the proliferating cells in the maternal heart during early pregnancy. The proliferating cells (pH3+) were mostly MHC- (upper panels) and Vimentin+ (lower panels), indicated that cardiac fibroblast, but not cardiomyocytes, are dividing in the pregnant maternal heart. Scar bar: 20 µm. (B) Number of proliferating cardiac fibroblasts increased significantly in the maternal heart during early pregnancy. Data are presented as mean ± SEM (n=3). “∗” indicates p < 0.05. Figure 4. Islet1 positive cells in porcine fetal and postnatal heart. (A-D) Representative pictures showing the the Isl1+cTNT- cells were found in the E50 hearts. (E) A number of Isl1+SMA+ cells were identified in the outflow tract region of the E30 heart. (F) Isl1+ cells were found in the OFT region from the hearts of the new born (P0) pigs. The overviews of the heart (longitudinal) and OFT (transverse) were shown in the left panels. Scar bars: 1000 µm (overview) and 20 µm.

370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419

Figure 5. The proliferation dynamics of porcine limb muscle stem cells throughout life. (A) Immunofluorescent staining of pax7 and ki67 identified proliferating muscle stem cells in the limb muscle in the developing limbs. Scar bars: 500 µm (overview) and 20 µm. (B) The proportion of proliferating muscle stem cells decline during development. The dividing muscle stem cells reduced rapidly after birth and a few cells proliferate persistently into adulthood. During pregnancy, the proliferating of limb muscle stem cells increased significantly. Data are presented as mean ± SEM (n=3). “∗” indicates p < 0.05. Figure 6. The oxidative DNA or RNA damage is increased in cardiac but not skeletal muscle in postnatal pig development. Immunofluorescent staining of 8-OHdG and MHC showed that the oxidative DNA damage levels were not detectable in embryonic heart or limb, and increased dramatically in cardiac muscle but not skeletal muscle in postnatal development. Scar bars: 20 µm. References [1] A.M. Gordon, M. Regnier, E. Homsher, Skeletal and Cardiac Muscle Contractile Activation: Tropomyosin “Rocks and Rolls,” Physiology. 16 (2001) 49–55. doi:10.1152/physiologyonline.2001.16.2.49. [2] N. Witman, M. Sahara, Cardiac Progenitor Cells in Basic Biology and Regenerative Medicine, Stem Cells Int. 2018 (2018). doi:10.1155/2018/8283648. [3] R. Sambasivan, R. Yao, A. Kissenpfennig, L. Van Wittenberghe, A. Paldi, B. Gayraud-Morel, H. Guenou, B. Malissen, S. Tajbakhsh, A. Galy, Pax7-expressing satellite cells are indispensable for adult skeletal muscle regeneration, Development. 138 (2011) 3647–3656. doi:10.1242/dev.073601. [4] M.J. Foglia, K.D. Poss, Building and re-building the heart by cardiomyocyte proliferation, Development. 143 (2016) 729–740. doi:10.1242/dev.132910. [5] P. Camacho, H. Fan, Z. Liu, J.-Q. He, Large Mammalian Animal Models of Heart Disease, J. Cardiovasc. Dev. Dis. 3 (2016) 30. doi:10.3390/jcdd3040030. [6] L. Ye, G. D’Agostino, S.J. Loo, C.X. Wang, L.P. Su, S.H. Tan, G.Z. Tee, C.J. Pua, E.M. Pena, R.B. Cheng, W.C. Chen, D. Abdurrachim, J. Lalic, R.S. Tan, T.H. Lee, J.Y. Zhang, S.A. Cook, Early regenerative capacity in the porcine heart, Circulation. 138 (2018) 2798–2808. doi:10.1161/CIRCULATIONAHA.117.031542. [7] W. Zhu, E. Zhang, M. Zhao, Z. Chong, C. Fan, Y. Tang, J.D. Hunter, A. V. Borovjagin, G.P. Walcott, J.Y. Chen, G. Qin, J. Zhang, Regenerative potential of neonatal porcine hearts, Circulation. 138 (2018) 2809–2816. doi:10.1161/CIRCULATIONAHA.118.034886. [8] N.T. Lam, H.A. Sadek, Neonatal heart regeneration, Circulation. 138 (2018) 421–423. doi:10.1161/CIRCULATIONAHA.118.033648. [9] M. Leone, A. Magadum, F.B. Engel, Cardiomyocyte proliferation in cardiac development and regeneration: a guide to methodologies and interpretations, Am. J. Physiol. Circ. Physiol. 309 (2015) H1237–H1250. doi:10.1152/ajpheart.00559.2015. [10] M. Hesse, M. Doengi, A. Becker, K. Kimura, N. Voeltz, V. Stein, B.K. Fleischmann, Midbody Positioning and Distance Between Daughter Nuclei Enable Unequivocal Identification of Cardiomyocyte Cell Division in Mice, Circ. Res. 123 (2018) 1039– 1052. doi:10.1161/CIRCRESAHA.118.312792. [11] K.-L. Laugwitz, A. Moretti, L. Caron, A. Nakano, K.R. Chien, Islet1 cardiovascular progenitors: a single source for heart lineages?, Development. 135 (2007) 193–205. doi:10.1242/dev.001883. [12] P. Khattar, F.W. Friedrich, G. Bonne, L. Carrier, T. Eschenhagen, S.M. Evans, K. Schwartz, M.Y. Fiszman, J.-T. Vilquin, Distinction Between Two Populations of Islet-

420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

1-Positive Cells in Hearts of Different Murine Strains, Stem Cells Dev. 20 (2010) 1043–1052. doi:10.1089/scd.2010.0374. S. Ding, F. Wang, Y. Liu, S. Li, G. Zhou, P. Hu, Characterization and isolation of highly purified porcine satellite cells, Cell Death Discov. 3 (2017) 1–11. doi:10.1038/cddiscovery.2017.3. B.N. Puente, W. Kimura, S.A. Muralidhar, J. Moon, J.F. Amatruda, K.L. Phelps, D. Grinsfelder, B.A. Rothermel, R. Chen, J.A. Garcia, C.X. Santos, S. Thet, E. Mori, M.T. Kinter, P.M. Rindler, S. Zacchigna, S. Mukherjee, D.J. Chen, A.I. Mahmoud, M. Giacca, P.S. Rabinovitch, A. Aroumougame, A.M. Shah, L.I. Szweda, H.A. Sadek, The oxygen-rich postnatal environment induces cardiomyocyte cell-cycle arrest through DNA damage response, Cell. 157 (2014) 565–579. doi:10.1016/j.cell.2014.03.032. L.J. Kroese, P.G. Scheffer, 8-Hydroxy-2′-Deoxyguanosine and Cardiovascular Disease: a Systematic Review, Curr. Atheroscler. Rep. 16 (2014) 1–8. doi:10.1007/s11883-0140452-y. M.D. Grounds, J.D. White, N. Rosenthal, M.A. Bogoyevitch, The role of stem cells in skeletal and cardiac muscle repair, J. Histochem. Cytochem. 50 (2002) 589–610. doi:10.1177/002215540205000501. N. Naqvi, M. Li, J.W. Calvert, T. Tejada, J.P. Lambert, J. Wu, S.H. Kesteven, S.R. Holman, T. Matsuda, J.D. Lovelock, W.W. Howard, S.E. Iismaa, A.Y. Chan, B.H. Crawford, M.B. Wagner, D.I.K. Martin, D.J. Lefer, R.M. Graham, A. Husain, A proliferative burst during preadolescence establishes the final cardiomyocyte number, Cell. 157 (2014) 795–807. doi:10.1016/j.cell.2014.03.035. S.S. Jonker, S. Louey, G.D. Giraud, K.L. Thornburg, J.J. Faber, Timing of cardiomyocyte growth, maturation, and attrition in perinatal sheep, FASEB J. 29 (2015) 4346–4357. doi:10.1096/fj.15-272013. K. Alkass, J. Panula, M. Westman, T. Di Wu, J.L. Guerquin-Kern, O. Bergmann, No Evidence for Cardiomyocyte Number Expansion in Preadolescent Mice, Cell. 163 (2015) 1026–1036. doi:10.1016/j.cell.2015.10.035. M.H. Soonpaa, D.C. Zebrowski, C. Platt, A. Rosenzweig, F.B. Engel, L.J. Field, Cardiomyocyte Cell-Cycle Activity during Preadolescence, Cell. 163 (2015) 781–782. doi:10.1016/j.cell.2015.10.037. A. Moretti, L. Caron, A. Nakano, J.T. Lam, A. Bernshausen, Y. Chen, Y. Qyang, L. Bu, M. Sasaki, S. Martin-Puig, Y. Sun, S.M. Evans, K.L. Laugwitz, K.R. Chien, Multipotent Embryonic Isl1+ Progenitor Cells Lead to Cardiac, Smooth Muscle, and Endothelial Cell Diversification, Cell. 127 (2006) 1151–1165. doi:10.1016/j.cell.2006.10.029. R. Genead, C. Danielsson, A.B. Andersson, M. Corbascio, A. Franco-Cereceda, C. Sylvén, K.-H. Grinnemo, Islet-1 Cells Are Cardiac Progenitors Present During the Entire Lifespan: From the Embryonic Stage to Adulthood, Stem Cells Dev. 19 (2010) 1601–1615. doi:10.1089/scd.2009.0483. F. Weinberger, D. Mehrkens, F.W. Friedrich, M. Stubbendorff, X. Hua, J.C. Müller, S. Schrepfer, S.M. Evans, L. Carrier, T. Eschenhagen, Localization of islet-1-positive cells in the healthy and infarcted adult murine heart, Circ. Res. 110 (2012) 1303–1310. doi:10.1161/CIRCRESAHA.111.259630. M. Rudar, M.L. Fiorotto, T.A. Davis, Regulation of Muscle Growth in Early Postnatal Life in a Swine Model, Annu. Rev. Anim. Biosci. 7 (2018) 309–335. doi:10.1146/annurev-animal-020518-115130. K. Gabisonia, G. Prosdocimo, G.D. Aquaro, L. Carlucci, L. Zentilin, I. Secco, H. Ali, L. Braga, N. Gorgodze, F. Bernini, S. Burchielli, C. Collesi, L. Zandonà, G. Sinagra,

470 471 472 473

M. Piacenti, S. Zacchigna, R. Bussani, F.A. Recchia, M. Giacca, MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs, Nature. 569 (2019) 418–422. doi:10.1038/s41586-019-1191-6.

Declaration of interests ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: