Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV)

Fish & Shellfish Immunology 28 (2010) 98–105

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV) Maureen K. Purcell a, *, Scott E. LaPatra b, James C. Woodson a, Gael Kurath a, James R. Winton a a b

U.S. Geological Survey, Western Fisheries Research Center, 6505 NE 65th St. Seattle, WA 98115, USA Clear Springs Foods, Inc., Research Division PO Box 712, Buhl., ID 83316, USA

a r t i c l e i n f o Article history: ĆReceived 10 July 2009 Received in revised form 2 October 2009 Accepted 3 October 2009 Available online 9 October 2009 Keywords: Interferon Viral load Full-sibling families Pattern recognition receptors

a b s t r a c t The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N ¼ 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific immunity. In summary, disease outcome for each family was determined very early in the infection process and resistance was associated with lower early viral replication. Published by Elsevier Ltd.

1. Introduction Infectious hematopoietic necrosis virus (IHNV) is a negative-sense RNA virus in the genus Novirhabdovirus [1]. The virus causes extensive morbidity and mortality in the North American rainbow trout (Oncorhynchus mykiss) and Atlantic salmon industry [2,3]. Despite its importance to commercial aquaculture, there is no licensed vaccine for trout available in the United States but a DNA vaccine is licensed for use in the Atlantic salmon (Salmo salar) industry in Canada [4]. Mass delivery strategies are needed before inactivated or DNA vaccines against IHNV are economically viable for the rainbow trout industry [5]. Selective breeding for disease resistance represents

* Corresponding author. Tel.: þ1 206 526 6282x252; fax: þ1 206 526 6654. E-mail address: [email protected] (M.K. Purcell). 1050-4648/$ – see front matter Published by Elsevier Ltd. doi:10.1016/j.fsi.2009.10.005

a useful tool for the aquaculture industry to mitigate losses due to disease [6]. Previous studies have established that IHNV resistance is a heritable trait and efforts have been made to identify quantitative trait loci (QTLs) or genes associated with the trait [7–11]. IHNV typically leads to an acute disease associated with rapid viral replication and onset of mortality by 4–7 days post-infection [12]. Fish infected with IHNV rapidly up-regulate transcription of a number of cytokine genes including type I and II interferon (IFN) genes [12–14]. IHNV is sensitive to the effects IFN in vivo [15,16] and the IFN response induced by the IHNV glycoprotein DNA vaccine provides protection of trout against virulent rhabdovirus challenge [17–19]. Survivors of IHNV challenge typically develop specific immunity, which is often associated with neutralizing serum antibodies [20]. The goal of the present study was to better understand the mechanisms responsible for differential resistance to IHNV using

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

high and low resistance families. This study was conducted in cooperation with a large commercial trout producer that has an ongoing selective breeding program to enhance a number of traits including IHNV resistance. IHNV phenotypic characterization of full-sibling families is performed by IHNV immersion challenge at 1 g size and the best performing families are incorporated into the brood stock. In this study, we selected 7 families from the 2007 cohort year that varied in IHNV resistance. We hypothesized that resistant families would have differences in innate immune gene expression that differed in magnitude of response or timing of response compared with susceptible families. To test this hypothesis, progeny fish from the select families were challenged at the 10 g size and mortality, viral replication and IFN response were assessed. Additionally, we examined neutralizing antibody responses among families with varying susceptibility. 2. Methods 2.1. Virus The highly virulent IHNV virus strain 220–90 was isolated from rainbow trout in Hagerman Valley, ID in 1990 [21]. Virus was propagated in the epithelioma papulosum cyprini (EPC) cell line [22] and viral titer defined by plaque assay using previously described methods [23].

2.2. IHNV immersion challenge at 1 g size Fish rearing and challenge experiments were conducted at a constant water temperature of 15  C. IHNV susceptibility in the 2007 cohort year was assessed at Clear Springs Foods, Inc. (Buhl, ID) by comparing survival following waterborne exposure to in a standard immersion challenge [24]. Briefly, fish were exposed to 1  104 plaque forming units (PFU)/mL concentration of IHNV under static conditions for 1 h, water flow was resumed and the challenge was monitored daily for 21 days. Based on these results, seven families representing a range of susceptibility were transferred to the Western Fisheries Research Center (Seattle, WA). Each full-sibling family had distinct sires and dams and there were no half-sibling relationships. Fish were fed a semi-moist commercial diet (BioOregon) until they achieved w10 g size.

99

2.4. Viral load and host gene expression in 10 g fish RNA was extracted from anterior kidney tissue as previously described [13] using the RNeasy Mini Kit (Qiagen, Inc.) with incolumn DNAse I treatment. Synthesis of cDNA using random hexamer and oligo-dt priming was conducted as previously described [13]. Viral load was assessed in cDNA samples using quantitative reverse-transcriptase PCR (qRT-PCR) that measures total IHNV viral RNA (both mRNA and genome). Development of the IHNV qRT-PCR assay and validation of the assay against infectious viral titer has been previously described [25]. Development of qRT-PCR assays to monitor trout innate immune gene expression has been previously described [13,19,26]. All primer and probe sets for immune genes and GenBank accession numbers are presented in Table 1. Ten-fold dilution of a standard cDNA sample was used to construct a standard curve. The genes analyzed included: housekeeping gene ARP [27], interferon (IFN) 1 short transcript, IFN1 long transcript, IFN2, IFN3 [26,28], IFN-g1, IFN-g2 [26,29], Mx-1 [30], Vig-1 [31], Interleukin (IL) 1b1 [32], IFN regulatory factor (IRF) 3 [33], Toll-like receptor (TLR) 3 [34], TLR22a, TLR22b [35], and MDA-5 [36]. The MDA-5 sequence was an expressed sequence tag (EST) that was previously identified in Atlantic salmon and for which a trout EST was available (Table 1). Expression of specific genes was normalized to the housekeeping gene ARP to produce normalized ratios. To examine gene modulation after IHNV challenge, the mock control group for each family was used as a calibrator group and expression is presented as fold-change relative to the mock control group. To examine constitutive gene expression in unhandled fish, the family with the lowest gene expression for a given gene was used as a calibrator group and expression in the other families was divided by gene expression of the calibrator group. 2.5. Neutralizing antibody titer in 10 g fish At 45 days post-injection (dpi) challenge, a subset of survivors (5 fish per family if available) was euthanized as previously described and bled. Blood was clotted overnight at 4  C, centrifuged at 15 000  g and serum was removed and frozen at 80  C until use. Complement dependent neutralizing antibody assays were conducted as previously described [37]. Titers are reported as the reciprocal of the highest dilution that provided 50% plaque reduction relative to the negative control serum; a sample was considered positive if the titer is >20.

2.3. IHNV intra-peritoneal injection challenge at 10 g

2.6. Statistics

Prior to challenge, 6 unhandled fish were euthanized with an overdose of buffered tricaine methanesulfonate (MS-222; Argent Chemical Laboratories) and anterior kidney tissue was removed and preserved in RNAlater (Qiagen Inc; Valencia, CA) following manufacturer's instructions. All trout were anaesthetized by immersion in 50 mg/mL buffered MS-222 prior to handling. Fish were challenged by intra-peritoneal (I.P.) injection with 5  102 PFU/fish diluted in 50 ml of medium; mock-infected fish received 50 ml of medium only. For each family, there were two tanks of virally-infected fish containing w20 fish in each tank per family (family 07–007 had only 10 fish per tank). No sampling of these 2 tanks occurred and tanks were monitored daily for mortality for 30 days to calculate final cumulative percent mortality (CPM) of each family. A third tank of virally-infected fish and a fourth tank housing the mock-infected fish initially contained w45 fish per tank per family and these tanks were sampled. Anterior kidney tissues were removed from 6 fish per family at 24, 48 and 72 h post-infection (hpi) and processed as described above.

To test for heterogeneity among families in final cumulative percent mortality (CPM) we performed Chi-square analysis. Replicate tanks for each family were first tested for differences and if no differences were found, the data were pooled to test for CPM differences among families. General linear models (GLM) were used to test for associations between family susceptibility (measured as CPM of the family) and covariate terms including body weight (g), viral load and gene expression. We started with the maximum model which included the main terms and all higher order interactions. Non-significant interaction and terms were eliminated to achieve minimal models. All main terms were retained in the regression model when evaluating the effect of IFN induction on susceptibility to control for the effect of viral load and fish size. Pearson's correlation analysis was used to test for association between mean day to death and CPM or mean family weight. Individual fish viral load and IFN gene expression induction were also examined by Pearson's correlation analysis. CPM data were arcsine square root transformed and viral load data were log10 transformed prior to all statistical analyses to meet the test

100

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

Table 1 Gene names, accession numbers and qRT-PCR primer and probe sets. Transcript Normalizing gene Acidic ribo-phosphoprotein P0

Viral gene IHNV Glycoprotein

Host immune genes Interferon 1 long Transcript

Interferon 1 short transcript

Interferon 2

Interferon 3

Interferon-g1

Interferon-g2

Interleukin-1b1

Interferon regulatory factor 3

MDA-5

Mx-1

TLR22a

TLR22b

TLR3

Vig-1

Primer Name

Sequence(50 -30 )

Accession

ARP F ARP R ARP T

gaaaatcatccaattgctggatg cttcccacgcaaggacaga 6'FAM-ctatcccaaatgtttcattgtcggcgc-TAMRA

AY505012

G 1066R G 946F G 1003T

tcccgtgatagatggagcctt t gcgcacgccgagataatatcaa 6'FAM-cgatctccacatcccggaataaatgacgtct-TAMRA

L40883

IFN1L 138F IFN1L 253R IFN1L 164T IFN1S 24F IFN1S 119R IFN1S 58T IFN2 5F IFN2 107R IFN2 47T IFN3 270F IFN3 370R IFN3 317T IFN-g1 299F IFN-g1 402R IFN-g1 333T IFN-g2 207F IFN-g2 329R IFN-g2 279T IL-1b1F IL-1b1R IL-1b1T IRF3 477F IRF3 597R IRF3 521T MDA5 220F MDA5 340R MDA5 270T MX-1F MX-1R MX-1T TLR22a 997F TLR22a 1104R TLR22a 1025T TLR22b 1005F TLR22b 1144R TLR22b 1033T TLR3 3812F TLR3 3932R TLR3 3862T Vig-1 760F Vig-1 880R Vig-1 821T

cacgcgaagttattagcagttgaa aaattatagttgaaccacaatgaaatattattc 6'FAM-caaagctcgcgaatagcctattctcgc-TAMRA gcgaaacaaactgctatttacaatgtata tcacagcaatgacacacgctc 6'FAM-cagagctggagttgtatttttcttattatttgcagtatgc-TAMRA aaagctaaaagcaaaataaacagctctt cagcaatgacacacactctgca 6'FAM-tgcagagttggacgtgtctttttcttattctttg-TAMRA tggaggctatgcgatatgtgg acgatatatgacgttttggaacatgtt MGB-6'FAM-tctgtcacgtggaacaa-NFQ tcggccagatgctgaacc cctccccaggaaatagtgtttc MGB-6'FAM-aatgattgagagtctgaaata-NFQ gttgatgagtgtggttctggacg ttctgggtctcctgaaccttcc 6'FAM-agtgagggagaggctggaccaggtcaag-TAMRA ggagaggttaaagggtggcga tgccgactccaactccaaca 6'FAM-ctgctcaacttcttgctggagagtgctgtg-TAMRA aacaaggcatgcagggttctaaat acgtgtgcaatcagtaccagca 6'FAM-atgctccttaatattttgctgtgcgacctggatt-TAMRA attcaggcgatcatggagga cagagcagactggtttgttgca 6'FAM-aggaatgaaaaaggagagcccgtccaaagt-TAMRA ggttgtgccatgcaacgtt ggcttggtcaggatgcctaat 6'FAM-aagatggcacaagaggtggaccctgaag-TAMRA aacataagtgctttgtctgaggaattt tgatctgaatgatacctctgacagc 6'FAM-tgcagtcatgtaaacaagtcaccgaagtgg-TAMRA tgttctctctaaggaatttctgcagtc gcctgttgtggcccagtt 6'FAM-tgtaaacagttgaccgaaatggacgtatgtgataa-TAMRA ggtttcaaacaatggtcgagg gcatgtcacttggctactgaaaca 6'FAM-caatattgcacgtctcatttaaccgctgaatg-TAMRA gtgttccagtgtctgctgatcgat tgatgctgctgtgcctttcc 6'FAM-agaggtttctcatcagtgatcagcagtttcagga-TAMRA

FJ184370

assumptions. P values less than 0.05 were considered significant. Chi-square and correlation analyses were conducted using InStat V3.06 (GraphPad Inc.; San Diego, CA) and general linear models were conducted using SPSS V11.5.0 (SPSS, Inc.; Chicago, IL). 3. Results 3.1. Mortality in IHNV challenges For the initial immersion challenge, mean weight of the 7 selected full-sibling progeny families ranged from 0.8 to 1.2 g (mean weight of all families was 1.0 g). The final CPM of progeny families ranged from 32.0% to 89.8% (Fig. 1A) and final CPM was significantly different among families (X2 ¼ 65.5; P < 0.0001). Onset of mortality was at 5 dpi in all progeny families and mean day to death (MDD) of families ranged from 7.2 to 10.4 dpi (Fig. 1A). There

FJ184371

FJ184369

FJ184372

FJ184374

FJ184375

AJ223954

AJ829668

CA374964 CX259995 U30253

AJ628348

AJ878915

DQ459470

AF076620

was no significant correlation between MDD and CPM (Pearson's correlation; P ¼ 0.24) or between MDD and mean family weight (Pearson's correlation; P ¼ 0.23). For the subsequent I.P. injection challenge, mean weight of progeny families ranged from 8.0 to 11.3 g (mean of all families 10.0 g) (Fig. 2A). Final CPM of the progeny families ranged from 36.7% to 100% (Fig. 1A) and final CPM was significantly different among families (X2 ¼ 46.1; P < 0.0001). Onset of mortality in progeny families ranged from 4 to 6 dpi and MDD of families ranged from 6.4 to 10.8 dpi (Fig. 1A). There was no significant correlation between MDD and CPM (Pearson's correlation; P ¼ 0.20) or between MDD and mean family weight (Pearson's correlation; P ¼ 0.42). A significant relationship existed between CPM of family at 1 g and 10 g size (GLM; F(1,5) ¼ 10.0; P ¼ 0.03; r2 ¼ 0.66) indicating that relative IHNV susceptibility of the families was maintained as fish grew (Fig. 1B).

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

1 gram size

8.3

7.9

CPM

7.2

8.4

8.3 7.9 9.5

9.0

10.4

60.0 40.0

7.2

10.8

80.0

6.4

9.2

100.0

8.1

A

10 gram size

20.0 0.0 07-012

07-011

07-009

07-007

07-004

07-002

07-054

Full-sibling Families

Arcsine sq. root (CPM) at 10 g

B 2.0

r2 = 0.66 P = 0.03

1.6

F(1,5) = 10.0

1.2 0.8 0.4 0.0 0.0

0.4

0.8

1.2

1.6

2.0

Arcsine sq. root (CPM) at 1 g Fig. 1. (A) Cumulative percent mortality (CPM) of seven full-sibling rainbow trout families challenged at 1 g by size immersion or at 10 g size by intra-peritoneal injection with IHNV. Immersion challenge CPM represents a single replicate tank while injection challenge CPM is the mean of two replicate tanks  standard deviation. Mean day to death of each family in the challenges is shown above the bars. (B) Plot of arcsine square root transformed CPM of the full-sibling families challenged at 1 g vs. 10 g size.

3.2. Early viral load No detectable viral load was observed in the pre-challenge samples or the mock control groups (data not shown). Viral load increased rapidly in infected groups over time with maximum levels observed at either 48 or 72 hpi depending on family (Fig. 2A). A positive relationship was observed between viral load and final CPM of each family at all time points (Fig. 2B) and viral load at 48 hpi was a significant predictor of family CPM (GLM; F(1,5) ¼ 6.82; P ¼ 0.048; r2 ¼ 0.577) (Fig. 2B). Controlling for the effect of weight differences among families in the viral load regression models helped to explain more of the variation but did not change the overall result, and viral load at 48 h remained the only significant predictor of CPM (GLM; viral load: F(1,4) ¼ 9.291; P ¼ 0.038; weight: F(1,4) ¼ 4.742; P ¼ 0.095; r2 ¼ 0.806). 3.3. Induction of immune gene expression IFN1S (short transcript), IFN2 and IFN-g2 gene expression was examined at 24, 48 and 72 hpi (Table 2). IFN1S gene expression was induced as early as 24 hpi in all families and increased at subsequent time points with peak expression at either 48 or 72 hpi depending on family. A similar pattern was observed for IFN2 but the fold change increases relative to mock were of a lesser magnitude than IFN1S. In all families, IFN-g2 gene expression was induced relative to mock controls at 24 hpi, maximum gene expression was observed at 48 hpi and showed a slight decline in expression at 72 hpi (Table 2). IFN1S and IFN2 normalized gene expression ratios (ratio of specific gene/housekeeping gene ARP) of individual fish were significantly correlated with viral load at 48 and 72 hpi (P < 0.001

101

all comparisons) for all genes analyzed but not at 24 hpi (P ¼ 0.11 and 0.25 for IFN1S and IFN2, respectively) (Table 2). IFN-g2 gene expression was significantly correlated in individuals with viral load at 24 and 48 hpi (P ¼ 0.006 and 0.016, respectively) but was not quite significant at 72 hpi (P ¼ 0.062) (Table 2). Since viral load was significantly correlated with IFN gene expression and was a significant predictor of family CPM itself, we retained viral load in all regression models to control for the effect of viral load when examining the association between family gene expression and CPM (Table 3). We also accounted for mean family size in the model because of the variation among families and because retaining this term improved the fit of the model (as evidenced by r2 values greater than >0.7 in Table 3). IFN1S expression at 72 hpi was a significant predictor of mean family susceptibility (CPM) (F(1,3) ¼ 11.692, P ¼ 0.042). IFN2 expression at 72 hpi was also a significant predictor of family CPM (F(1,3) ¼ 17.468, P ¼ 0.025) but there was also a significant effect of mean family weight (F(1,3) ¼ 11.579, P ¼ 0.042). IFN-g2 expression was not significant at any time point (Table 3). A total of 9 statistical tests were performed (Table 3), which may lead to multiple testing errors. A simple but highly conservative approach to account for these errors is to adjust the P-value using a Bonferroni correction [38]. In this study, a Bonferroni corrected P-value would be P < 0.006. The significant associations between gene expression and family CPM observed in this study did not meet this stricter criterion. 3.4. Basal expression of immune genes The positive relationship observed between viral load and disease outcome at early time points and the failure to observe a correlation between inducible immune gene expression and family resistance prompted us to question the role of constitutive defenses in family susceptibility. Basal gene expression was assayed in the pre-challenge anterior kidney samples (6 unhandled fish per family). A range of genes were assayed including the long transcript form of IFN1 (IFN1L), IFN1S, IFN2, IFN3, IFN-g1, IFN-g2, IL-1b1, IRF-3, MDA-5, Mx-1, TLR-22A, TLR-22B, TLR-3 and Vig-1 (Table 4). Variation in gene expression was observed among families but there were no genes in which expression level was significantly associated with CPM of the family. However, a suggestive but non-significant negative association with CPM (indicating a protective effect) was observed for IFN1S, IFN2 and IFN3 (Table 4). A suggestive positive association (indicating a non-protective effect) with CPM was observed for IL-1b1 (Table 4). 3.5. Neutralizing antibody response Serum samples from survivors of the IHNV or mock injection challenge were analyzed for neutralizing antibody response. A total of 2 mock challenged fish and 5 IHNV challenged fish per family were sampled at 45 dpi (Table 5). Mortality in families 07–011 and 07–012 meant that only 2 and 0 fish were tested from those families, respectively. All sera from mock challenged fish had neutralizing antibody titers <20, which were considered negative. All survivors from the IHNV challenge had detectable neutralizing antibody titers except for 2 fish from family 07–054 (Table 5). There was no evidence of a trend associated with neutralizing antibody titer and family CPM. 4. Discussion Rainbow trout become more resistant to IHNV as they increase in size [39]. However, we observed that relative family susceptibility was a stable trait as progeny fish grew, evidenced by the fact that susceptibility at 1 g size was a significant predictor of family

102

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

A

8

Mean log (viral load)

7

8.2g 8.0g

50.0

9.8g 75.0

10.7g 69.5

11.3g 58.9

12.0g

10.3g

94.1

100.0

Mean family weight and CPM

36.7

6 5

24 hrs

4

48 hrs

3

72 hrs

2 1 0 07-007

07-054

07-002

07-009

07-004

07-011

07-012

B

Family Arcsine sq. root (CPM)

Full-sibling families 2.0

24 hrs

r2 = 0.288

1.6 1.2

P = 0.214

0.8

F(1,5) = 2.02

0.4 0.0 0

1

2

3

4

5

6

7

Family Arcsine sq. root (CPM)

r2 = 0.577

48 hrs

2.0

F(1,5) = 6.82

1.2 0.8 0.4 0.0 0

Family Arcsine sq. root (CPM)

P = 0.048

1.6

1

2

3

4

5

6

7

r 2 = 0493

2.0

P = 0.079

1.6

F(1,5) = 4.86

1.2 0.8 0.4 0.0 0

1

2

3

4

5

6

7

Family mean log (viral load) Fig. 2. (A) Mean viral load in the anterior kidney at 24, 48 and 72 h post-infection of full-sibling families injection challenged with IHNV at 10 g size. Six fish were analyzed per time point from each family. The mean cumulative percent mortality and weight of the families in the challenge are listed above the bar graphs. (B) Relationship between viral load and family CPM at the three time points (general linear model; arcsine square root (CPM) ¼ log (viral load)).

susceptibility at 10 g size. Our results indicate that IHNV susceptibility was not a transitory effect related to development or other factors. Previous studies have also demonstrated that relative disease resistance was maintained as fish grew [40,41]. IHNV has been reported to enter fish at the gills, intestine and skin, particularly at the base of the fins [42–44] and it is hypothesized that the sensors in the superficial tissues may function to alert internal lymphoid tissues to activate anti-viral defenses [45]. I.P. injection challenge could bypass these superficial sensors. However, in this study susceptibility determined by immersion challenge was significantly associated susceptibility determined by injection challenge. IHNV rapidly replicates in rainbow trout [42,44] and a previous study in rainbow trout with high and low virulence IHNV strains

suggests that disease outcome is determined quickly (<72 hpi) [12]. Studies with the related rhabdovirus Viral hemorrhagic septicemia virus (VHSV) have demonstrated that rapid viral replication in fin explants cultures is highly correlated with disease susceptibility [45,46]. In this study, early in vivo viral replication, measured as viral load in the anterior kidney was positively associated with family CPM and was a significant predictor of susceptibility at 48 hpi For instance, the most resistant family (07–007) had w 10to 100-fold less viral load at 24 and 48 hpi, respectively, relative to the most susceptible family (07–012). The association we observed between early viral replication and mortality was not surprising since IHNV is an acute virus, but it was notable that the differences among the families manifested early causing us to question if inducible gene products could account for this effect.

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

103

Table 2 Type I and II interferon (IFN) gene expression at 24, 48 and 72 h post-IHNV infection. Data are presented as the mean fold change for each family (IHNV-infected/mock control)  the SEM. Mean gene expression of all families is highlighted in italics. Six fish were analyzed per family per time point. The families are ordered in the table from lowest susceptibility (07–007) to the highest susceptibility (07–012). Family

CPM

IFN1-S

IFN-g2

IFN2

24 h

48 h

72 h

07–007 36.7% 13.3  6.3 670.2  342.1 246.7  95.1 07–054 50.0% 3.5  1.7 1163.1  461.8 1277.7  290.7 07–002 58.9% 2.2  0.9 254.3  118.9 253.6  69.9 07–009 69.5% 4.5  1.4 807.8  309.4 505.7  153.4 07–004 75.0% 5.4  1.1 322.8  174.5 834.5  215.9 07–011 94.1% 19.0  6.8 1198.6  283.1 465.7  160.3 07–012 100.0% 4.0  1.1 699.4  128.5 2592.9  781.5 Mean all families 7.4  2.8 730.9  259.8 882.4  252.4 r ¼ 0.25 r ¼ 0.79* r ¼ 0.52* Correlation with viral load?a

24 h

48 h

72 h

24 h

6.2  4.7 1.4  0.4 2.7  0.7 1.5  0.3 1.7  0.2 1.5  0.4 2.0  0.5 2.4  1.1 r ¼ 0.18

77.3  45.7 412.6  193.2 61.4  29.2 141.1  58.3 123.8  101.4 376.1  101.5 180.0  47.9 196.0  82.5 r ¼ 0.73*

53.7  26.9 484.3  188.3 96.3  29.1 207.0  68.8 448.2  132.8 259.1  85.9 989.9  251.9 362.5  112.0 r ¼ 0.71*

22.2  9.8 7195.3  4046.7 10.5  8.2 4422.7  1578.8 2.9  1.3 1279.1  611.0 11.3  5.7 8549.3  3835.0 9035.0  4995.1 4.5  1.3 31.6  18.2 4632.9  2467.3 13.3  5.0 14 247.3  4083.2 13.8  7.1 7051.7  3088.1 r ¼ 0.42* r ¼ 0.37*

48 h

72 h 1902.7  1931.7  904.6  2380.0  1791.9  1172.5  5337.3  2302.0  r ¼ 0.29

771.2 560.5 226.7 971.1 378.7 475.7 2131.8 788.0

a Pearson's correlation analysis between the viral load levels and normalized gene expression ratios in individual fish (bolded and starred correlation coefficients are significant (P < 0.05)). Association of gene expression with cumulative percent mortality (CPM) and other covariates is presented in Table 3.

Table 3 Summary of the associations of mean family interferon gene expression, log viral load and weight (g) to cumulative percent mortality of families analyzed with a general linear modela. P-values <0.05 are designated in boldb. Gene

r2

Time

df

Gene Expression

Viral Load

Weight

F

P

F

P

F

P

IFN1S

24 h 48 h 72 h

0.795 0.844 0.905

1,3 1,3 1,3

1.297 0.716 11.692

0.337 0.460 0.042b

6.427 8.696 0.376

0.085 0.06 0.583

7.114 3.691 8.502

0.076 0.15 0.062

IFN2

24 h 48 h 72 h

0.722 0.821 0.932

1,3 1,3 1,3

0.166 0.251 17.468

0.711 0.651 0.025b

3.309 7.024 0.817

0.166 0.077 0.433

2.617 3.658 11.579

0.204 0.152 0.042b

IFN-g2

24 h 48 h 72 h

0.846 0.787 0.845

1,3 1,3 1,3

2.693 2.457 5.964

0.199 0.215 0.092

9.033 2.569 0.006

0.057 0.207 0.945

10.037 8.442 4.189

0.051 0.062 0.133

a Arcsine square root (CPM) ¼ fold gene expression þ log (viral load) þ weight. The maximal model included higher order interactions but these interactions were dropped because they were non-significant. b These findings are non-significant using a Bonferroni corrected significance threshold of P < 0.006.

Given the rapid in vivo replication of IHNV, the host has limited time to induce a protective host response. Expression of the type I IFN (IFN1S and IFN2) and type II IFN (IFN-g2) genes was quickly induced in response to the virus (by 24 hpi). Type II IFN but not type I IFN gene expression was significantly correlated with viral load at the 24 h time point. This result suggests that type I IFN gene

expression in the kidney may be responding to virus encountered at other secondary sites while type II IFN is responding directly to virus present in the kidney. The difference between type I and II IFN gene expression may also be related to the types of cells present in the kidney at each time point after challenge, since these two classes of IFNs are likely produced by different cell types. IFN1S and

Table 4 Constitutive immune gene expression in anterior kidney tissue sampled from pre-challenge families (n ¼ 6 fish per family). Data are presented as normalized valuesa  SEM. The families are ordered in the table from lowest susceptibility (07–007) to the highest susceptibility (07–012). There were no significant associations detected. For each gene, the family that was used as a calibrator group is designated in bold (as described belowa). Gene

IFN1L IFN1S IFN2 IFN3 IFN-g1 IFN-g2 IL-1b1 IRF-3 MDA-5 MX-1 TLR-22A TLR-22B TLR-3 VIG-1

Family

P-value

07–007

07–054

1.8  1.6  1.7  2.0  3.0  1.0  1.9  1.4  1.6  2.1  1.8  1.3  2.4  2.3 

1.7 2.0 1.2 4.6 2.3 1.9 1.3 1.2 1.1 2.4 1.3 1.3 2.4 1.3

0.6 0.6 0.4 1.0 0.8 0.3 0.8 0.3 0.3 1.0 0.3 0.3 0.4 0.4

             

0.7 0.8 0.3 3.6 1.1 0.9 0.3 0.2 0.3 0.5 0.2 0.3 1.3 0.4

07–002 2.4 1.4 1.8 2.8 8.7 1.9 1.0 2.4 1.4 7.6 3.3 3.0 2.3 2.8

             

0.7 0.5 0.4 0.9 2.3 0.6 0.3 0.6 0.3 2.7 0.7 0.6 0.6 0.6

07–009

07–004

1.6  1.5  1.8  1.2  1.0  1.1  1.6  1.0  1.0  2.3  2.5  1.6  1.0  1.4 

2.6 1.0 1.2 1.3 1.7 1.1 2.8 1.1 1.0 1.0 1.4 1.1 4.0 1.0

0.3 0.6 0.3 0.2 0.4 0.2 0.3 0.1 0.1 1.0 0.4 0.3 0.2 0.2

             

1.5 0.3 0.3 0.3 0.8 0.4 1.3 0.3 0.3 0.4 0.4 0.3 2.1 0.3

07–011 1.0 1.3 1.0 1.0 3.7 1.4 1.5 2.0 1.5 9.1 2.3 1.0 2.1 4.6

             

0.3 0.3 0.2 0.2 1.8 0.7 0.3 0.4 0.3 4.6 0.6 0.3 0.4 2.4

07–012 1.9 1.4 1.0 1.3 3.8 1.8 3.3 1.0 1.3 3.3 1.0 1.4 1.5 1.3

             

0.6 0.3 0.2 0.2 0.8 0.6 1.4 0.2 0.2 0.8 0.2 0.4 0.2 0.4

0.75 0.20 0.16 0.11 0.87 0.74 0.14 0.64 0.83 0.65 0.59 0.59 0.63 0.90

a Normalized constitutive gene expression was calculated by taking the ratio of the specific gene divided by the housekeeping gene (ARP). For each gene, the family with the lowest constitutive expression was used as a calibrator group and expression in the remaining families was divided by expression in the calibrator group (the calibrator group has a value of 1.0).

104

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105

Table 5 IHNV neutralizing antibody titers from surviving IHNV-infected fisha sampled at 45 days post-infection. Titers were based on the highest serum dilution that provided 50% plaque reduction relative to negative serum controls. Family

CPM

Samples Tested

Titer <20

160

320

640

1280

2560

07–007 07–054 07–002 07–009 07–004 07–011 07–012

36.7% 50.0% 58.9% 69.5% 75.0% 94.1% 100.0%

5 5 5 5 5 2 0

– 2 – – – – –

1 – – 1 – – –

1 1 3 2 – 1 –

– 1 2 1 2 – –

2 – – 1 2 – –

1 1 – – 1 1 –

a Serum from mock-challenged fish (2 fish per family; total N ¼ 14) had neutralizing antibody titers <20, which were considered negative.

IFN2 gene expression was significantly associated with family disease outcome (CPM) at 72 hpi, when the effect of viral load and body weight on gene expression was controlled. However, when the significance threshold (P-value) was corrected for multiple tests, these differences were no longer significant. Additionally, type I IFN gene expression was only having an effect at 72 hpi whereas the differences among the families in viral load were already apparent at 24–48 hpi. In this study, we focused only on the IFN genes themselves because they represent the key early genes that initiate the IFN pathway, the critical anti-viral innate defense pathway [47]. Systemic up-regulation of IFN-related genes is correlated to early non-specific protective immunity following IHNV DNA vaccination [19,26]. In other studies we have examined additional immune genes (e.g. IFN stimulated genes and other cytokines) after live viral infection and the kinetics of gene expression changes lagged viral load [12]. Thus, we would predict that examination of additional genes in this study would also lag viral load. Resistant families had lower viral replication starting at the earliest time points measured in this study. This led us to question whether constitutive defenses might be associated with resistance. To partially address this question, we surveyed the constitutive expression of a range of immune related genes associated with anti-viral immunity including several important innate immune receptors (e.g. MDA-5, TLR-3, TLR-22A and TLR-22B). Although variation in constitutive gene expression was observed among families, there was no evidence of a significant association with CPM. A suggestive protective (negative) association was observed between CPM and constitutive expression of type I IFN (IFN1S, IFN2 and IFN3) genes but this association was not significant. The power to detect associations may have been limited since the study only contained 7 families; more families may be required to detect a small effect. Alternatively, it may be that constitutive genes other than those tested here are responsible for the differences among the families. Global gene expression approach (e.g. microarrays) may identify constitutive genes associated with resistance but these experiments would be costly, requiring analyses of multiple individuals from multiple families. Additionally, the genes controlling IHNV resistance may not be differentially regulated at the mRNA level. Integration of functional studies with genetic linkage or association mapping of the trait may be needed to identify the genes underlying IHNV resistance. Passive immunization studies showed that sera containing detectable neutralizing antibody titers (>1:20) were able to protect juvenile trout against IHNV, demonstrating the importance of specific humoral immunity [20,48]. Neutralizing antibodies are slow to develop in finfish and are not capable of protecting naïve fish from acute viral challenges [20], such as used in this study. Here we sought to test the relationship between innate resistance and

development of specific immunity. Other researchers working with attenuated fish rhabdoviruses have observed that low mortality in a primary challenge was associated with poor development of specific immunity [49,50] suggesting that a certain threshold of viral replication is needed to trigger specific immunity. In the present study, we had only limited number of survivors available for testing but we observed no indication of a trade-off between levels of early viral replication and development of specific immunity. Rhabdoviruses are inhibited by poly I:C stimulation of the IFN system [15,51]. The early anti-viral response induced by an IHNV glycoprotein DNA vaccine provides non-specific protection of trout against challenge with IHNV and VHSV and is correlated with systemic up-regulation of IFN stimulated genes [19,52,53]. More recently, IFN recombinant proteins have been shown to inhibit VHSV in vitro and IHNV in vivo [16,28]. Here we demonstrate that trout from all families mount a rapid IFN response but this response correlates with viral load. Thus, IHNV appears to be sensitive to IFN but can continue to replicate in vivo in the presence of a strong, but lagging, host IFN response. Rapid early viral replication may result in a threshold of virus that the IFN system cannot control [12,54]. The most resistant families had lower viral replication as early as 24 hpi, which is a very limited time in which the host can mount an adequate inducible defense. A weakly significant effect of type I IFN gene expression on mean family CPM was observed but not until 72 hpi. Initially, we hypothesized that resistant families would have differences in innate immune gene expression that differed in magnitude of response or timing of response compared with susceptible families. Here we show that such differences were not detected suggesting constitutive defenses or other barriers to rapid viral replication appear to be operating. Acknowledgements The authors would like to acknowledge the assistance of Ma. ~ aranda, Chang Hoon Moon, Bill Shewmaker, Robin Michelle Pen Burkhart and Richard Towner. We thank Andrew Wargo for advice on statistical methods. The project was supported by the National Research Initiative of the USDA Cooperative State Research, Education and Extension Service, grant number 2006-3520417393. The use of trade, firm, or corporation names in this publication is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the U.S. Department of Interior or the U.S. Geological Survey of any product or service to the exclusion of others that may be suitable. References [1] Tordo N, Benmansour A, Calisher C, Dietzgen RG, Fang R-X, Jackson AO, et al. Family Rhabdoviridae. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, editors. Virus taxonomy: VIIIth report of the international committee on taxonomy of viruses. Academic Press; 2005. [2] Troyer RM, LaPatra SE, Kurath G. Genetic analyses reveal unusually high diversity of infectious haematopoietic necrosis virus in rainbow trout aquaculture. Journal of General Virology 2000;81:2823–32. [3] St-Hilaire S, Ribble CS, Stephen C, Anderson E, Kurath G, Kent ML. Epidemiological investigation of infectious hematopoietic necrosis virus in salt water net-pen reared Atlantic salmon in British Columbia, Canada. Aquaculture 2002;212:49–67. [4] Salonius K, Simard N, Harland R, Ulmer JB. The road to licensure of a DNA vaccine. Current Opinion Investigational Drugs 2007;8:635–41. [5] Kurath G. Overview of recent DNA vaccine development for fish. In: Midlyng PJ, editor. Progress in fish vaccinology. Development in biological standards ed, vol. 121. Basel: Karger; 2005. p. 201–13. [6] Hulata G. Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies. Genetica 2001;111:155–73. [7] Yamamoto S, Sanjyo I, Sato R, Kohara M, Tahara H. Estimation of the heritability for resistance to infectious hematopoietic necrosis in rainbow trout. Bulletin of the Japanese Society of Scientific Fisheries 1991;57:1519–22.

M.K. Purcell et al. / Fish & Shellfish Immunology 28 (2010) 98–105 [8] Palti Y, Parsons JE, Thorgaard GH. Identification of candidate DNA markers associated with IHN virus resistance in backcrosses of rainbow (Oncorhynchus mykiss) and cutthroat trout (O. clarki). Aquaculture 1999;173:81–94. [9] Palti Y, Nichols KM, Waller KI, Parsons JE, Thorgaard GH. Association between DNA polymorphisms tightly linked to MHC class II genes and IHN virus resistance in backcrosses of rainbow and cutthroat trout. Aquaculture 2001;194:283–9. [10] Miller KM, Winton JR, Schulze AD, Purcell MK, Ming TJ. Major histocompatibility complex loci are associated with susceptibility of Atlantic salmon to infectious hematopoietic necrosis virus. Environmental Biology of Fishes 2004;69:307–16. [11] Barroso RM, Wheeler PA, LaPatra SE, Drew R, Thorgaard GH. QTL for IHNV resistance and growth identified in a rainbow (Oncorhynchus mykiss)  Yellowstone cutthroat (Oncorhynchus clarki bouvieri) trout cross. Aquaculture 2008;277:156–63. ~ aranda MMD, Purcell MK, Kurath G. Differential virulence mechanisms of [12] Pen infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss) include host entry and virus replication kinetics. Journal of General Virology 2009;90:2172–82. [13] Purcell MK, Kurath G, Garver KA, Herwig RP, Winton JR. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection of DNA vaccination. Fish and Shellfish Immunology 2004;17:447–62. [14] Landis ED, Purcell MK, Thorgaard GH, Wheeler PA, Hansen JD. Transcriptional profiling of MHC class I genes in rainbow trout infected with infectious hematopoietic necrosis virus. Molecular Immunology 2008;45:1646–57. [15] Eaton WD. Anti-viral activity in four species of salmonids following exposure to poly inosinic:cytidylic acid. Diseases of Aquatic Organisms 1990;9:193–8. [16] Ooi EL, Verjan N, Haraguchi I, Oshima T, Kondo H, Hirono I, et al. Innate immunomodulation with recombinant interferon-alpha enhances resistance of rainbow trout (Oncorhynchus mykiss) to infectious hematopoietic necrosis virus. Developmental and Comparative Immunology 2008;32:1211–20. [17] LaPatra SE, Corbeil S, Jones GR, Shewmaker WD, Lorenzen N, Anderson ED, et al. Protection of rainbow trout against infectious hematopoietic necrosis virus four days after specific or semi-specific DNA vaccination. Vaccine 2001;19:4011–9. [18] Lorenzen N, Lorenzen E, Einer-Jensen K, La Patra SE. Immunity induced shortly after DNA vaccination of rainbow trout against rhabdoviruses protects against heterologous virus but not against bacterial pathogens. Developmental and Comparative Immunology 2002;26:173–9. [19] Purcell MK, Nichols KM, Winton JR, Kurath G, Thorgaard GH, Wheeler P, et al. Comprehensive gene expression profiling following DNA vaccination of rainbow trout against Infectious hematopoietic necrosis virus. Molecular Immunology 2006;43:2089–106. [20] Lorenzen N, LaPatra SE. Immunity to rhabdoviruses in rainbow trout: the antibody response. Fish and Shellfish Immunology 1999;9:345–60. [21] LaPatra SE, Lauda KA, Jones GR. Antigenic variants of infectious hematopoietic necrosis virus and implications for vaccine development. Diseases of Aquatic Organisms 1994;20:119–26. [22] Fijan N, Sulimanovic D, Bearzotti M, Muzinic D, Zwillenberg L, Chilmonczyk S, et al. Some properties of the epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Annals of Virology 1983;134E:207–20. [23] Batts WN, Winton JR. Enhanced detection of infectious hematopoetic necrosis virus and other fish viruses by pretreatment of cell monolayers with polyethylene glycol. Journal of Aquatic Animal Health 1989;1:284–90. [24] Corbeil S, LaPatra SE, Anderson ED, Jones J, Vincent B, Hsu YL, et al. Evaluation of the protective immunogenicity of the N, P, M, NV and G proteins of infectious hematopoietic necrosis virus in rainbow trout Oncorhynchus mykiss using DNA vaccines. Diseases of Aquatic Organisms 1999;39:29–36. [25] Purcell MK, Hart SA, Kurath G, Winton JR. Strand-specific, real-time RT-PCR assays for quantification of genomic and positive-sense RNAs of the fish rhabdovirus infectious hematopoietic necrosis virus. Journal of Virological Methods 2006;132:18–24. [26] Purcell MK, Laing KJ, Woodson J, Thorgaard G, Hansen JD. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes. Fish and Shellfish Immunology 2009;26:293–304. [27] Pierce AL, Dickey JT, Larsen DL, Fukada H, Swanson P, Dickhoff WW. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA and its application in the study of GH regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General and Comparative Endocrinology 2004;135: 401–11. [28] Zou J, Tafalla C, Truckle J, Secombes C. Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. Journal of Immunology 2007;179:3859–71. [29] Zou J, Carrington AC, Collet B, Dijkstra JM, Yoshiura Y, Bols N, et al. Identification and bioactivities of IFN-gamma in rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish. Journal of Immunology 2005;175:2484–94. [30] Trobridge GD, Leong JA. Characterization of a rainbow trout Mx gene. Journal of Interferon and Cytokine Research 1995;15:691–702.

105

[31] Boudinot P, Massin P, Blanco M, Riffault S, Benmansour A. Vig-1, a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family. Journal of Virology 1999;73:1846–52. [32] Zou J, Grabowski PS, Cunningham C, Secombes CJ. Molecular cloning of interleukin 1beta from rainbow trout Oncorhynchus mykiss reveals no evidence of an ice cut site. Cytokine 1999;11:552–60. [33] Holland JW, Bird S, Williamson B, Woudstra C, Mustafa A, Wang T, et al. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: functional analysis and transcriptional modulation. Molecular Immunology 2008;46:269–85. [34] Rodriguez MF, Wiens G, Purcell MK, Palti Y. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005;57:510–9. [35] Matsuo A, Oshiumi H, Tsujita T, Mitani H, Kasai H, Yoshimizu M, et al. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. Journal of Immunology 2008;181:3474–85. [36] Sun B, Robertsen B, Wang Z, Bin L. Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties. Developmental and Comparative Immunology 2008;33:547–58. [37] LaPatra SE, Turner T, Lauda KA, Jones GR, Walker S. Characterization of the humoral response of rainbow trout to infectious hematopoietic necrosis virus. Journal of Aquatic Animal Health 1993;5:165–71. [38] Rice WR. Analyzing tables of statistical tests. Evolution 1989;43:223–5. [39] LaPatra SE, Groberg WJ, Rohovec JS, Fryer JL. Size-related susceptibility of salmonids to two strains of infectious hematopoietic necrosis virus. Transactions of the American Fisheries Society 1990;119:25–30. [40] Hadidi S, Glenney GW, Welch TJ, Silverstein JT, Wiens GD. Spleen size predicts resistance of rainbow trout to Flavobacterium psychrophilum challenge. Journal of Immunology 2008;180:4156–65. [41] Quillet E, Dorson M, Le Guillou S, Benmansour A, Boudinot P. Wide range of susceptibility to rhabdoviruses in homozygous clones of rainbow trout. Fish and Shellfish Immunology 2007;22:510–9. [42] Yamamoto T, Batts WN, Arakawa CK, Winton JR. Multiplication of infectious hematopoietic necrosis virus in rainbow trout following immersion infection: Whole-body assay and immunohistochemistry. Journal of Aquatic Animal Health 1990;2:271–80. [43] Drolet BS, Rohovec JS, Leong JC. The route of entry and progression of infectious haematopoietic necrosis virus in Oncorhynchus mykiss (Walbaum): a sequential immunohistochemical study. Journal of Fish Diseases 1994;17:337–47. [44] Harmache A, LeBerre M, Droineau S, Giovannini M, Bremont M. Bioluminescence imaging of live infected salmonids reveals that the fin bases are the major portal of entry for Novirhabdovirus. Journal of Virology 2006;80:3655–9. [45] Quillet E, Dorson M, Aubard G, Torhy C. In vitro assay to select rainbow trout with variable resistance/susceptibility to viral haemorrhagic septicaemia virus. Diseases of Aquatic Organisms 2007;76:7–16. [46] Quillet E, Dorson M, Aubard G, Torhy C. In vitro viral haemorrhagic septicemia virus replication in excised fins of rainbow trout: correlation with resistance to waterborne challenge and genetic variation. Diseases of Aquatic Organisms 2001;45:171–82. [47] Sen GC. Viruses and interferons. Annual Review of Microbiology 2001;55: 255–81. [48] LaPatra SE, Lauda KA, Jones GR, Walker S, Shewmaker WD. Development of passive immunotherapy for control of infectious hematopoeitic necrosis. Diseases of Aquatic Organisms 1994;20:1–6. [49] Bernard J, de Kinkelin P, Bearzotti-le Berre M. Viral hemorrhagic septicemia of rainbow trout: relation between the G polypeptide and antibody production in protection of fish after infection with the F25 attenuated variant. Infectious Immunity 1983;39:7–14. [50] Bernard J, Bearzotti-le Berre M, De Kinkelin P. Viral haemorrhagic septicaemia in rainbow trout: attempt to relate interferon production, antibody synthesis and structure of the virus with the mechanism of virulence. Annalles Institute Pasteur 1985;136:13–26. [51] Renault T, Torchy C, De Kinkelin P. Spectrophotometric method for titration of trout interferon, and its application to rainbow trout fry experimentally infected with viral haemorrhagic septcaemia virus. Diseases of Aquatic Organisms 1991;10:23–9. [52] McLauchlan PE, Collet B, Ingerslev E, Secombes CJ, Lorenzen N, Ellis AE. DNA vaccination against viral haemorrhagic septicaemia (VHS) in rainbow trout: size, dose, route of injections and duration of protection-early protection correlates with Mx expression. Fish and Shellfish Immunology 2003;15: 39–50. [53] Boudinot P, Blanco M, de Kinkelin P, Benmansour A. Combined DNA immunization with the glycoprotein gene of viral hemorrhagic septicemia virus and infectious hematopoeitic necrosis virus induces double-specific immunity and nonspecific responses in rainbow trout. Virology 1998;249:297–306. [54] Purcell MK, Ka G, Conway CM, Elliott DG, Kurath G. Infectious hematopoietic necrosis virus genogroup-specfic virulence mechanisms in sockeye salmon (Oncorhynchus nerka) from Redfish Lake Idaho. Journal of Fish Diseases 2009;32:619–31.