Dynamics of Homologous Chromosome Pairing during Meiotic Prophase in Fission Yeast

Developmental Cell, Vol. 6, 329–341, March, 2004, Copyright 2004 by Cell Press

Dynamics of Homologous Chromosome Pairing during Meiotic Prophase in Fission Yeast Da-Qiao Ding,1 Ayumu Yamamoto,1 Tokuko Haraguchi,1,2 and Yasushi Hiraoka1,2,* 1 CREST Research Project Kansai Advanced Research Center 588-2 Iwaoka, Iwaoka-cho Nishi-ku, Kobe 651-2492 Japan 2 Department of Biology Graduate School of Science Osaka University 1-1 Machikaneyama Toyonaka 560-0043 Japan

Summary Pairing of homologous chromosomes is important for homologous recombination and correct chromosome segregation during meiosis. It has been proposed that telomere clustering, nuclear oscillation, and recombination during meiotic prophase facilitate homologous chromosome pairing in fission yeast. Here we examined the contributions of these chromosomal events to homologous chromosome pairing, by directly observing the dynamics of chromosomal loci in living cells of fission yeast. Homologous loci exhibited a dynamic process of association and dissociation during the time course of meiotic prophase. Lack of nuclear oscillation reduced association frequency for both centromeric and arm regions of the chromosome. Lack of telomere clustering or recombination reduced association frequency at arm regions, but not significantly at centromeric regions. Our results indicate that homologous chromosomes are spatially aligned by oscillation of telomere-bundled chromosomes and physically linked by recombination at chromosome arm regions; this recombination is not required for association of homologous centromeres. Introduction Meiosis is a process of general importance for sexually reproducing eukaryotic organisms, generating inheritable haploid gametes from a diploid cell. This is accomplished by two consecutive rounds of chromosome segregation following one round of DNA replication. In this process, pairing of homologous chromosomes during meiotic prophase and the resulting recombination-mediated physical links between the homologous chromosomes are essential for correct segregation of chromosomes during meiotic divisions. Pairing of homologous chromosomes is accomplished through a series of chromosomal events. These events include alignment of homologous chromosomes, recombination between homologous chromosomes, *Correspondence: [email protected]

and formation of a synaptonemal complex (SC), a tripartite structure connecting homologous chromosomes along their entire lengths. A characteristic arrangement of meiotic chromosomes called the “bouquet” arrangement, in which chromosomes are bundled at the telomere to form a bouquet-like arrangement, is observed in a wide variety of organisms (Loidl, 1990; Scherthan, 2001; Zickler and Kleckner, 1999). The bouquet arrangement is suggested to contribute to homologous chromosome pairing by generating a polarized configuration of chromosomes bundled at the telomere and bringing pairs of homologous chromosomes into close proximity. While the SC is formed between homologous chromosomes connecting them along their entire lengths, previous studies suggest that the SC is dispensable for homologous association; rather, it is suggested to be required for maintenance of association and distribution of crossover recombination over the length of the chromosomes (Hillers and Villeneuve, 2003; Walker and Hawley, 2000). On the other hand, centromere heterochromatin plays an important role in mediating pairing and segregation in achiasmate or nonexchanging chromosomes (Dernburg et al., 1996; Hawley et al., 1993; Karpen et al., 1996). The fission yeast Schizosaccharomyces pombe provides the most striking example of the bouquet arrangement: the nucleus moves back and forth between the cell poles for some hours during meiotic prophase, and telomeres remain clustered at the spindle-pole body (SPB; a centrosome-equivalent structure in fungi), located at the leading edge of the moving nucleus, during the entire period of meiotic prophase (Chikashige et al., 1994; Ding et al., 1998). From these observations, it has been proposed that telomere clustering and the subsequent nuclear oscillation facilitate pairing of homologous chromosomes (Chikashige et al., 1994; Hiraoka, 1998; Yamamoto and Hiraoka, 2001). In this model, chromosomes are bundled at the telomere and aligned along their length; aligned chromosomes are shuffled around each other during nuclear movement to find the correct partner and then the homologous pair of chromosomes become connected with each other through homologous recombination. This model has been supported by several lines of evidence. Homologous recombination is reduced moderately (3- to 10-fold) when telomere clustering is impaired by depleting protein components of the telomere or the SPB. For example, loss of telomere binding proteins Taz1 or Rap1 or loss of the SPB component Kms1 leads to loss of telomere-SPB clustering, and these mutants show low recombination frequencies (Chikashige and Hiraoka, 2001; Cooper et al., 1998; Kanoh and Ishikawa, 2001; Nimmo et al., 1998; Shimanuki et al., 1997). Homologous recombination is also reduced when nuclear movement is abolished by depleting dynein heavy chain (Dhc1), a microtubule motor protein required for nuclear movement (Yamamoto et al., 1999). Because the recombination machinery is intact in these mutants, it is thought that the reduction in recombination is a

Developmental Cell 330

result of a deficiency in pairing of homologous chromosomes. S. pombe, unlike many other organisms, does not form a typical tripartite SC structure along the entire length of its chromosomes, but instead forms discontinuous structures called linear elements (LE), which resemble the axial elements which appear prior to the formation of the SC (Ba¨hler et al., 1993; Kohli and Ba¨hler, 1994; Scherthan et al., 1994). Previous studies on homologous pairing in fission yeast by fluorescence in situ hybridization (FISH) indeed demonstrated the lack of homologous association along the entire length of chromosomes, but also revealed a higher pairing frequency at the centromere and telomere, and an increase of pairing frequency during meiosis (Scherthan et al., 1994). In observations of fixed cells, however, it is not possible to obtain dynamic information on homologous chromosome pairing. Recent analysis of the dynamics of homologous loci in living S. pombe cells using the lacO/lacIGFP recognition system found that a homologous cut3 locus repeats association and dissociation during meiotic prophase, and that pairing frequencies are reduced when recombination is abolished by depleting Rec12, a Spo11 homolog in S. pombe which is required for initiation of recombination (Nabeshima et al., 2001). In this study, however, only a single locus was examined. The behavior of entire chromosomes needs to be examined in order to obtain a general view into the dynamics of homologous chromosome pairing. In the present study, we examined the dynamics of homologous chromosome pairing in living cells of S. pombe using a series of strains carrying lacO/lacI-GFP recognition sequences inserted at different chromosomal positions. Using these strains, we measured the distance between homologous loci and determined the frequency of their association along the chromosome. Continuous observation of homologous chromosome dynamics in living cells revealed the dynamic nature of chromosomes in S. pombe. In addition, examination of mutants defective in telomere clustering, nuclear oscillation, or recombination elucidated the contributions of these events to the pairing of homologous chromosomes at chromosome arm and centromeric regions. Results Meiotic Chromosomal Events in S. pombe Cells of S. pombe are induced to undergo meiosis by depleting nitrogen sources from the culture medium. Upon nitrogen starvation, haploid cells of the opposite mating types conjugate with each other to form a diploid zygote, and undergo meiosis. Figure 1 shows the behavior of meiotic chromosomes in a living zygote of S. pombe. In a diploid zygote, two haploid nuclei fuse with each other (karyogamy) (Figure 1; 0–22 min). Immediately after nuclear fusion, the diploid nucleus elongates and moves back and forth between the two cell ends for some hours (Figure 1; 33–143 min). The elongated nucleus is generally called the “horsetail” nucleus. After the horsetail nucleus stops at the center of the cell, chromosomes proceed with condensation (Figure 1; 154–176 min) followed by two consecutive meiotic divisions to generate four haploid nuclei (Figure 1; 187–231

Figure 1. Behavior of Chromosomes in S. pombe Meiosis Chromosomes were stained with GFP-histone H3 fusion proteins (Wang et al., 2002). Shape of the zygote is contoured by the white line. Bar, 5 ␮m.

min). We defined the period from the end of karyogamy to the end of oscillatory nuclear movement as the horsetail stage and the period of chromosome condensation as metaphase. The horsetail stage corresponds to meiotic prophase, the period when pairing and recombination of homologous chromosomes take place. In our experiments with living cells, the duration of the horsetail stage and metaphase averaged 142 min and 37 min, respectively (Table 1). Dynamic Association and Dissociation of Homologous Chromosomal Loci To follow the dynamics of homologous chromosome pairing in living cells of S. pombe, we visualized eight

Table 1. Time Length of Meiotic Prophase in Various Cell Types Horsetail stage (min)

Metaphase (min)

Strains

Average

SD

Average

SD

N

wild-type dhc1⫺ taz1⫺ rec12-152

142 133 135 137

22 17 21 21

37 32 37 47

9 3 8 12

170 70 79 120

N, the number of cells examined.

Dynamics of Meiotic Homologous Chromosome Pairing 331

Figure 2. Positions of Labeled Chromosome Loci (A) The eight chromosomal loci examined are as follows: five loci are located on the chromosome arms, ade3 (chromosome I), ade8, cut3, his2 (chromosome II), and ade6 (chromosome III); the sod2proximal locus is about 80 kb from the telomere of chromosome I; and two loci are located on centromere-proximal regions, lys1 (35 kp to the centromere I) and cen2 (5 kp to the centromere II). Schematic drawing shows the physical position of the eight lacO insertions in U-shaped chromosomes in a horsetail nucleus in which telomeres are clustered. (B) Double stained images of a horsetail nucleus: the blue color represents DNA stained with Hoechst33342 and the green dots represent lacO arrays stained with lacI-GFP. The approximate distance of the labeled locus to the closest telomere and centromere are shown at the right side of the image panel. The distances were calculated using the genome sequence data provided by Sanger Institute (http://www-sanger.ac.uk/Projects/S_pombe/). The leading edge of the horsetail nucleus, where telomeres cluster under the SPB and lead the horsetail movement, is indicated by an arrow. Bar, 5 ␮m.

chromosomal loci on three different chromosomes using GFP in conjunction with the lac operator/repressor recognition system (see Experimental Procedures). A physical map of the visualized loci is shown in Figure 2A. In the horsetail nucleus, chromosomes are bundled at the

telomere and the arms of each chromosome are linearly aligned behind the telomere (Chikashige et al., 1994; Nabeshima et al., 2001; Niwa et al., 2000). Our results in living cells showed that the positions of the eight chromosomal loci within the horsetail nucleus accorded with their predicted physical distances from the telomere (Figure 2B). In the diploid horsetail nucleus, the GFP signal generated one or two spots, whereas only a single spot was observed in the haploid nucleus before nuclear fusion. Separation of sister chromatid loci was rarely observed (less than 0.3%). Thus, each of the GFP spots seen in the horsetail nucleus represents a chromosomal locus, one on each of the homologous chromosomes. Using these lacO repeat carrying strains, time-lapse images of GFP-labeled chromosomal loci were collected every 5 min from karyogamy to the first meiotic division in living zygotes. An example of time-lapse observation is shown for the ade8 locus in a wild-type zygote (Figure 3A). During karyogamy, two spots of the GFP signal, representing a homologous pair of the ade8 locus, approached the middle of zygote. In this example, two homologous loci formed a single dot after karyogamy, and showed occasional association and separation during the horsetail stage. At meiosis I (MI in Figure 3A), four spot signals were observed, which segregated to two sets of two spots, representing separation of sister chromatid loci in each of the homologous sets. We measured the three-dimensional distance between a homologous pair of GFP signals from karyogamy through the horsetail stage to the first meiotic division. The distance between the GFP signals of homologous loci was plotted as a function of time after nuclear fusion (Figure 3B). Results showed that homologous loci repeatedly associated and dissociated throughout the entire horsetail stage. While each zygote gave different profiles of association dynamics, all eight chromosomal loci examined showed similar dynamics of repeated association and dissociation. In addition, simultaneous observation of two pairs of homologous loci (his2 and ade8) on the same arm of chromosome II showed no obvious correlation in association between the two chromosomal loci (Figures 3C and 3D), indicating that these loci repeat association and dissociation independently of each other. Progressive Association of Homologous Chromosomal Loci during the Horsetail Stage In order to obtain quantitative measurements of the association kinetics of homologous loci during progression through the horsetail stage, we divided the horsetail stage equally into five substages (each substage is 28 min on average) and counted in each substage the number of time points at which two homologous loci are associated with each other. We defined homologous loci as being “associated” when the distance between the center of GFP signals is equal or less than 0.35 ␮m (the diameter of the GFP signal), i.e., when the signals overlap with each other. The measured frequency of association of homologous loci is then plotted as a time course (Figure 4A). Results showed that for all the loci examined the frequency of association increased during substages I to IV of the horsetail stage. On the other

Developmental Cell 332

Figure 3. Dynamic Association and Dissociation of Homologous Loci in Wild-Type Cells (A) Time-lapse observation of the ade8 locus in a living cell. Time in the horsetail stage is shown in the figure. Shape of the zygote is contoured by the white line. Bar, 5 ␮m. (B) Spatial distance between homologous loci from the horsetail stage to the first meiotic segregation in individual cells. Three examples are shown for each locus including two arm (ade8 and cut3) and two centromere-proximal loci (lys1 and cen2). The vertical dashed line indicates the end of the horsetail stage. (C) Two pairs of homologous loci on the chromosome II (ade8 and his2) in the same cell are shown. The ade8 loci, which are closer to the leading edge, are indicated by the arrow. (D) Distance between the homologous loci (ade8 and his2) during the horsetail stage is shown for two examples of the cell.

Dynamics of Meiotic Homologous Chromosome Pairing 333

Figure 4. Changes of Association Frequency and Spatial Distance between Homologous Loci (A) Time course of homologous association frequency in the horsetail stage. As a control, the association frequency between ade6 and lys1 loci is shown in the right panel. (B) Changes of percentile rank of the distance between homologous loci during the horsetail stage (substages I–V) are shown for a centromereproximal region (cen2) and two arm region loci (cut3, ade6); those for nonhomologous loci (ade6-lys1) are also shown. Because distances less than 0.35 ␮m (defined as “associated” above) cannot be measured, they are collectively plotted at 0.35 ␮m. (C) The homologous association frequency is plotted as a function of the physical distance to the closest telomere. Plots are shown for substages I, III, and V of the horsetail stage. Symbols are the same as in (A). (D) Percentile rank of the distance at different homologous loci on chromosome II (his2, cen2, cut3, and ade8) in the horsetail stage (substages I, III, and V). Cut-off distance was set at 0.35 ␮m.

hand, no increase of association frequency was observed between nonhomologous pairs of loci, ade6 and lys1 (Figure 4A). Therefore, the increase in the association frequency is specific to homologous loci. Next, to examine changes in the distance between homologous loci during the horsetail stage, the distribution of the distances was plotted as a percentile rank.

In a percentile rank plot, the percentage of cells in which the distance between homologous loci is equal or less than a given distance is plotted as a function of the distance. Curves of the percentile rank of distance became gradually shallower during the progression of the horsetail stage, meaning that the distance between homologous loci decreased (examples for cut3, cen2, and

Developmental Cell 334

ade6 shown in Figure 4B); a similar profile was obtained for all loci examined (data not shown). The distribution of the distances between nonhomologous pairs (ade6lys1) did not change during the horsetail stage (Figure 4B). Therefore, only homologous loci specifically become progressively closer during the horsetail stage. It is plausible that the progressive decrease in the distance observed at multiple chromosomal loci represents the spatial alignment of homologous chromosomes along their lengths. In addition, we found that telomere-proximal loci have higher frequencies of homologous association than the telomere-distal loci (Figure 4C). This tendency was observed throughout the horsetail stage (substages I, III, and V are shown in Figure 4C). This tendency was also demonstrated by a percentile rank of the distance between homologous loci: distribution of the distance at four loci on chromosome II showed that telomere-proximal loci were closer to each other than telomere-distal loci (Figure 4D), reflecting the spatial arrangement of telomere-bundled chromosomes. Homologous Chromosome Pairing in the Absence of Nuclear Oscillation To examine how nuclear movement contributes to the homologous pairing, the dynamics of homologous chromosome loci were examined in the dhc1⫺ mutant. In this mutant, karyogamy is completed, but the subsequent nuclear oscillation is defective (Yamamoto et al., 1999). Because of the lack of nuclear oscillation, the horsetail stage was defined as the period lasting from the end of nuclear fusion until the start of chromosomal condensation at meiotic metaphase. The duration of the horsetail stage thus defined was similar to that in wild-type cells (Table 1). In dhc1⫺ cells, homologous loci remained as two discrete signals, indicating that these loci remained separated during the entire horsetail period (an example, using ade8, is shown in Figure 5A). Almost no increase of association frequency was observed either at chromosome arm regions (ade8 and cut3) or at centromereproximal regions (lys1 and cen2) during the horsetail stage (Figure 5B). In addition, the distribution of the distance between homologous loci plotted as a percentile rank showed more highly separated curves than wild-type cells in all of the loci examined, both in the arm and centromere-proximal regions (Figure 5C). The tendency that telomere-proximal loci are closer to each other than telomere-distal loci was observed in the dhc1⫺ mutant as in wild-type (Figure 5D). The distance distribution plotted for the five substages of the horsetail stage showed that the distance became shorter during progression through the horsetail stage (Figure 5E), but not as short as for the wild-type cells (compare Figure 5E with Figure 4B). These results suggest that oscillatory nuclear movements during meiotic prophase are essential for alignment of homologous chromosomes, and for their association. Homologous Chromosome Pairing in the Absence of Telomere Clustering Next, we examined the telomere clustering-defective mutant, taz1⫺. In taz1⫺ cells, the duration of the horsetail

stage was similar to that in wild-type cells (Table 1). In these cells, the distance between homologous loci on chromosome arm regions fluctuated dramatically as a function of time (an example showing ade8 shown in Figure 6A). In this mutant, while the nucleus led by the SPB oscillates between the cell poles, the telomeres do not form a single cluster at the SPB. Occasionally, however, telomeres do bind to the SPB (Cooper et al., 1998; Nimmo et al., 1998). Thus, a telomere will temporally attach to the SPB and move with the SPB transiently. An example can be seen in Figure 6A; this figure shows that one of the homologous loci suddenly started moving (indicated by the arrow), likely reflecting a transient attachment of a telomere to the oscillating SPB. This movement explains the widely changing distances between homologous loci seen in the graph in Figure 6A. In contrast, significant movement was not observed at centromere-proximal regions (Figure 6B), probably because centromeres are spatially distant from the SPB. During the horsetail stage in the taz1⫺ mutant, no increase of association frequency was observed at chromosome arm regions (ade8 and cut3; Figure 6C), and distribution of the distance was significantly larger than that in wild-type cells at chromosome arm regions (ade8 and cut3; Figure 6D). Unlike in wild-type, distance distribution was larger for telomere-proximal loci than for centromere-proximal loci (Figure 6E), likely reflecting defective clustering of telomeres in the taz1⫺ mutant. Moreover, decreases in the distance between homologous loci at arm regions was limited to early in the horsetail stage (cut3; Figure 6F). In contrast, homologous loci were well associated at the lys1 locus, 35 kb from the centromere (lys1; Figure 6C), and more significantly at the cen2 locus, immediately adjacent to the centromere (cen2; Figure 6C). Furthermore, a distance distribution similar to that of wild-type was obtained from examples of centromere-proximal loci (cen2 and lys1 in Figure 6D; cen2 in Figure 6F). In the taz1⫺ dhc1⫺ double mutant, association of the cen2 loci was impaired to the same level as in the dhc1⫺ mutant (Figures 5C and 6D, rightmost panels), indicating that centromere association in taz1⫺ cells requires nuclear oscillation. Taken together, these results indicate that alignment and subsequent association of homologous chromosome arms require telomere clustering in addition to nuclear oscillation. Homologous Chromosome Pairing in RecombinationDefective rec12⫺ Mutant As the frequency of homologous association increases during the horsetail stage, we wished to examine whether the increase of association frequency results from homologous recombination accumulated during meiotic prophase. Thus, we observed dynamics of homologous loci in recombination-defective rec12⫺ mutants. S. pombe Rec12, a homolog of the S. cerevisiae Spo11 (De Veaux et al., 1992; Keeney et al., 1997), introduces the double-strand breaks essential for initiation of meiotic recombination (Cervantes et al., 2000). We examined homologous chromosome pairing in the rec12-152 mutant and the rec12 null mutant (see Experimental Procedures) and obtained basically the same results.

Dynamics of Meiotic Homologous Chromosome Pairing 335

Figure 5. Homologous Association in the dhc1⫺ Mutant (A) Selected time-lapse images of live cell observation of the ade8 locus in the dhc1⫺ mutant. Three examples of the spatial distance between homologous loci plotted as a function of time are shown below the microscope image. Bar, 5 ␮m. (B) Time course of homologous association frequency during the horsetail stage in dhc1⫺ (open triangle) compared with that in wild-type cells (closed diamond). (C) Percentile distance ranks in dhc1⫺ (red) and in wild-type (blue) are shown for the horsetail substage III. (D) Percentile rank of the distance at different homologous loci on chromosome II in the horsetail substage III. (E) Changes of the percentile rank of the distance between homologous loci during the horsetail stage (substages I–V) are shown for an arm region (cut3) and a centromere-proximal region (cen2) in the dhc1⫺ mutant.

In rec12⫺ cells, duration of the horsetail stage was similar to that in wild-type cells (Table 1). In this mutant, homologous loci were located closely to each other although they seldom formed a single spot (an example for the ade8 locus is shown in Figure 7A). The frequency of homologous association was low at the chromosome arm regions (sod2, ade8, cut3, and ade6 in Figure 7B). Moreover, homologous association is short-lived in this mutant. Figure 7C shows an example of the ade8 locus: less than 20% of these loci sustained association for more than 10 min in rec12⫺ cells, whereas about 50%

of association sustained for more than 10 min in wildtype cells. A similar result of a decrease in persistent association (more than 10 min) was also observed for the ade6 locus (data not shown). Therefore, stable association of homologous chromosomes requires Rec12. Although homologous loci are not stably associated in rec12⫺ cells as shown above, the distance between homologous loci plotted as a percentile rank gave a distribution only slightly larger than that in wild-type (ade8 and cut3 in Figure 7D), showing that homologous loci reside close to each other. Distance distribution for

Developmental Cell 336

Figure 6. Homologous Association in the taz1⫺ Mutant (A and B) Selected time-lapse images of live cell observation of the ade8 locus (A) or the cen2 locus (B) in the taz1⫺ mutant. For each locus, three examples of the spatial distance between homologous loci plotted as a function of time are shown below the microscope image. The asterisk in (A) indicates that segregated chromosomes re-approached after telophase, which is often observed in this mutant probably due to telomere end joining as reported in Ferreira and Cooper (2001). Bar, 5 ␮m. (C) Time course of homologous association frequency during the horsetail stage in taz1⫺ (open square) compared with that in wild-type cells (closed diamond). For the cen2 locus, the dhc1⫺ taz1⫺ double mutant is also shown (asterisk). (D) Percentile distance ranks in taz1⫺ (red) and in wild-type (blue) are shown for the horsetail substage III. (E) Percentile rank of the distance at different homologous loci on chromosome II in the horsetail substage III. (F) Changes of the percentile rank of the distance between homologous loci during the horsetail stage (substages I–V) are shown for an arm region (cut3) and a centromere-proximal region (cen2) in the taz1⫺ mutant.

Dynamics of Meiotic Homologous Chromosome Pairing 337

Figure 7. Homologous Association in the rec12⫺ Mutant (A) Selected time-lapse images of live cell observation of the ade8 locus in the rec12-152 mutant. Three examples of the spatial distance between homologous loci plotted as a function of time during the horsetail stage are shown below the microscopic image. Bar, 5 ␮m. (B) Time course of homologous association frequency in the horsetail stage in the rec12-152 mutant (open square) compared with that in wild-type (closed diamond). For the cen2 locus, the rec12⫺ (null) dhc1⫺ double mutant is also shown (open circle). (C) Distribution of the duration of the association in rec12-152 and wild-type. (D) A percentile rank of the distance between homologous loci (ade8, cut3, and cen2) in rec12-152 (red) and wild-type (blue) is shown for the horsetail substage III. Distance distribution in the taz1⫺ dhc1⫺ double mutant (green) is also shown in the rightmost panel (cen2 locus). (E) Percentile rank of the distance at different homologous loci on chromosome II in the horsetail substage III. (F) Changes of the percentile rank distance during the horsetail stage (substages I–V) are shown for the cut3, ade6, and cen2 loci in the rec12152 mutant, and for the cen2 locus in the rec12⫺ (null) dhc1⫺ double mutant.

Developmental Cell 338

these loci was similar to that in wild-type (Figure 7E; compare with the middle panel in Figure 4D). Further analysis of the distance distribution during the horsetail stage showed that in contrast to the progressive decrease between homologous loci in wild-type cells (Figure 4B), the decrease in the distance between homologous loci in rec12⫺ cells was observed only until horsetail substage II, and no further decrease was observed for chromosome arm regions (examples for cut3 and ade6 shown in Figure 7F). These results suggest that the Rec12-independent convergence of homologous loci at early stages likely reflects alignment by telomere clustering and nuclear oscillation, and Rec12-mediated physical links at arm regions promote the further convergence at later stages. At the centromere-proximal regions, however, a high level of association was observed in rec12⫺ cells (lys1 and cen2; Figure 7B), and the distance distribution at the cen2 locus decreased considerably as the horsetail stage progressed (Figure 7D). These results suggest that Rec12 is necessary for homologous association of chromosome arm regions, but not for association of homologous centromeres. Significantly, association of centromere-proximal regions was diminished by the lack of nuclear oscillation in the rec12⫺ dhc1⫺ double mutant (upper left panel in Figure 7B); in these cells, the distance between homologous centromeres remained unchanged (rightmost panel in Figure 7F). This effect in the rec12⫺ dhc1⫺ double mutant was significant compared with each of the rec12⫺ or dhc1⫺ single mutants, in which the homologous distance becomes shorter to a limited extent (compare rec12⫺ dhc1⫺ with rec12⫺ in Figure 7F, or dhc1⫺ in Figure 5E). These results suggest that nuclear oscillation causes centromeres to come into close proximity and centromere regions are then held together by Rec12-independent machinery; Rec12mediated physical links at arm regions also contribute to centromere association by conjoining nearby regions (see Discussion). Discussion In this study, we examined the behavior of homologous chromosomes in living meiotic cells of S. pombe by visualizing several different chromosomal loci. Our observations in individual living cells revealed dynamic association and dissociation of homologous loci, a decrease in the distance between homologous loci, and an increase in homologous association during the time course of meiosis. Our results suggest that pairing of homologous chromosomes proceeds in two steps: the initial event is the spatial alignment of homologous chromosomes, and the subsequent event is their physical association. Spatial alignment of homologous chromosomes in the early stages of the horsetail period requires telomere clustering and nuclear oscillation, and physical association of homologous chromosomes requires recombination. Recombination also promotes a closer approach of homologous chromosomes in the late stages of the horsetail period. In our model, chromosomes are first bundled at the telomere and oriented in a polarized configuration within the nucleus; oscillatory movement of telomere-bundled chromosomes then aligns homologous chromosomes side by side and promotes their

association. Homologous loci associate with each other transiently during nuclear movement, and occasionally these loci are recombined to form a physical link in the chromosome arm regions. Such a physical link provides stable association between homologous loci, and further promotes convergence of homologous chromosomes at nearby regions. The Role for Telomere Clustering and Nuclear Movement in Alignment of Homologous Chromosomes Our observations in living cells demonstrate that homologous loci undergo association and dissociation. While homologous loci associate and dissociate, the distance between a pair of homologous loci decreases and the frequency of association increases during the time course of the horsetail stage in wild-type cells. Similar behavior of homologous chromosomes before synapsis is suggested by FISH analysis in budding yeast (Weiner and Kleckner, 1994). Importantly, the distribution of the distances between homologous loci is larger and the frequency of association of homologous loci is lower in the taz1⫺ mutant (defective in telomere clustering) and in the dhc1⫺ mutant (defective in nuclear oscillation) than in wild-type. These results demonstrate that both telomere clustering and nuclear oscillation are necessary for reducing the distance between homologous loci and for their consequent association. In our model, chromosomes are bundled at the telomere and aligned along their lengths from the telomere, and bundled chromosomes are shuffled around each other to find their correct homologous partners. Nuclear oscillation provides a basic force to promote the contact between homologous chromosomes. On the other hand, association of telomere-proximal regions is suppressed in the taz1⫺ mutant (see Figure 6E). In this mutant, nuclear oscillation may rather disturb the arrangement of telomere-proximal regions as a result of defective clustering of telomeres; centromeres are less severely affected probably because they are located further from the oscillating nucleus and/or because they have other mechanisms for pairing. As a consequence of the alignment of chromosomes from the telomere, the probability of homologous association depends on the distance of the loci from the telomere. There is, however, no evidence that recombination frequency depends on the distance from the telomere in the wild-type background. In the recombinationdeficient rec8⫺, rec10⫺, and rec11⫺ mutants, on the other hand, recombination frequency does depend on the chromosomal region (DeVeaux and Smith, 1994; Krawchuk et al., 1999). In these mutants, recombination frequency is reduced, and its reduction is less severe near the telomere. Association probability may directly affect recombination frequency in these mutant backgrounds, whereas recombination is controlled independently of association probability in wild-type cells. The Role for Recombination in Association of Homologous Chromosomes The reduced level of homologous association in the rec12⫺ mutants indicates a contribution of Rec12 to homologous association. Similar contributions of Spo11

Dynamics of Meiotic Homologous Chromosome Pairing 339

are observed in budding yeast (Neale et al., 2002; Peoples et al., 2002; Weiner and Kleckner, 1994). We believe that Rec12 contributes to homologous association through DSB formation and, by extension, recombination. It has been suggested, however, in S. cerevisiae that Spo11 contributes to homologous association independently of DSB formation as the spo11-Y135F mutant which is defective specifically in DSB formation accomplishes homologous association (Cha et al., 2000). On the other hand, our preliminary results do not support this possibility: the corresponding S. pombe rec12-Y98F mutant (Sharif et al., 2002) was defective in homologous association at the ade8 locus (D.-Q.D., unpublished data). Thus, S. pombe Rec12 likely functions through DSB formation generating recombination-mediated physical links between homologous chromosomes. The distribution of distances between a pair of homologous loci in the rec12⫺ mutants decreases in the early stages of the horsetail period, but does not lessen further in the later stages (Figure 7F). These results demonstrate that recombination is not directly required for the spatial alignment of homologous chromosomes, but is required for the further approach of homologous loci seen in the late horsetail period. In budding yeast and Sordaria, recombination is suggested to be required for homologous chromosome alignment (Peoples et al., 2002; Storlazzi et al., 2003). In fission yeast, however, recombination alone obviously cannot align homologous chromosomes as shown in dhc1⫺ mutant, but rather promotes a closer approximation of chromosomes by conjoining nearby regions when homologous chromosomes are spatially aligned by nuclear movements. Association of Homologous Centromeres Interestingly, homologous centromeres associate with each other in the absence of recombination. This property of centromeres may increase the fidelity of chromosome segregation at the first meiotic division. In fact, in some recombination-deficient mutants, while the frequency of reductional segregation at the first meiotic division is reduced, it is still considerably higher than would be achieved by random segregation (Molnar et al., 2001). In addition, centromeres may facilitate search of homologous chromosomes independently of recombination. The centromere could be a recognition site on the chromosome as the centromere of each chromosome is a unique distance from the telomere and can act as an identifier of the chromosome. Currently, recombination-independent mechanisms for association of homologous centromeres remain unknown in S. pombe. In the fly, it is reported that centromere association can occur independently of recombination and is necessary for the disjunction of achiasmate chromosomes at meiosis I (Hawley et al., 1993; Karpen et al., 1996). In this organism, the centromere heterochromatin structure is proposed to promote centromere association (Dernburg et al., 1996). In S. pombe cells depleted of Swi6 (an S. pombe homolog to metazoan heterochromatin protein HP1, which is required for heterochromatin formation) (Ekwall et al., 1995), the centromere association was not abolished (D.-Q.D., unpublished data), indicating that centromere association does not depend, at

least, on Swi6. On the other hand, involvement of an S. pombe meiotic cohesin Rec8 in homologous chromosome pairing has been reported previously (Molnar et al., 1995), and our preliminary observation showed that the centromere association was abolished in the absence of Rec8 (D.-Q.D., unpublished data). Thus, meiosis-specific chromatin structures may play a role in homologous centromere association. Further examinations of the role for a meiotic cohesin complex in homologous chromosome pairing are now underway.

Strategies for Homologous Chromosome Association Current knowledge of other organisms supports the idea that, as in S. pombe, homologous pairing proceeds in two steps: spatial alignment of homologous chromosomes followed by their physical stabilization. While this basic scheme seems to be general in eukaryotes, strategies for its achievement are diverse (Loidl, 1990; Zickler and Kleckner, 1999). Initial alignment of homologous chromosomes is achieved by the telomere bouquet in many organisms (Scherthan, 2001; Zickler and Kleckner, 1999). A polarized configuration of chromosomes formed by the telomere bouquet approximates homologous loci along the chromosome, and provides a chance of transient contacts between homologous loci. Stabilization of transient contacts is mainly achieved by crossover recombination (Peoples et al., 2002; Rockmill et al., 1995) and/or the SC (Colaiacovo et al., 2003; MacQueen et al., 2002; Sym and Roeder, 1994) formed between homologous chromosomes (Hunter, 2003; Page and Hawley, 2003). However, the telomere bouquet contributes to homologous pairing differently in different organisms. In organisms that develop the SC, the telomere bouquet is a transient structure that supports unstable contacts between homologous chromosomes and disappears when the unstable contacts between homologous chromosomes have been stabilized by formation of an SC (Zickler and Kleckner, 1999). In S. pombe, an asynaptic organism, the telomere bouquet and nuclear movement persist throughout meiotic prophase, and loss of these functions severely disturbs progression of meiosis. Thus, it is likely that persistent telomere clustering and nuclear movement in S. pombe plays an important role in maintaining a polarized configuration of homologous chromosomes, compensating for the lack of a stable synapsis by the SC. Different strategies for homologous chromosome pairing have been developed in different organisms. As present-day organisms are the consequence of selection through evolution, comparative studies in several model organisms using a wide spectrum of strategies are necessary to obtain insights into the essentials of meiosis. Experimental Procedures Strains and Culture Media The fission yeast strains used in this study are listed in Supplemental Table S1 (http://www.developmentalcell.com/cgi/content/full/6/3/ 329/DC1). The mutants used in this study were described previously: dhc1-d3::LEU2, dhc1-d4::ura4⫹ (Yamamoto et al., 1999),

Developmental Cell 340

⌬taz1::ura4⫹ (Cooper et al., 1997), and rec12-152::LEU2 (Lin and Smith, 1994). The ⌬rec12::kanr was a gift from Dr. Molnar; it was created according to the method of Ba¨hler (Ba¨hler et al., 1998). In this construct, the whole ORF of rec12 was replaced by the kanMX6 module. The construction of the GFP histone H3 fusion (hht2⫹-GFP) was described previously (Wang et al., 2002). Media used in this study were prepared as described by Moreno (Moreno et al., 1991) except that EMM medium lacking a nitrogen source (EMM-N) was used for live observation of meiotic cells. The genetic techniques used in this study are also described in Moreno et al. (1991). Fluorescence Visualization of Chromosome Loci Chromosomal loci were visualized by the lac repressor (lacI)/lac operator (lacO) recognition system (Nabeshima et al., 1998; Robinett et al., 1996; Straight et al., 1996). The version of lacI protein that prevents tetramerization constructed in Nabeshima et al. (1998) was used in this study. Tandem repeats of the lacO sequence were integrated at chromosome loci, and a GFP-tagged lacI protein, which specifically binds to the lacO sequence, visualized the loci. The GFP-tagged lacI that is expressed from the dis1 promoter is derived from strain MKY7A-4 (Nabeshima et al., 1998). Integration of the lacO repeats at the lys1⫹ (Nabeshima et al., 1998), cut3⫹ (Nabeshima et al., 2001), ade6⫹, ade8⫹, cen2-proximal loci (Yamamoto and Hiraoka, 2003), and his2⫹ (Shimada et al., 2003), were described previously. The strain carrying lacO repeats at the ade3⫹ locus is a gift of Drs. T. Shimada and M. Yamamoto (Shimada et al., 2003). The lacO repeats were integrated at the sod2-proximal locus by the two-step integration method (Yamamoto and Hiraoka, 2003). Two genomic DNA fragments derived from a chromosomal region ⵑ2 kb upstream of the sod2 gene were amplified by PCR using two sets of synthetic oligonucleotides (GCCTGCCCGGTTACA CAGCAT and TTAATTAACCCGGGGATCCGCTGACGCATGTATAG ACAACT; GTTTAAACGAGCTCGAATTCATTGGCCAAGTTACTCAT CCGC and AGAGGATAACAACCGAGACTT). Then a DNA fragment containing a partial ura4 gene and the kanr gene was amplified by PCR using the amplified genomic DNA fragments as primers and the plasmid pCT33-6 as a template. The amplified ura4 containing DNA fragment was integrated at the sod2-upstream locus using the kanr gene as a selection marker. Subsequently, the plasmid pCT31 containing the lacO repeats was integrated into the locus using the ura4 sequence as a target. At all steps, integration was confirmed by colony PCR and Southern hybridization analyses. Live Observations of Homologous Chromosome Pairing Cells were grown on solid YES medium at 33⬚C. To induce meiosis, the cells were transferred to solid ME medium and incubated at 26⬚C for about 12 hr. They were then suspended in EMM-N medium supplemented with appropriate amino acids for live observations. The cell suspension was placed on a 35 mm glass-bottom culture dish (MatTek Corp., Ashland, MA) coated with 0.2% (w/v) concanavalin A. The behavior of GFP-labeled chromosomal loci in meiotic cells was examined at 26⬚C as described previously (Ding et al., 1998). A set of images from 10 focal planes with 0.3 ␮m intervals was taken every 5 min. At least 20 individual zygotes were observed for each experiment. Fluorescence microscope images were obtained by the DeltaVision microscope system (Applied Precision, Inc.) set up in a temperature-control room as described previously (Haraguchi et al., 1999). Data analysis was carried out using the SoftWoRx software on the DeltaVision system. Acknowledgments We thank Jianhua Liu, Mohan K. Balasubramanian, Kentaro Nabeshima, Hiroshi Nojima, Monika Molnar, Tadayuki Shimada, Masayuki Yamamoto, and Mitsuhiro Yanagida for providing fission yeast strains; Nobuko Sakurai and Chihiro Tsutsumi for technical assistance; Akira Shinohara and Julia P. Cooper for helpful discussion; David Alexander and Akira Shinohara for critical reading of the manuscript. This work was supported by grants from Japan Science and Technology Corporation and Human Frontier Science Program to Y.H.

Received: November 21, 2003 Revised: January 24, 2004 Accepted: January 26, 2004 Published: March 15, 2004 References Ba¨hler, J., Wyler, T., Loidl, J., and Kohli, J. (1993). Unusual nuclear structures in meiotic prophase of fission yeast: a cytological analysis. J. Cell Biol. 121, 241–256. Ba¨hler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A., 3rd, Steever, A.B., Wach, A., Philippsen, P., and Pringle, J.R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–951. Cervantes, M.D., Farah, J.A., and Smith, G.R. (2000). Meiotic DNA breaks associated with recombination in S. pombe. Mol. Cell 5, 883–888. Cha, R.S., Weiner, B.M., Keeney, S., Dekker, J., and Kleckner, N. (2000). Progression of meiotic DNA replication is modulated by interchromosomal interaction proteins, negatively by Spo11p and positively by Rec8p. Genes Dev. 14, 493–503. Chikashige, Y., and Hiraoka, Y. (2001). Telomere binding of the Rap1 protein is required for meiosis in fission yeast. Curr. Biol. 11, 1618– 1623. Chikashige, Y., Ding, D.Q., Funabiki, H., Haraguchi, T., Mashiko, S., Yanagida, M., and Hiraoka, Y. (1994). Telomere-led premeiotic chromosome movement in fission yeast. Science 264, 270–273. Colaiacovo, M.P., MacQueen, A.J., Martinez-Perez, E., McDonald, K., Adamo, A., La Volpe, A., and Villeneuve, A.M. (2003). Synaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination. Dev. Cell 5, 463–474. Cooper, J.P., Watanabe, Y., and Nurse, P. (1998). Fission yeast Taz1 protein is required for meiotic telomere clustering and recombination. Nature 392, 828–831. Cooper, J.P., Nimmo, E.R., Allshire, R.C., and Cech, T.R. (1997). Regulation of telomere length and function by a Myb-domain protein in fission yeast. Nature 385, 744–747. Dernburg, A.F., Sedat, J.W., and Hawley, R.S. (1996). Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell 86, 135–146. DeVeaux, L.C., and Smith, G.R. (1994). Region-specific activators of meiotic recombination in Schizosaccharomyces pombe. Genes Dev. 8, 203–210. De Veaux, L.C., Hoagland, N.A., and Smith, G.R. (1992). Seventeen complementation groups of mutations decreasing meiotic recombination in Schizosaccharomyces pombe. Genetics 130, 251–262. Ding, D.Q., Chikashige, Y., Haraguchi, T., and Hiraoka, Y. (1998). Oscillatory nuclear movement in fission yeast meiotic prophase is driven by astral microtubules, as revealed by continuous observation of chromosomes and microtubules in living cells. J. Cell Sci. 111, 701–712. Ekwall, K., Javerzat, J.P., Lorentz, A., Schmidt, H., Cranston, G., and Allshire, R. (1995). The chromodomain protein Swi6: a key component at fission yeast centromeres. Science 269, 1429–1431. Ferreira, M.G., and Cooper, J.P. (2001). The fission yeast Taz1 protein protects chromosomes from Ku-dependent end-to-end fusions. Mol. Cell 7, 55–63. Haraguchi, T., Ding, D.Q., Yamamoto, A., Kaneda, T., Koujin, T., and Hiraoka, Y. (1999). Multiple-color fluorescence imaging of chromosomes and microtubules in living cells. Cell Struct. Funct. 24, 291–298. Hawley, R.S., McKim, K.S., and Arbel, T. (1993). Meiotic segregation in Drosophila melanogaster females: molecules, mechanisms, and myths. Annu. Rev. Genet. 27, 281–317. Hillers, K.J., and Villeneuve, A.M. (2003). Chromosome-wide control of meiotic crossing over in C. elegans. Curr. Biol. 13, 1641–1647. Hiraoka, Y. (1998). Meiotic telomeres: a matchmaker for homologous chromosomes. Genes Cells 3, 405–413.

Dynamics of Meiotic Homologous Chromosome Pairing 341

Hunter, N. (2003). Synaptonemal complexities and commonalities. Mol. Cell 12, 533–535.

for two RecA homologs in promoting meiotic chromosome synapsis. Genes Dev. 9, 2684–2695.

Kanoh, J., and Ishikawa, F. (2001). spRap1 and spRif1, recruited to telomeres by Taz1, are essential for telomere function in fission yeast. Curr. Biol. 11, 1624–1630.

Scherthan, H. (2001). A bouquet makes ends meet. Nat. Rev. Mol. Cell Biol. 2, 621–627.

Karpen, G.H., Le, M.H., and Le, H. (1996). Centric heterochromatin and the efficiency of achiasmate disjunction in Drosophila female meiosis. Science 273, 118–122. Keeney, S., Giroux, C.N., and Kleckner, N. (1997). Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88, 375–384. Kohli, J., and Ba¨hler, J. (1994). Homologous recombination in fission yeast: absence of crossover interference and synaptonemal complex. Experientia 50, 295–306. Krawchuk, M.D., DeVeaux, L.C., and Wahls, W.P. (1999). Meiotic chromosome dynamics dependent upon the rec8(⫹), rec10(⫹) and rec11(⫹) genes of the fission yeast Schizosaccharomyces pombe. Genetics 153, 57–68. Lin, Y., and Smith, G.R. (1994). Transient, meiosis-induced expression of the rec6 and rec12 genes of Schizosaccharomyces pombe. Genetics 136, 769–779.

Scherthan, H., Ba¨hler, J., and Kohli, J. (1994). Dynamics of chromosome organization and pairing during meiotic prophase in fission yeast. J. Cell Biol. 127, 273–285. Sharif, W.D., Glick, G.G., Davidson, M.K., and Wahls, W.P. (2002). Distinct functions of S. pombe Rec12 (Spo11) protein and Rec12dependent crossover recombination (chiasmata) in meiosis I; and a requirement for Rec12 in meiosis II. Cell Chromosome 1, 1. Shimada, T., Yamashita, A., and Yamamoto, M. (2003). The fission yeast meiotic regulator Mei2p forms a dot structure in the horsetail nucleus in association with the sme2 locus on chromosome II. Mol. Biol. Cell 14, 2461–2469. Shimanuki, M., Miki, F., Ding, D.Q., Chikashige, Y., Hiraoka, Y., Horio, T., and Niwa, O. (1997). A novel fission yeast gene, kms1⫹, is required for the formation of meiotic prophase-specific nuclear architecture. Mol. Gen. Genet. 254, 238–249.

Loidl, J. (1990). The initiation of meiotic chromosome pairing: the cytological view. Genome 33, 759–778.

Storlazzi, A., Tesse, S., Gargano, S., James, F., Kleckner, N., and Zickler, D. (2003). Meiotic double-strand breaks at the interface of chromosome movement, chromosome remodeling, and reductional division. Genes Dev. 17, 2675–2687.

MacQueen, A.J., Colaiacovo, M.P., McDonald, K., and Villeneuve, A.M. (2002). Synapsis-dependent and -independent mechanisms stabilize homolog pairing during meiotic prophase in C. elegans. Genes Dev. 16, 2428–2442.

Straight, A.F., Belmont, A.S., Robinett, C.C., and Murray, A.W. (1996). GFP tagging of budding yeast chromosomes reveals that proteinprotein interactions can mediate sister chromatid cohesion. Curr. Biol. 6, 1599–1608.

Molnar, M., Ba¨hler, J., Sipiczki, M., and Kohli, J. (1995). The rec8 gene of Schizosaccharomyces pombe is involved in linear element formation, chromosome pairing and sister-chromatid cohesion during meiosis. Genetics 141, 61–73.

Sym, M., and Roeder, G.S. (1994). Crossover interference is abolished in the absence of a synaptonemal complex protein. Cell 79, 283–292.

Molnar, M., Ba¨hler, J., Kohli, J., and Hiraoka, Y. (2001). Live observation of fission yeast meiosis in recombination-deficient mutants: a study on achiasmate chromosome segregation. J. Cell Sci. 114, 2843–2853. Moreno, S., Klar, A., and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795–823. Nabeshima, K., Nakagawa, T., Straight, A.F., Murray, A., Chikashige, Y., Yamashita, Y.M., Hiraoka, Y., and Yanagida, M. (1998). Dynamics of centromeres during metaphase-anaphase transition in fission yeast: Dis1 is implicated in force balance in metaphase bipolar spindle. Mol. Biol. Cell 9, 3211–3225. Nabeshima, K., Kakihara, Y., Hiraoka, Y., and Nojima, H. (2001). A novel meiosis-specific protein of fission yeast, Meu13p, promotes homologous pairing independently of homologous recombination. EMBO J. 20, 3871–3881. Neale, M.J., Ramachandran, M., Trelles-Sticken, E., Scherthan, H., and Goldman, A.S. (2002). Wild-type levels of Spo11-induced DSBs are required for normal single-strand resection during meiosis. Mol. Cell 9, 835–846. Nimmo, E.R., Pidoux, A.L., Perry, P.E., and Allshire, R.C. (1998). Defective meiosis in telomere-silencing mutants of Schizosaccharomyces pombe. Nature 392, 825–828. Niwa, O., Shimanuki, M., and Miki, F. (2000). Telomere-led bouquet formation facilitates homologous chromosome pairing and restricts ectopic interaction in fission yeast meiosis. EMBO J. 19, 3831–3840. Page, S.L., and Hawley, R.S. (2003). Chromosome choreography: the meiotic ballet. Science 301, 785–789. Peoples, T.L., Dean, E., Gonzalez, O., Lambourne, L., and Burgess, S.M. (2002). Close, stable homolog juxtaposition during meiosis in budding yeast is dependent on meiotic recombination, occurs independently of synapsis, and is distinct from DSB-independent pairing contacts. Genes Dev. 16, 1682–1695. Robinett, C.C., Straight, A., Li, G., Willhelm, C., Sudlow, G., Murray, A., and Belmont, A.S. (1996). In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J. Cell Biol. 135, 1685–1700. Rockmill, B., Sym, M., Scherthan, H., and Roeder, G.S. (1995). Roles

Walker, M.Y., and Hawley, R.S. (2000). Hanging on to your homolog: the roles of pairing, synapsis and recombination in the maintenance of homolog adhesion. Chromosoma 109, 3–9. Wang, H., Tang, X., Liu, J., Trautmann, S., Balasundaram, D., McCollum, D., and Balasubramanian, M.K. (2002). The multiprotein exocyst complex is essential for cell separation in Schizosaccharomyces pombe. Mol. Biol. Cell 13, 515–529. Weiner, B.M., and Kleckner, N. (1994). Chromosome pairing via multiple interstitial interactions before and during meiosis in yeast. Cell 77, 977–991. Yamamoto, A., and Hiraoka, Y. (2001). How do meiotic chromosomes meet their homologous partners?: lessons from fission yeast. Bioessays 23, 526–533. Yamamoto, A., and Hiraoka, Y. (2003). Monopolar spindle attachment of sister chromatids is ensured by two distinct mechanisms at the first meiotic division in fission yeast. EMBO J. 22, 2284–2296. Yamamoto, A., West, R.R., McIntosh, J.R., and Hiraoka, Y. (1999). A cytoplasmic dynein heavy chain is required for oscillatory nuclear movement of meiotic prophase and efficient meiotic recombination in fission yeast. J. Cell Biol. 145, 1233–1249. Zickler, D., and Kleckner, N. (1999). Meiotic chromosomes: integrating structure and function. Annu. Rev. Genet. 33, 603–754.