Early expression of zona pellucida proteins under octylphenol exposure in Cichlasoma dimerus (Perciformes, Cichlidae)

Aquatic Toxicology 101 (2011) 175–185

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Early expression of zona pellucida proteins under octylphenol exposure in Cichlasoma dimerus (Perciformes, Cichlidae) ˜ a,b , David W. Towle c , Griselda Genovese a,b,c,∗ , Rodrigo Da Cuna a,b María C. Maggese , Fabiana Lo Nostro a,b a b c

Laboratorio de Embriología Animal. DBBE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires C1428EHA, Argentina Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Rivadavia 1917, Buenos Aires C1033AAJ, Argentina Mount Desert Island Biological Laboratory, Salisbury Cove 04672, ME, USA

a r t i c l e

i n f o

Article history: Received 17 May 2010 Received in revised form 21 September 2010 Accepted 25 September 2010 Keywords: Zona pellucida proteins Vitellogenin Gene expression Octylphenol 17␤-Estradiol Cichlid fish

a b s t r a c t An increasing number of widely used industrial and agricultural chemicals are being found to cause endocrine disruption. In fishes, xenoestrogens can induce female proteins, and in some cases, the development of testis-ova, demonstrating feminization of males. In this study we analyzed the effect of an acute exposure of adult male Cichlasoma dimerus fish to estradiol (E2 ) and octylphenol (OP). E2 and OP were injected at 10 and 50 ␮g/g body weight doses, respectively. After a single OP dose, liver was processed for RNA extraction at 1, 3, 12, 24, and 72 h. PCR was performed using cDNA and primers for egg coat or zona pellucida proteins (ZP). Genes encoding ZPB and ZPC isoforms were sequenced. E2 -induced fish were sacrificed at 72 h. Using multiple OP or E2 injections, blood and surface mucus were sampled on days 0, 3, 6, 9, and 13. On day 13 fish were sacrificed for liver and testis dissection. Histological examination of E2 and OP-treated fish livers showed cellular disarray and intense cytoplasmatic basophilia within hepatocytes, probably due to increased mRNA synthesis, as well as hypertrophied euchromatic nuclei, and conspicuous nucleoli, indicative of augmented cell activity. An abnormal amount of sperm and immature germ cells within the testis lumen were seen in treated fish, suggesting reproductive impairment. Both plasma and mucus revealed the presence of ZP (and vitellogenin) at day 3 and thereafter with E2 treatment, using Western and Dot blot techniques; OP effects were delayed in time. These results validate the analysis of mucus by Dot blot as an easy and rapid technique to address endocrine disruption caused by OP. Quantitative gene expression showed induction of liver ZPB and ZPC upon OP injection; muscle, brain, and intestine did not express any ZP. Both ZPs were induced at 1 h post injection, but only ZPB expression was statistically significant. At 12 h, both ZPs increased significantly, reaching the same levels of E2 -challenged males after 72 h. Therefore, OP mimicked the action of E2 with a prompt and strong xenoestrogenic effect, evidenced by the early response through mRNA and protein expression of ZP and the concomitant histological liver and testis alterations. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Numerous industrial and agricultural chemicals concentrate in the aquatic biota and have been found to elicit a host of adverse effects in humans and wildlife. Some of these chemicals have been reported to modulate, mimic or antagonize the action of sex steroid hormones. In this respect, the decreasing trend in male

Abbreviations: ZP, zona pellucida proteins; VTG, vitellogenin; OP, octylphenol; E2 , 17␤-estradiol; ER, estrogen receptor. ∗ Corresponding author at: Laboratorio de Embriología Animal. DBBE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires C1428EHA, Argentina. Tel.: +54 11 4576 3348; fax: +54 11 4576 3384. E-mail address: [email protected] (G. Genovese). 0166-445X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2010.09.017

fertility, including congenital malformations and testicular cancer in humans, augments concern (Saradha and Mathur, 2006). The pollutants that exhibit estrogenic activity include organochlorine insecticides, some phthalate plasticizers, and industrial chemicals such as nonylphenol, bisphenol A, and polychlorinated biphenyls (PCBs) (Sonnenschein and Soto, 1998; Arukwe et al., 2000; van der Oost et al., 2003). Certain structural features, such as an overall ring structure, are important for binding to estrogen receptors (ER) (Blair et al., 2000), though some of these chemically diverse agents differ from steroidal estrogens and still can mimic or counteract estrogenic actions by their ability to bind to and successfully compete with estradiol for the estrogen binding sites (Danielian et al., 1993; White et al., 1994; Tollefsen et al., 2002). The reproductive disorders caused in wildlife by these estrogen-like substances, known as xenoestrogens, include egg shell thinning, developmen-

176

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

tal alterations, altered hormone concentration in adults, changes in socio-sexual behavior, impaired viability of offspring, among others (Jobling and Sumpter, 1993; Ahel et al., 1993; Jobling et al., 1996; Iguchi et al., 2001; Fox, 2001; Arukwe and Goksøyr, 2003; Robinson et al., 2004). These effects lead to reduced reproductive success, consequently affecting population growth and biodiversity. In particular, in fish, 17␤-estradiol and 17␣-ethinylestradiol (present in sewage effluents) have been reported to affect sex differentiation leading to the development of testis-ova and complete feminization (Kang et al., 2002; Andersen et al., 2003; Jobling et al., 2006; Milnes et al., 2006). Alkylphenols such as nonylphenol (NP), octylphenol (OP) and related compounds are biodegradation products of alkylphenol polyethoxylates, a group of non-ionic surfactants used in the manufacture of detergents, paints, pesticides and cosmetics. NP is used in the production of plastics such as polystyrene and polyvinyl chloride (PVC). They have been detected in surface waters and effluents in high concentrations but due to their chemical properties, they are easily adsorbed onto sediments (Ying et al., 2002). There is scarce information about the levels of APs in the aquatic environment in South America. Even though Fiedler et al. (2006) reported low levels of APs in a rural area of Brazil, OP was the dominant one and much higher values can be expected in densely populated urban environments. In Argentina up to 5 ␮g/g and 20 ␮g/L of NP were detected in sediments and water creeks of the Buenos Aires conurbation, respectively (Meijide, 2007). Concentrations of APs detected in aquatic animals were as high as 1.4 ␮g/g bodyweight (Ferrara et al., 2005; David et al., 2009). It has been reported that OP has a half-life of 1.7 days in liver of fish and does not accumulate in that organ (Pedersen and Hill, 2002; Pedersen et al., 2003). OP and NP have been shown to be estrogenic, capable of inducing the expression of vitellogenin (VTG) and egg coat proteins, though to a lesser extent than estradiol (White et al., 1994; Arukwe et al., 2002), hence high doses (above 40 ␮g/g) are necessary to elicit an acute estrogenic response. Additionally, Sundt et al. (2009) demonstrated elimination of alkylphenols in fish through the liver-bile-faeces excretion pathway. VTG, a complex phospholipoglycoprotein, is synthesized in the liver of non-mammalian vertebrates in response to estrogen and transferred to the ovaries through the bloodstream. This complex precursor is taken up by growing oocytes and enzymatically cleaved into yolk proteins, which are stored as nutrient reserves once oogenesis is completed. These proteins provide nutrients to the developing embryo and buoyancy to the eggs. As stated by Spargo and Hope (2003), a glycoprotein coat with similar gross structure and function surrounds all ovulated vertebrate oocytes. The egg coat proteins, known as zona pellucida proteins (ZP), choriogenin, vitelline envelope proteins and zona radiata proteins, mediate sperm-oocyte binding, induction of acrosome reaction, sperm penetration and eggshell hardening, and prevent polyspermy in vertebrates (Modig et al., 2007). In the present study, we use the term ZP, following the unified nomenclature proposed by Spargo and Hope (2003). ZP subfamilies include ZPA, ZPB (including alpha and beta isoforms), ZPC (also known as gamma), and ZPX, and a phylogenetic tree has been proposed to show relatedness among vertebrates; new subfamilies are still being identified (Benson et al., 2009; Izquierdo-Rico et al., 2009). Vertebrate ZP is mainly composed of three to six glycoproteins (Modig et al., 2006; Izquierdo-Rico et al., 2009), which are deposited around the oocytes during zonagenesis. In fish, the egg envelope is thicker than in mammals providing also physical protection against mechanical disturbances from the environment for the developing embryo during the first fragile period (Yamagami et al., 1992). In many fishes, synthesis of ZP is carried out in the liver of adult females, under estrogenic control (Arukwe and Goksøyr,

2003). Zonagenesis precedes vitellogenesis, since the initial formation of the eggshell occurs before the active uptake of vitellogenin (Hyllner et al., 1994; Celius and Walther, 1998). In most species, juveniles and male fish normally do not produce ZP or VTG, but estrogens or xenoestrogens can induce their expression requiring only basal ER concentrations. When this basal ER concentration is depleted, ER gene transcription may begin, resulting in continued transcription of ZP and VTG genes (Yadetie et al., 1999; Arukwe et al., 2001; Bowman et al., 2002). In other fish species, including many salmonids, ER gene expression peaked before VTG induction (Bowman et al., 2002). The family Cichlidae is one of the largest perciform families (Nelson, 2006), an important group of relatively large and often colorful aquarium fishes. Cichlasoma dimerus inhabits inland waters (Parana and Paraguay Rivers’ basins) of Brazil and Argentina. This species adapts easily to captivity, has notable reproductive features (complex social and breeding behavior, parental care, a high spawning frequency) and acceptable survival rates, proving a good model for laboratory studies (Meijide and Guerrero, 2000; reviewed in Pandolfi et al., 2009). It has been used for ecotoxicological testing in previous studies (Moncaut et al., 2003; Rey Vázquez et al., 2009), and is included as a suitable native species for the determination of the lethal acute toxicity of xenobiotics by the Argentinean Institute of Standarization and Certification (IRAM, 2008). Few studies have dealt with induction of ZP after a shortexposure to octylphenol in fish (Knudsen et al., 1998; Rhee et al., 2009), and since ZP has been proved to be more sensitive than VTG (Arukwe et al., 1997, Celius et al., 2000), it can be used as an early biomarker of xenoestrogenicity. The aim of this study was to analyze the early expression of zona pellucida proteins and vitellogenin and the concomitant histological alterations due to the acute exposure of specimens of C. dimerus to 4-tert-octylphenol, to better understand the underlying mechanisms behind the action of xenoestrogens. 2. Materials and methods 2.1. Animals Adult fish were captured in Esteros del Riachuelo, Corrientes Province, Argentina (27◦ 25 S, 58◦ 15 W). Prior to experimentation, animals (44 ± 3 g body weight, 12.6 ± 0.3 cm total length) were acclimated to laboratory conditions for a month in 100 L glass aquaria, with external filtration, constant aeration and temperature of 26 ± 1 ◦ C, pH 7.3 and a 12:12 h photoperiod. Fish were fed daily with pellet food (Tetra® food sticks). 2.2. Protein detection 2.2.1. Experimental design In a first series of experiments, male fish (N = 5 per treatment) were intraperitoneally (i.p.) injected with 10 ␮g/g of body weight (bw) 17␤-estradiol (E2 ; Sigma–Aldrich, USA), to generate a strong estrogenic response according to a previous study (Moncaut et al., 2003), or 50 ␮g/g bw octylphenol (OP, 4-tert-octylphenol >97% purity; Sigma–Aldrich, USA) to elicit an acute response according to Pedersen et al. (2003). Injections were administered on days 0, 3, 6, and 9; on day 13 fish were sacrificed by decapitation (Canadian Council on Animal Care, 2005). Both chemicals were dissolved in ethanol and resuspended in 0.9% saline solution; corn oil was added as a vehicle before injecting sedated fish (dose: 6 drops/2 L; active ingredients: acetone, dimethylketone alpha methyl quinoline; Fish Sedate, USA). Control males were injected with saline solution and corn oil. Mature females were used as positive controls. For the duration of the experiment fish were kept individually

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

in 20 L aquaria in the same conditions mentioned for acclimation.

2.2.2. Sample collection Before each injection and at the end of the experiment, body weight was measured, blood and mucus samples were collected from the caudal vein (heparin-coated syringe, 27 gauge × 1/2 in. needle) and scraped from the body surface (metal spatula), respectively. 10 ␮L of protease inhibitor cocktail (Sigma–Aldrich, USA) were added to all samples. Mucus samples were also mixed with 200 ␮L of PBST (phosphate buffer saline, 0.1 M, pH 7.4, 0.5% Tween 20). After centrifugation at 3000 rpm for 15 min at 4 ◦ C, plasma and mucus free of debris and scales were stored at −20 ◦ C, until analysis by SDS-PAGE Western blot and Dot blot. Protein concentrations were measured by Lowry‘s method using bovine serum albumin (BSA) as a standard (Lowry et al., 1951).

2.2.3. SDS-PAGE, Western and Dot blots Samples with equal amounts of protein (40 ␮g for plasma; 50 ␮g for mucus) were mixed with loading buffer (120 mM Tris–HCl, pH 6.8, 3% sodium dodecyl sulfate, 10% glycerol, 2% bromophenol blue and 1% ␤-mercaptoethanol, boiled for 5 min and briefly spun down before loading them into polyacrylamide gel wells. Molecular weight standard was loaded in a separate well (SeeBlue Plus2 Pre-Stained Standard, Invitrogen Corporation, USA). A sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE), as described by Laemmli (1970), was performed at constant 100 V using 4% stacking and 8% separating gel (Mini-Protean III, Bio-Rad, USA) and 124 mM Tris–HCl, pH 8.8 running buffer. Transference to nitrocellulose membranes (ECL Amersham Biosciences, UK) was done at 100 V for 90 min, in 25 mM Tris, 187 mM glycine and 20% methanol. Subsequently, membranes were soaked with TTBS (100 mM Tris–HCl, 0.9% NaCl, 0.1% Tween 20, pH 7.5), and endogenous peroxidases were blocked with 2% 30 vol H2 O2 in TTBS for 5 min. Afterwards, unspecific binding sites were blocked with 3% skimmed milk and 3% BSA in TTBS overnight at 4 ◦ C. Zona pellucida proteins (ZP) were immunodetected using mouse anti-salmon ZP monoclonal antibody (Salmo salar; MN8C4, Biosense Laboratories, Norway) 1:500 overnight at 4 ◦ C. For vitellogenin (VTG) immunodetection, membranes were incubated with rabbit anti-perch VTG antiserum 1:2000 for 90 min at RT (Perca fluviatilis; donated by Dr. B. Allner, Germany; see Hennies et al., 2003). After three 5-min washes with TTBS, membranes were incubated with biotinylated anti-mouse secondary antibody (for ZP) or biotinylated anti-rabbit secondary antibody (for VTG) 1:1000 for 1 h at RT, ABC (Dako, USA) 1:3000 for 1 h, and 0.1% 3,3 -diaminobenzidine in Tris–HCl buffer (Dako, USA) for 5 min, for amplification and detection of the signal. For both proteins, omission of the primary antibody was also performed (not shown). Membranes were scanned and molecular weights were estimated using SigmaGel software (Jandel Scientific software 1.0, USA). Dot blot analysis was performed adding a fixed amount of protein to a nitrocellulose membrane and following the aforementioned protocol for Western blots.

177

2.4. Gene expression 2.4.1. Experimental design For gene expression analysis, in a second series of experiments, male fish (N = 4) were i.p. injected with a single dose of OP (50 ␮g/g bw) or saline solution and corn oil, and were sacrificed at 0, 1, 3, 12, 24, and 72 h. In parallel, male and female fish were i.p. injected with a single dose of E2 (10 ␮g/g bw) and sacrificed at 72 h. Liver, muscle, intestine, and brain samples were immersed in 2 mL cold RNAlater (Ambion, USA) for 24 h and then frozen at −20 ◦ C until processing (according to product specifications for short term storage). 2.4.2. RNA extraction, sequencing, and quantitative mRNA expression RNA was extracted and purified following the phenol–chloroform–isoamyl alcohol protocol (RNAgent total RNA isolation system, Promega Corporation, USA). Quantification and quality of RNA were analyzed with RNA 6000 Nano Chip Kit and Agilent 2100 Bioanalyzer. Poly-A mRNA was reverse transcribed using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, USA). Degenerate primers for ZPB and ZPC were designed based on sequences of different fish species available in the GenBank database at NCBI (http://www.ncbi.nlm.nih.gov). For ZPB the forward and reverse primers were 5 GYNACNGTNCARTGYACNAARGA3 and 5 RTCRTCNKSRTANGGRCANCC3 , respectively. For ZPC 5 GCNGYNGTNATHGTNGARTGYCAYTA3 , and 5 RAANCKRAANGCYTCNARYTGRAA3 . Conventional PCR was performed at an annealing temperature of 55 ◦ C using RedTaq polymerase (Sigma REDTaq® ReadyMixTM PCR Reaction Mix), and amplification products were isolated electrophoretically on 0.8% agarose gels (Promega Corporation, USA). Following gel extraction with a MinElute Gel Extraction Kit (Qiagen, USA), amplification products were sequenced, analyzed, trimmed (Chromas 2.33, http://www.technelysium.com.au), and submitted to BLASTX analysis for tentative functional identification at NCBI. Alignment of sequences between different fish species and cladograms were performed with Clustal W2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html). Species-specific primers were designed for quantitative mRNA expression. For ZPB the forward and reverse primers were 5 CAGAAACGCCACTCTACCCAACA 3 and 5 TCCTCCTCTTCAATGCAACCCT 3 , respectively; and for ZPC, 5 AGTTCCTCTATTTCACCCTGAC 3 and 5 TCTACTATCAATCATACACCCTTG 3 . cDNA was amplified in the presence of SYBRGreen dye using Qiagen Quantitect chemistry and the Stratagene MX4000 Multiplex Quantitative PCR System. Liver RNA from estrogenized females was used for the standard curve to normalize data. A dilution series demonstrated a linear relationship between threshold cycle (Ct) and log 10 of template availability. 2.5. Statistical analysis Repeated measures one-way ANOVA test followed by Dunnett’s multiple comparisons was performed for body weight. For gene expression comparison, non-parametric test was done using Kruskal–Wallis test followed by Dunn’s multiple comparison test. In both cases, a free version of Graph Pad Prism 4 software (http://www.graphpad.com) was used.

2.3. Histological analysis 3. Results Liver and testis were fixed in Bouin’s solution for histological processing. Subsamples were dehydrated and embedded in Paraplast (Oxford, USA). 7 ␮m thick sections were stained with hematoxylin-eosin. Photomicrographs were taken with a NikonMicrophot FX microscope.

3.1. Survival and growth No mortality was registered in any of the experiments. In the first series, fish body weight remained constant during the exper-

178

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 1. Western (A, B, E, F, i) and Dot blot (C, D, G, H, J) analysis of zona pellucida proteins (ZP) from plasma and mucus samples of 17␤-estradiol and octylphenol-injected males of Cichlasoma dimerus. A mouse anti-salmon ZP monoclonal antibody (Salmo salar; MN-8C4, Biosense Laboratories, Norway), was used for immunodetection. Dot blot results parallel those of Western blots, except for OP treatment. A normal pattern of ZP bands in a mature female is shown (i). No ZP was found in control males. Numbers at the left of each sub-figure represent molecular weight in kilodaltons. Omission of the primary antibody was performed and no bands were detected in any sample (data not shown).

iment in the control group (p > 0.05); it significantly decreased 6% after day 9 in E2 -injected animals, and 8% on day 13 in OPchallenged fish (p < 0.05). No difference in feeding behavior (food ingestion) was seen in any of the treatments during the experimental period. 3.2. ZP and VTG immunodetection SDS-PAGE followed by Western blot analysis of plasma samples of control vitellogenic C. dimerus females revealed a normal pattern of four ZP bands: 71.0 ± 0.6, 66.2 ± 0.4, 56.5 ± 0.4 and 54.3 ± 0.2 kDa (Fig. 1i, female lane), and four VTG bands: 121.5 ± 0.6 (the broader band), 111 ± 1, 106.4 ± 0.6 and 74.0 ± 0.9 kDa (Fig. 2i, female lane). In spawning females an additional band of 190 kDa could be detected. Control males did not exhibit any ZP or VTG bands (Figs. 1 and 2A–B and E–F, lanes marked with 0). At day 3 of 17␤-estradiol (E2 ) injection, plasma of male fish became ZP- and VTG-immunoreactive (Figs. 1A and 2A, lanes marked with 3). For both proteins, in addition to the bands observed in mature females, several extra bands of higher and lower molecular weights were detected. Induction continued till the end of the experiment (day 13) (Figs. 1 and 2A, lanes marked with 3, 6, 9, and 13). Similarly, OP induced VTG and ZP in plasma of treated male fish at day 3 and 6, respectively. No additional ZP bands were detected with OP injection (Figs. 1 and 2E). Neither control males nor control females showed immunoreactivity of ZP and VTG in mucus scraped from body surface. Mucus samples evidenced ZP and VTG bands on day 3 with a single E2 injection (Figs. 1 and 2B, lane marked with 3). Under OP treatment, ZP and VTG were first detected on days 6 and 9, respectively

(Figs. 1 and 2F). For both treatments, the predominant ZP bands detected in males’ mucus were the two higher MW bands found in plasma of mature females. Immunodetection of ZP and VTG by Dot blot of plasma of a mature female is represented by Figs. 1J and 2J, respectively. Detection of ZP and VTG of plasma and mucus samples of E2 -injected males occurred on the same days of treatment as Western blots (Figs. 1C and D and 2C and D). Under OP treatment, plasma ZP and VTG were detected later in time in Dot blots than in Western blots (Figs. 1 and 2G). In contrast, mucus immunoreaction preceded the ones obtained in Western blots (Figs. 1 and 2H). Comparing the obtained results from WB and Dot blot techniques provides useful validation of the latter, since Dot blot represents an easy and rapid method for evaluating estrogenic effects in the field, as it does not require the use of lab equipment. 3.3. Histological analysis Liver of C. dimerus is composed of hepatocytes arranged around blood sinusoids and dispersed pancreatic tissue. In control animals, hepatocytes possessed an eccentric nucleus, occasionally one nucleolus was seen, and the cytoplasm appeared vacuolated and weakly eosinophilic in hematoxylin-eosin sections (Fig. 3A). On the contrary, the liver of E2 -injected males showed signs of cellular disarray since rows of hepatocytes were hardly identified. These cells had hypertrophic and euchromatic nuclei with conspicuous nucleoli and an intense cytoplasmic basophilia. A reduction in vacuolization of the cytoplasm was also evident (Fig. 3C). OP treatment caused similar alterations, though they were less pronounced (Fig. 3 E).

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

179

Fig. 2. Western (A, B, E, F, i) and Dot blot (C, D, G, H, J) analysis of vitellogenin (VTG) from plasma and mucus samples of 17␤-estradiol and octylphenol-injected males of Cichlasoma dimerus. A rabbit anti-perch VTG antiserum (Perca fluviatilis; donated by Dr. B. Allner, Germany) was used for immunodetection. Dot blot results parallel those of Western blots, except for OP treatment. A normal pattern of VTG bands in a mature female is shown (i). No VTG was found in control males. Numbers at the left of each sub-figure represent molecular weight in kilodaltons. Omission of the primary antibody was performed and no bands were detected in any sample (data not shown).

C. dimerus possesses a lobular unrestricted testis type. Control males showed the typical cytoarchitecture in this species, with all spermatogenic stages present within the spermatocysts and sperm in the lobular lumen (Fig. 3B). After E2 injection, immature germ cells and an abnormal predominance of sperm were seen within the lumen, and spermatogonia were the only cell type lining the lobule wall (Fig. 3D). Treatment with OP showed the same but less noticeable modifications (Fig. 3 F). 3.4. Zona pellucida (ZP) partial sequence and gene expression Conventional PCR was performed with different combinations of degenerated primers and cDNA from liver of induced male and female fish. Only the amplification products showing a clear and single band for each ZP were purified and sent for nucleotide sequencing. Based on similarities to ZP from other fish species, the obtained sequences were identified as ZPB and ZPC. Partial sequences of 404 and 227 bp obtained using species-specific primers for ZPB and ZPC, respectively were sent for publication in the GenBank database (Accession Nos.: EU081905 for ZPB and EU081906 for ZPC). Alignment of the partial sequence of the ZPB isoform of C. dimerus was compared to teleost sequences from rainbow trout Oncorhynchus mykiss ZP1a (AF231706) and ZP1b (AF231707), arctic char Salvelinus alpinus ZP beta mRNA, (AY426716), Japanese medaka Oryzias latipes ZP1b (D89609), gilthead seabream Sparus aurata ZP1a (AY928800), and sheepshead minnow Cyprinodon variegatus zona radiata-2 (AY598615). Amino-acid sequence similarities include >70% homology between ZPB of C. dimerus, S. aurata

and C. variegatus, and 55–61% homology between C. dimerus, O. mykiss, S. alpinus and O. latipes. Sequence homology was also found with those of tetrapods (data not shown). Five cysteines with conserved location between the compared species are shown in Fig. 4. Alignment of the partial sequence of the ZPC isoform of C. dimerus was compared to teleost sequences from rainbow trout O. mykiss ZP3 (AF231708), gilthead seabream S. aurata ZP3 (X93306), Oreochromis mossambicus ZPC1 (AY737027.1) and Danio rerio zona pellucida glycoprotein 3b (BC067692.1). Amino-acid sequence similarities showed 77% homology between ZPC of C. dimerus and S. aurata, and 50–60% homology with O. mykiss and D. rerio. O. mossambicus ZPC showed the least homology with the rest (30–34%). Two cysteines with conserved location among the compared species are shown in Fig. 5. Quantitative gene expression showed up-regulation of ZPB and ZPC upon OP injection in the liver of males (Fig. 6). ZPB was significantly induced after 1 h of injection (Fig. 6A). At 12 h post injection, mRNA levels of both ZP were significantly greater than those of control fish (0 h). At 72 h post injection, gene expression levels were similar to those found in E2 -injected males (p > 0.5) (Fig. 6A and B). Muscle, brain, and intestine did not exhibit changes in gene expression, since mRNA levels of induced fish never differed from control males (data not shown). 4. Discussion Terms such as environmental estrogens, endocrine disruptors, environmental hormones and xenoestrogens, describe chemicals that may affect the endocrine system of various organisms. Many

180

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 3. Liver and testis cross sections of Cichlasoma dimerus males. Control males (N = 5) showed the normal structure of liver (A) and testis (B). In estradiol treated males (N = 5), the liver (C) displays cellular disarray, euchromatic nuclei, and intense cytoplasmic basophilia; the testis (D) showed abnormal amount of sperm and immature germ cells within the lobular lumen. In octylphenol-treated males (N = 5), the same alterations were seen, even though they were less evident (E and F). Hematoxylin-eosin, 600×. *, immature germ cells; Cy, spermatocyst; H, hepatocyte; Lo, lobular lumen; N, nuclei; S, sinusoid; SPC; spermatocyte; SPG, spermatogonia; SPZ, sperm.

of the effects caused by these substances have been associated with developmental, reproductive and other health problems in wildlife and laboratory animals (Arukwe and Goksøyr, 2003). Among these chemicals are octylphenol ethoxylates and nonylphenol ethoxylates, two of the most common alkylphenol polyethoxylates (APEs) in the marketplace. Degradation of APEs in wastewater treatment plants or in the environment generates more persistent APEs and alkylphenols (APs) such as nonylphenol (NP) and octylphenol (OP). These chemicals can act as xenoestrogens, inducing the expression of female-specific proteins (Andersen et al., 1999; Chikae et al., 2003). In the present study, though not environmentally relevant, a protocol of repeated injections of high OP doses was designed to achieve a maximum induction of the contaminant, since the estro-

genic capacity of OP increases with exposure time (Andreassen et al., 2005). Protein induction and early gene expression of femalesspecific proteins (involved in zonagenesis and vitellogenesis) in male fish were used to elucidate the time-course of OP effects. A significant decrease in body weight in E2 and OP-injected fish was registered at the end of the experiment. This body weight loss could be the result of metabolic stress due to the presence of the contaminant, since no differences in food ingestion were observed during the experiment. Growth effects in fish exposed to synthetic estrogens have been associated with increased energy requirements for female-specific protein synthesis and xenobiotic metabolism; a reduction of hepatic glycogen and lipid stores in such conditions is consistent with such energetic changes (Schwaiger et al., 2000; Van den Belt et al., 2003; Zha et al., 2007, 2008).

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

181

Fig. 4. (A) Sequence alignment of the zona pellucida B isoform of Cichlasoma dimerus and other teleost sequences. Blanks (-) are inserted to optimize alignment of the sequences. The cysteine residues are highlighted in grey and the internal hydrophobic patch is indicated by IHP. (*) means that amino-acids in that column are identical in all sequences in the alignment. (:) means that conserved substitutions have been observed, according to amino-acid type. (.) means semi-conserved substitutions. (B) Cladogram showing estimated phylogenetic relationship of ZPB between species used in (A).

In the present investigation, histological observations provided evidence on the condition of organs following exposure to OP. As seen in several fish exposed to xenoestrogens (Folmar et al., 2001; Van den Belt et al., 2002; Islinger et al., 2003; Zha et al., 2008), the liver of C. dimerus treated with E2 or OP showed active hepatocytes. The nuclear hypertrophy and intense cytoplasmic basophilia of hepatocytes could be due to increased mRNA translation in the rER of estrogen-inducible proteins such as ZP and VTG (Yadetie et al., 1999; Arukwe et al., 2002; Bowman et al., 2002; Tollefsen et al., 2002; Woods et al., 2009). In treated animals, vacuolization of hepatocyte cytoplasm was no longer evident, probably due to depletion of energetic reserves (Schwaiger et al., 2000). All the features observed in liver of treated male fish are typical of vitellogenic females (Arukwe and Goksøyr, 2003; Ribeiro et al., 2006). The abnormal production of female-specific proteins in male fish leads to protein accumulation not only in liver but also in gonads and kidney, which can cause histological alterations (Folmar et al., 2001; Zaroogian et al., 2001; Moncaut et al., 2003; Zha et al., 2008; Rey Vázquez et al., 2009, present work). Previous results of our group demonstrated that, after E2 or OP treatment,

VTG accumulates within the cytoplasm of hepatocytes and in the vascular system in the liver of male C. dimerus (Moncaut et al., 2003; Rey Vázquez et al., 2009). We also found that the liver of this species is the only source of egg proteins (ZP and VTG) (Genovese et al., 2006, 2007), so large amounts of these proteins must exit the liver through the bloodstream after xenoestrogen induction. Some evidence suggests that male fish synthesize small amounts of estrogen, which in turn regulate the production of male androgens, explaining why ER transcripts are detected in germ and somatic cells within testis (Woods et al., 2009). Estrogenic compounds may affect the testis directly via inhibition of androgen synthesis or may inhibit gonadotropin-releasing hormone synthesis in the hypothalamus or gonadotropin synthesis in the pituitary through feedback mechanisms. They may also exert a direct effect on Sertoli cells, which are believed to have important functions in spermatogenesis (Jobling et al., 1996; Khan and Thomas, 1998). After 13 days of OP or E2 treatment, testis of C. dimerus showed an abnormal amount of sperm and release of immature germ cells into the lobular lumen. In other fish species the effects of xenoestrogens include: decrease in the number of cysts, hypertrophy of Sertoli cells, predominance of early spermatogenic stages, increase in the

182

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 5. (A) Sequence alignment of the zona pellucida C isoform of Cichlasoma dimerus and other teleost sequences. Blanks (-) are inserted to optimize alignment of the sequences. The cysteine residues are highlighted in grey and the internal hydrophobic patch is indicated by IHP. (*) means that amino-acids in that column are identical in all sequences in the alignment. (:) means that conserved substitutions have been observed, according to amino-acid type. (.) means semi-conserved substitutions. (B) Cladogram showing estimated phylogenetic relationship of ZPC between species used in (A). Note that due to the low homology between Oreochromis mossambicus and the species used in (A), the former was not included in the cladogram.

number of sperm cells in the ejaculates, and inhibition of testicular growth (Kinnberg et al., 2000; Toft and Baatrup, 2001; Van den Belt et al., 2002). Even though gonadal dysfunction leads to reproductive impairment, recovery of exposed fish has been reported after transference to clean water (Van den Belt et al., 2002). We found that complete recovery of C. dimerus is achieved but only if males are exposed to clean water for an equivalent period of time as that of exposure to octylphenol (Genovese et al., 2007; Regueira, 2008). In our attempt to identify different egg coat proteins in C. dimerus, we were able to partially sequence two ZPs, identified as ZPB and ZPC after NCBI blast analysis. No ZPA was found in C. dimerus probably because it is assumed that fish lost this isoform during evolution (Spargo and Hope, 2003; Modig et al., 2006). No fish ZPX sequence was published in GenBank by the time this study took place. The highest homology (70–77%) was found between ZP of perciform species, C. dimerus and S. aurata. Comparison between C. dimerus and O. mykiss or S. alpinus did not exceed 61% homology, probably because these salmonids are considered basal species. The percentage of identity coincides with relatedness previously reported for estrogen responsive genes (Karels and Brouwer, 2003; Modig et al., 2006; Finn and Kristoffersen, 2007). Sequence similarities between vertebrate ZPs suggest a conserved function as structural components of the egg coat. In mammals, sperm recognizes glycosylated serines in ZPC, however several oviparous organisms lack these serines, so the involvement of teleost ZPC in sperm recognition is uncertain (Hyllner et al., 2001; Wassarman et al., 2004). Cysteines – involved in protein cross-linking– and hydrophobic patches – involved in secondary and tertiary protein structure–, are conserved in ZPs of C. dimerus as well as in other species (Del Giacco et al., 2000; Wassarman et al., 2004; Modig et al., 2006). ZP transcripts in treated C. dimerus were detected 1 h after OP injection, inferring transcription of ZP genes using already available estrogen receptors (ER). White et al. (1994) demonstrated that

the estrogenic action of OP is mediated by ER, binding to a similar region of the hormone-binding domain as E2 . In C. dimerus, mRNA expression of both forms of ZP increased markedly between 12 and 24 h after a single dose of OP. This exponential induction could be explained by de novo synthesis of ER molecules (Yadetie et al., 1999; Bowman et al., 2002; Islinger et al., 2003), since a palindromic DNA sequence named estrogen-responsive element (ERE), which permits recruitment of transcription cofactors, is also present in the ER promoter (Krauss, 2001; Menuet et al., 2004). In C. dimerus two ER isoforms (ER␣ and ␤2) were partially sequenced (GenBank Accession No. EU158258-9). ER␣ isoform of male C. dimerus can be easily induced in liver after OP exposure (Genovese et al., 2008). Hence, up-regulation of ER in C. dimerus exposed to OP could explain the strong estrogenic effect evidenced in this work. Seventy-two hours post injection, levels of ZP transcripts in OPtreated fish reached those of E2 -induced fish, indicating that both chemicals are capable of eliciting the same response. By this time, ZP proteins were hardly detected in plasma of OP-treated fish, but were clearly evident with E2 treatment. This difference might be explained by the estrogenic potencies of both chemicals (White et al., 1994). Even though we measured the gene expression of ZP in E2 -treated fish at 72 h, it is likely that a high level of induction was achieved before that time, resulting in accumulation of transcripts and, hence, protein. In OP-challenged fish, high levels of ZP transcripts at 72 h did not parallel with protein detection at that time, suggesting that synthesis of mRNA precedes that of protein. Four ZP immunoreactive bands were detected in Western blots even though only two ZP isoforms were partially sequenced in C. dimerus. As noted by Izquierdo-Rico et al. (2009), the presence of different glycoforms for each protein could partially explain different migration behaviors in SDS-PAGE, and it is also possible that different ZP proteins co-migrate in the electrophoresis. So it cannot be assumed that other subfamilies, besides ZPB and ZPC, are present in C. dimerus.

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

183

sible for the presence of ZP in mucus it would be interesting to study the skin of C. dimerus as a target organ for estrogens. The detection of VTG in mucus has been used in recent years as a noninvasive assay to monitor endocrine disrupting chemicals (Moncaut et al., 2003; Meucci and Arukwe, 2005; Bulukin et al., 2007; Arukwe and Røe, 2008; Maltais and Roy, 2009; Rey Vázquez et al., 2009). We found that detection of ZP in mucus precedes that of VTG, so the former protein could be used as a more sensitive biomarker. Even though Dot blot results did not exactly match those obtained in Western blots, probably due to a difference in sensitivity, this method represents an easy, rapid, and noninvasive technique to address endocrine disruption in the field. The aforementioned results support quantitative gene expression as one of the most sensitive methods for the detection of estrogenic responses in fish (Andreassen et al., 2005). Induction of ZPB and ZPC transcripts in C. dimerus following OP injection was evidenced much earlier than protein detection. Gene expression also showed a differential response between ZPs, being ZPB more sensitive than ZPC (Arukwe et al., 1997; Lee et al., 2002). Therefore, ZPB gene expression results in an assertive biomarker for endocrine disruption by exposure to xenoestrogens in males of C. dimerus, since in this species males do not normally express ZP. However, this is not valid for all fish since in other species males typically express ZP (Zoarces viviparus, Larsson et al., 2002; Oncorhynchus mykiss, Hyllner et al., 2001; Ackerman et al., 2002). It is yet unknown whether ZPs serve a novel function or if it is a nonfunctional evolutionary by-product in males of these species. Nowadays, different government and non-government organizations are setting up directives and legal frameworks to protect and improve the quality of fresh water resources and promising removal processes are emerging (Chen et al., 2007; Esplugas et al., 2007). When monitoring endocrine disrupting chemicals it should be essential to include biomarkers that can serve as early warning signs of environmental pollution (Schlenk, 1999) such as the ones used in the present study.

Fig. 6. Relative expression of ZPB (A) and ZPC (B) in livers of male Cichlasoma dimerus injected with a single dose of octylphenol (OP) normalized to mean liver expression in estrogeneized females. Error bars represent standard error of the mean. Significant values (p < 0.01), after comparisons with control value, are indicated by *. Dotted line represents the expression of induced males after 72 h of E2 injection.

We found marked plasma VTG and ZP immunoreactivity 3 and 6 days after injection of OP, respectively. OP proved to be less potent eliciting an estrogenic response in mucus, since ZP and VTG were only detected on days 6 and 9 of treatment, respectively. As previously proposed, the skin could serve as an excretory pathway for excess proteins, considering that they lack a depositional site (ovary) in males (Folmar et al., 2001; Moncaut et al., 2003; Meucci and Arukwe, 2005). Recent studies demonstrated that VTG is actually expressed in skin of estrogeneized fish (Wang et al., 2005; Bulukin et al., 2007; Jin et al., 2008). It is not surprising for skin to be a target for estrogens, since different isoforms of ER were found to be expressed in this organ (Arukwe and Røe, 2008). This novel localization of VTG or ZP in skin validates surface mucus as a sensitive biomarker for estrogenic compounds. Fry of some cichlids (Symphysodon spp., Amphilophus citrinellus, O. mossambicus) get nutritional (vitellogenin) and biologically active non-nutrients (hormones) by biting mucus from both parents during the first weeks of parental care (Keenleyside, 1991; Kishida and Specker, 1994; Schütz and Barlow, 1997; Buckley et al., 2009). Even though C. dimerus does not exhibit this nipping behavior, the presence of VTG in mucus could be evolutionarily significant for nutritional purposes. However, to our knowledge, this explanation would not apply to ZP. To elucidate whether excretion or synthesis are respon-

Acknowledgements The present work was supported by University of Buenos Aires (UBACyT x118 and x620) and Agencia Nacional de Promoción Científica y Tecnológica (PICT 14271). Sequencing and gene expression studies were performed at MDIBL with a new investigator award to G. Genovese. References Ackerman, G.E., Schwaiger, J., Negele, R.D., Fent, K., 2002. Effects of long-term nonylphenol exposure on gonadal development and biomarkers of estrogenicity in juvenile rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 60, 203–221. Ahel, M., McEvoy, J., Giger, W., 1993. Bioaccumulation of the lipophilic metabolites of nonionic surfactants in freshwater organisms. Environ. Pollut. 79, 243–248. Andersen, H.R., Andersson, A.M., Arnold, S.F., Autrup, H., Barfoed, M., Beresford, N.A., Bjerregaard, P., Christiansen, L.B., Gissel, B., Hummel, R., Jørgensen, E.B., Korsgaard, B., Le Guevel, R., Leffers, H., McLachlan, J., Møller, A., Nielsen, J.B., Olea, N., Oles-Karasko, A., Pakdel, F., Pedersen, K.L., Perez, P., Skakkebcek, N.E., Sonnenschein, C., Soto, A.M., Sumpter, J.P., Thorpe, S.M., Grandjean, P., 1999. Comparison of short-term estrogenicity tests for identification of hormone-disrupting chemical. Environ. Health Perspect. 107, 89–108. Andersen, L., Holbech, H., Gessbo, A., Norrgren, L., Petersen, G.I., 2003. Effects of exposure to 17␣-ethinylestradiol during early development on sexual differentiation and induction of vitellogenin in zebrafish (Danio rerio). Comp. Biochem. Physiol. C 134, 365–374. Andreassen, T.K., Skjoedt, K., Korsgaard, B., 2005. Upregulation of estrogen receptor ␣ and vitellogenin in eelpout (Zoarces viviparous) by waterborne exposure to 4-tert-octylphenol and 17␤-estradiol. Comp. Biochem. Physiol. C 140, 340–346. Arukwe, A., Knudsen, F.R., Goksøyr, A., 1997. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ. Health Perspect. 105, 418–422. Arukwe, A., Celius, T., Walter, B.T., Goksoyr, A., 2000. Effects of xenoestrogens treatment on zona radiata protein and vitellogenin expression in Atlantic salmon (Salmo salar). Aquat. Toxicol. 49, 159–170.

184

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Arukwe, A., Kullman, S.W., Hinton, D.E., 2001. Differential biomarker gene and protein expressions in nonylphenol and estradiol-17␤ treated juvenile rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C 129, 1–10. Arukwe, A., Kullman, S.W., Berg, K., Goksøyr, A., Hinton, D.E., 2002. Molecular cloning of rainbow trout (Oncorhynchus mykiss) eggshell zona radiata protein complementary DNA: mRNA expression in 17␤-estradiol- and nonylphenol-treated fish. Comp. Biochem. Physiol. B 132, 315–326. Arukwe, A., Goksøyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2, 4. Arukwe, A., Røe, K., 2008. Molecular and cellular detection of expression of vitellogenin and zona radiata protein in liver and skin of juvenile salmon (Salmo salar) exposed to nonylphenol. Cell Tissue Res. 331, 701–712. Benson, A.P., Christensen, V.L., Fairchild, B.D., Davis, A.J., 2009. The mRNA for zona pellucida proteins B1 C and D in two genetic lines of turkey hens that differ in fertility. Anim. Reprod. Sci. 111, 149–159. Blair, R.M., Fang, H., Branham, W.S., Hass, B.S., Dial, S.L., Moland, C.L., Tong, W., Shi, L., Perkins, R., Sheehan, D.M., 2000. The estrogen receptor relative binding affinities of 188 natural and xenochemicals: structural diversity of ligands. Toxicol. Sci. 54, 138–153. Bowman, C.J., Kroll, K.J., Gross, T.G., Denslow, N.D., 2002. Estradiol-induced gene expression in largemouth bass (Micropterus salmoides). Mol. Cell. Endocrinol. 196, 67–77. Buckley, J., Maunder, R., Foey, A.D., Pearce, J., Sloman, K., 2009. Bi-parental mucus feeding: a unique example of parental care in an Amazonin cichlid. Comp. Biochem. Physiol. A 153, S94. Bulukin, E., Meucci, V., Minunni, M., Pretti, C., Intorre, L., Soldani, G., Mascini, M., 2007. An optical immunosensor for rapid vitellogenin detection in plasma from carp (Cyprinus carpio). Talanta 72, 785–790. Celius, T., Walther, B.T., 1998. Oogenesis in Atlantic salmon (Salmo salar L.) occurs by zonagenesis preceding vitellogenesis in vivo and in vitro. J. Endocrinol. 158, 259–266. Celius, T., Matthews, J.B., Giesy, J.P., Zacharewski, T.R., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) zona radiata and vitellogenin mRNA levels using real-time PCR after in vivo treatment with estradiol-17b or a-zearalenol. J. Steroid Biochem. Mol. Biol. 75, 109–119. Chen, C.Y., Wen, T.Y., Wang, G.S., Cheng, H.W., Lin, Y.H., Lien, G.W., 2007. Determining estrogenic steroids in Tapei waters and removal in drinking water treatment using high-flow solid-phase extraction and liquid chromatography/tandem mass spectrometry. Sci. Total Environ. 378, 352–365. Chikae, M., Ikeda, R., Hasan, Q., Morita, Y., Tamiya, E., 2003. Effect of alkylphenols on adult male medaka: plasma vitellogenin goes up to the level of estrous female. Environ. Toxicol. Pharmacol. 15, 33–36. Danielian, P.S., White, R., Hoare, S.A., Fawell, S.E., Parker, M.G., 1993. Identification of residues in the estrogen receptor that confer differential sensitivity to estrogen and hydroxytamoxifen. Mol. Endocrinol. 7, 232–240. David, A., Fenet, H., Gomez, E., 2009. Alkylphenols in marine environments: distribution monitoring strategies and detection considerations. Mar. Pollut. Bull. 58, 953–960. Del Giacco, L., Diani, S., Cotelli, F., 2000. Identification and spatial distribution of the mRNA encoding and egg envelope component of the cyprinid zebrafish Danio rerio, homologous to the mammalian ZP3 (ZPC). Dev. Genes Evol. 210, 41–46. Esplugas, S., Bila, D.M., Krause, L.G.T., Dezotti, M., 2007. Ozonation and advanced oxidation technologies to remove endocrine disrupting chemicals (EDCs) and pharmaceuticals and personal care products (PPCPs) in water effluents. J. Hazard. Mater. 149, 631–642. Ferrara, F., Fabietti, F., Delise, M., Funari, E., 2005. Alkylphenols and alkylphenol ethoxylates contamination of crustaceans and fishes from the Adriatic Sea (Italy). Chemosphere 59, 1145–1150. Fiedler, S., Foerster, M., Glaser, B., Zech, W., 2006. Alkylphenols in sediments of the Atlantic rainforest south-west of Sao Paulo, Brazil. Chemosphere 66, 212–218. Finn, R.N., Kristoffersen, B.A., 2007. Vertebrate vitellogenin gene duplication in relation to the “3 R hypothesis”: correlation to the pelagic egg and the oceanic radiation of teleosts. PLoS One 24, 169. Folmar, L.C., Gardner, G.R., Schreibman, M.P., Magliulo-Cepriano, L., Mills, L.J., Zaroogian, G., Gutjahr-Gobell, R., Haebler, R., Horowitz, D.B., Denslow, N.D., 2001. Vitellogenin-induced pathology in male summer flounder (Paralichthys dentatus). Aquat. Toxicol. 51, 431–441. Fox, G.A., 2001. Wildlife as sentinels of human health effects in the Great Lakes–St. Lawrence basin. Environ. Health Perspect. 109, 853–861. ˜ R., Maggese, C., Luquet, C., Towle, Genovese, G., Regueira, M., Lo Nostro, F., Da Cuna, D., 2006. cDNA sequencing of vitelline envelope protein and gene expression in Cichlasoma dimerus (Teleostei, Perciformes) induced by xenoestrogens. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 45, 127–128. Genovese, G., Regueira, M., Lo Nostro, F., Maggese, C., Towle, D., 2007. Vitelline envelope proteins and vitellogenin gene expression in Cichlasoma dimerus (Teleostei, Perciformes) exposed to octylphenol. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 46, 161–162. Genovese, G., Maggesse, M.C., Towle, D., 2008. Differential induction of estrogen receptors in Cichlasoma dimerus (Teleostei Perciformes) exposed to octylphenol. Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 47, 56–57. Hennies, M., Wiesmann, M., Allner, B., Sauerwein, H., 2003. Vitellogenin in carp (Cyprinus carpio) and perch (Perca fluviatilis): purification, characterization and development of an ELISA for the detection of estrogenic effects. Sci. Total Environ. 309, 93–103.

Hyllner, S.J., Silversand, C., Haux, C., 1994. Formation of the vitelline envelope precedes the active uptake of vitellogenin during oocyte development in the rainbow trout, Oncorhynchus mykiss. Mol. Reprod. Dev. 39, 166–175. Hyllner, S.J., Westerlund, L., Olsson, P.E., Schoppen, A., 2001. Cloning of rainbow trout egg envelope proteins: members of a unique group of structural proteins. Biol. Reprod. 64, 805–811. Iguchi, T., Watanabe, H., Katsu, Y., 2001. Developmental effects of estrogenic agents on mice, fish, and frogs: a mini-review. Horm. Behav. 40, 248–251. IRAM, 2008. Calidad ambiental, Calidad del agua. Determinación de la toxicidad letal aguda de sustancias en peces de agua dulce. Método semiestático. IRAM 29112:2008. Islinger, M., Willimski, D., Völkl, A., Braunbeck, T., 2003. Effects of 17aethinylestradiol on the expression of three estrogen-responsive genes and cellular ultrastructure of liver and testes in male zebrafish. Aquat. Toxicol. 62, 85–103. Izquierdo-Rico, M.J., Jiménez-Movilla, M., Llop, E., Pérez-Oliva, A.B., Ballesta, J., Gutiérrez-Gallego, R., Jiménez-Cervantes, C., Avilés, M., 2009. Hamster zona pellucida is formed by tour glycoproteins: ZP1, ZP2, ZP3, and ZP4. J. Proteome Res. 8, 926–941. Jin, Y., Wang, W., Sheng, G.D., Liu, W., Fu, Z., 2008. Hepatic and extrahepatic expression of estrogen-responsive genes in male adult zebrafish (Danio rerio) as biomarkers of short-term exposure to 17␤-estradiol. Environ. Monit. Assess. 146, 105–111. Jobling, S., Sumpter, J.P., 1993. Detergent components in sewage effluent are weakly estrogenic in to fish: an in vitro study using rainbow trout (Oncorhynchus mykiss) hepatocytes. Aquat. Toxicol. 27, 361–372. Jobling, S., Sheahan, D., Osborne, J.A., Matthiessen, P., Sumpter, J., 1996. Inhibition of testicular growth in rainbow trout (Oncorhynchus mykiss) exposed to estrogenic alkylphenolic chemicals. Environ. Toxicol. Chem. 15, 194–202. Jobling, S., Williams, R., Johnson, A., Taylor, A., Gross-Sorokin, M., Nolan, M., Tyler, C.R., van Aerle, R., Santos, E., Brighty, G., 2006. Predicted exposures to steroid estrogens in U.K. rivers correlate with widespread sexual disruption in wild fish populations. Environ. Health Perspect. 114, 32–39. Kang, I.J., Yokota, H., Oshima, Y., Tsuruda, Y., Yamaguchi, T., Maeda, M., Imada, N., Tadokoro, H., Honjo, T., 2002. Effects of 17b-estradiol on reproduction of Japanese medaka (Oryzias latipes). Chemosphere 47, 71–80. Karels, A.A., Brouwer, M., 2003. Cloning, sequencing and phylogenetic classification of an estrogen receptor alpha (␣) subtype of sheepshead minnow (Cyprinodon variegates). Comp. Biochem. Physiol. B 135, 263–272. Keenleyside, M.H.A., 1991. Parental care. In: Keenley-side, M.H.A. (Ed.), Cichlid Fishes. Behaviour, Ecology and Evolution. Chapman and Hall, New York, pp. 191–208. ´˚ 2000. Effects of nonylpheKinnberg, K., Korsgaard, B., Bjerregaard, P., Jespersen, A., nol and 17␤-estradiol on vitellogenin synthesis and testis morphology in male platyfish Xiphophorus maculates. J. Exp. Biol. 203, 171–181. Kishida, M., Specker, J.L., 1994. Vitellogenin in the surface mucus of tilapia (Oreochromis mossambicus): possibility for uptake by the free-swimming embryos. J. Exp. Zool. 268, 259–268. Khan, I.A., Thomas, P., 1998. Estradiol-17␤ and o,p -DDT stimulate gonadotropin release in Atlantic croaker. Mar. Environ. Res. 46, 149–152. Knudsen, F.R., Arukwe, A., Pottinger, T.G., 1998. The in vivo effect of combinations of octylphenol, butylbenzylphthalate and estradiol on liver estradiol receptor modulation and induction of zona radiate proteins in rainbow trout: no evidence of synergy. Environ. Pollut. 103, 75–80. Krauss, G., 2001. Biochemistry of Signal Transduction and Regulation. Wiley-VCH Verlag GmbH & Co, Weinheim. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Larsson, D.G.J., Mayer, I., Hyllner, S.J., Forlin, L., 2002. Seasonal variations of vitelline envelope proteins, vitellogenin, and sex steroids in male and female eelpout (Zoarces viviparus). Gen. Comp. Endocrinol. 125, 184–196. Lee, C., Na, J.G., Lee, K., Park, K., 2002. Choriogenin mRNA induction in male medaka Oryzias latipes as a biomarker of endocrine disruption. Aquat. Toxicol. 61, 233–324. Lowry, O.M., Rosenbrough, N.J., Farr, L., Randall, R.J., 1951. Protein measurement with the phenol reagent. J. Biol. Chem. 193, 265–275. Maltais, D., Roy, R.L., 2009. Purification and partial characterization of vitellogenin from shorthead redhorse (Moxostoma macrolepidotum) and copper redhorse (Moxostoma hubbsi) and detection in plasma and mucus with a heterologous antibody. Fish Physiol. Biochem. 35, 241–254. Meijide, F.J., 2007. Desarrollo gonadal y diferenciación sexual en Cichlasoma dimerus (Teleostei, Perciformes). Efectos de la exposición a 4-tert-octilfenol y 17␤- estradiol. Doctoral Thesis in Biological Sciences, FCEyN, UBA, Buenos Aires, 180pp. Meijide, F.J., Guerrero, G.A., 2000. Embryonic and larval development of a substrate-brooding cichlid Cichlasoma dimerus (Heckel, 1840), under laboratory conditions. J. Zool. 252, 481–493. Menuet, A., Le Page, Y., Torres, O., Kern, L., Kah, O., Pakdel, F., 2004. Analysis of the estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct effects of ERalpha ERbeta1 and ERbeta2. J. Mol. Endocrinol. 32, 975–986. Meucci, V., Arukwe, A., 2005. Detection of vitellogenin and zona radiate protein expressions in surface mucus of immature juvenile Atlantic salmon (Salmo salar) exposed to waterborne nonylphenol. Aquat. Toxicol. 73, 1–10. Milnes, M.R., Bermudez, D.S., Bryan, T.A., Edwards, T.M., Gunderson, M.P., Larkin, I.L.V., Moore, B.C., Guillette, L.J., 2006. Contaminant-induced feminization and demasculinization of nonmammalian vertebrate males in aquatic environments. Environ. Res. 100, 3–17.

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185 Modig, C., Modesto, T., Canario, A., Cerdà, J., von Hofsten, J., Olsson, P.-E., 2006. Molecular characterization and expression pattern of zona pellucida proteins in gilthead seabream (Sparus aurata). Biol. Reprod. 75, 717–725. Modig, C., Westerlund, L., Olsson, P.E., 2007. Oocyte zona pellucida proteins. In: Babin, P.J., Cerdà, J., Lubzens, E. (Eds.), The Fish Oocyte, from Basic Studies to Biotechnological Applications. Springer, Dordrecht, pp. 113–140. Moncaut, N., Lo Nostro, F.L., Maggese, M.C., 2003. Vitellogenin detection in surface mucus of the South American cichlid fish Cichlasoma dimerus (Heckel, 1840) induced by estradiol-17␤. Effects on liver and gonads. Aquat. Toxicol. 63, 127–137. Nelson, J.S., 2006. Fishes of the World, 4th ed. Wiley & Sons Inc., NJ, USA, p. 622. Pandolfi, M., Canepa, M., Meijide, F.J., Alonso, F., Rey Vazquez, G., Maggese, M.C., Vissio, P.G., 2009. Studies on the reproductive and developmental biology of Cichlasoma dimerus (Perciformes, Cichlidae). Biocell 33 (1), 1–18. Pedersen, R.T., Hill, E.M., 2002. Tissue distribution and depuration of 4-tertoctylphenol residues in the cyprinid fish, Scardinius erythrophthalmus. Environ. Sci. Technol. 36, 3275–3283. Pedersen, K.H., Pedersen, S.N., Pedersen, K.L., Korsgaard, B., Bjerregaard, P., 2003. Estrogenic effect of dietary 4-tert-octylphenol in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 62, 295–303. Regueira, M., 2008. Efectos de la exposición a 4-tert-octifenol sobre la vitelogenina y proteínas de envoltura vitelina en machos de Cichlasoma dimerus (Teleostei, Perciformes). Undergraduate Thesis in Biological Sciences, FCEyN, UBA, Buenos Aires, 91pp. ˜ R.H., Lo Nostro, F.L., Piazza, Y.G., Babay, P.A., Rey Vázquez, G., Meijide, F.J., Da Cuna, Trudeau, V.L., Maggese, M.C., Guerrero, G.A., 2009. Exposure to waterborne 4tert-octylphenol induces vitellogenin synthesis and disrupts testis morphology in the South American freshwater fish Cichlasoma dimerus (Teleostei, Perciformes). Comp. Biochem. Physiol. C 150, 298–306. Rhee, J.S., Kang, H.S., Raisuddin, S., Hwang, D.S., Han, J., Kim, R.O., Seo, J.S., Lee, Y.M., Park, G.S., Lee, J.S., 2009. Endocrine disruptors modulate expression of hepatic choriogenin in the hermaphroditic fish, Kryptolebias marmoratus. Comp. Biochem. Physiol. C 150, 170–178. Ribeiro, V.M.A., Bazzoli, N., Maria, T.A., Santos, G.B., 2006. Ultrastructural changes in female hepatocytes during ovarian maturation of Steindachnerina insculpta (Pisces: Curimatidae). Braz. J. Biol. 66, 957–962. Robinson, C.D., Brown, E., Craft, J.A., Davies, I.M., Moffat, C.F., 2004. Effects of prolonged exposure to 4-tert-octylphenol on toxicity and indices of oestrogenic exposure in the sand goby (Pomatoschistus minutes, Pallas). Mar. Environ. Res. 58, 19–38. Saradha, B., Mathur, P.P., 2006. Effect of environmental contaminants on male reproduction. Environ. Toxicol. Pharmacol. 22, 90–96. Schlenk, D., 1999. Necessity of defining biomarkers for use in ecological risk assessments. Mar. Pollut. Bull. 39, 48–53. Schütz, M., Barlow, G.W., 1997. Young of the Midas cichlid get biologically active nonnutrients by eating mucus from the surface of their parents. Fish Physiol. Biochem. 16, 11–18. Schwaiger, J., Spieser, O.H., Bauer, C., Ferling, H., Mallow, U., Kalbfus, W., Negele, R.D., 2000. Chronic toxicity of nonylphenol and ethinylestradiol: haematological and histopathological effects in juvenile Common carp (Cyprinus carpio). Aquat. Toxicol. 51, 69–78. Sonnenschein, C., Soto, A.M., 1998. An updated review of environmental estrogen and androgen mimics and antagonists. J. Steroid Biochem. Mol. Biol. 65, 143–150.

185

Spargo, S.C., Hope, R.M., 2003. Evolution and nomenclature of the zona pellucida gene family. Biol. Reprod. 68, 358–362. Sundt, R.C., Baussant, T., Beyer, J., 2009. Uptake and tissue distribution of C4 –C7 alkylphenols in Atlantic cod (Gadus morhua): relevance for biomonitoring of produced water discharges from oil production. Mar. Pollut. Bull. 58, 72–79. Toft, G., Baatrup, E., 2001. Sexual characteristics are altered by 4-tert-octylphenol and 17beta-estradiol in the adult male guppy (Poecilia reticulata). Ecotoxicol. Environ. Safety 48, 76–84. Tollefsen, F.E., Mathisen, R., Stenersen, J., 2002. Estrogen mimics bind with similar affinity and specificity to the hepatic estrogen receptor in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 126, 14–22. Van den Belt, K., Wester, P.W., van der Ven, L.T., Verheyen, R., Witters, H., 2002. Effects of ethynylestradiol on the reproductive physiology in zebrafish (Danio rerio): time dependency and reversibility. Environ. Toxicol. Chem. 21, 767–775. Van den Belt, K., Verheyen, R., Witters, H., 2003. Effects of 17␣-ethynylestradiol in a partial life-cycle test with zebrafish (Danio rerio): effects on growth, gonads and female reproductive success. Sci. Total Environ. 309, 127–137. van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Wang, H., Tan, J.T.T., Emelyanov, A., Korzh, V., Gong, Z., 2005. Hepatic and extrahepatic expression of vitellogenin genes in the zebrafish Danio rerio. Gene 356, 91–100. Wassarman, P.M., Jovine, L., Litscher, E.S., Qi, H., Williams, Z., 2004. Egg-sperm interactions at fertilization in mammals. Eur. J. Obstet. Gynecol. Reprod. Biol. 115, S57–S60. White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175–182. Woods, M., Kumar, A., Barton, M., Woods, A., Kookana, R., 2009. Localisation of estrogen responsive genes in the liver and testis of Murray rainbowfish Melanotaenia fluviatilis exposed to 17␤-estradiol. Mol. Cell. Endocrinol. 303, 57–66. Yadetie, F., Arukwe, A., Goksøyr, A., Male, R., 1999. Induction of hepatic estrogen receptor in juvenil Atlantic salmon in vivo by the environmental estrogen, 4nonylphenol. Sci. Total Environ. 233, 201–210. Yamagami, K., Hamazaki, T.S., Yasumasu, S., Masuda, K., Iuchi, I., 1992. Molecular and cellular basis of formation, hardening and breakdown of the egg envelope in fish. Int. Rev. Cytol. 136, 51–92. Ying, G.G., Williams, B., Kookana, R., 2002. Environmental fate of alkylphenols and alkylphenol ethoxylates – a review. Environ. Int. 28, 215–226. Zaroogian, G., Gardner, G., Borsay Horowitz, D., Gutjahr-Gobell, R., Haebler, R., Mills, L., 2001. Effect of 17␤-estradiol, o,p -DDT, octylphenol and p,p -DDE on gonadal development and liver and kidney pathology in juvenile male summer flounder (Paralichthys dentatus). Aquat. Toxicol. 54, 101–112. Zha, J., Wang, Z., Wang, N., Ingersoll, C., 2007. Histological alteration and vitellogenin induction in adult rare minnow (Gobiocypris rarus) after exposure to ethynylestradiol and nonylphenol. Chemosphere 66, 488–495. Zha, J., Sun, L., Zhou, Y., Spear, P.A., Ma, M., Wang, Z., 2008. Assessment of 17a-ethinylestradiol effects and underlying mechanisms in a continuous, multigeneration exposure of the Chinese rare minnow (Gobiocypris rarus). Toxicol. Appl. Pharmacol. 226, 298–308.