RXR isoform cloning and ligand-binding properties

General and Comparative Endocrinology 173 (2011) 346–355

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Ecdysteroid receptor from the American lobster Homarus americanus: EcR/RXR isoform cloning and ligand-binding properties Ann M. Tarrant ⇑, Lars Behrendt 2, John J. Stegeman, Tim Verslycke 1 Biology Department, 45 Water Street, Woods Hole Oceanographic Institution, Woods Hole, MA 02543, USA

a r t i c l e

i n f o

Article history: Received 7 December 2010 Revised 2 June 2011 Accepted 14 June 2011 Available online 22 June 2011 Keywords: Crustacean Binding Ligand Ponasterone A Retinoid Tebufenozide

a b s t r a c t In arthropods, ecdysteroids regulate molting by activating a heterodimer formed by the ecdysone receptor (EcR) and retinoid X receptor (RXR). While this mechanism is similar in insects and crustaceans, variation in receptor splicing, dimerization and ligand affinity adds specificity to molting processes. This study reports the EcR and RXR sequences from American lobster, a commercially and ecologically important crustacean. We cloned two EcR splice variants, both of which specifically bind ponasterone A, and two RXR variants, both of which enhance binding of ponasterone A to the EcR. Lobster EcR has high affinity for ponasterone A and muristerone and moderately high affinity for the insecticide tebufenozide. Bisphenol A, diethyl phthalate, and two polychlorinated biphenyls (PCB 29 and PCB 30), environmental chemicals shown to interfere with crustacean molting, showed little or no affinity for lobster EcR. These studies establish the molecular basis for investigation of lobster ecdysteroid signaling and signal disruption by environmental chemicals. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction In arthropods, ecdysteroids regulate development, reproduction, and especially the periodic shedding of the exoskeleton (ecdysis) [5,45,49]. Ecdysteroid signaling is mediated through the ecdysone receptor (EcR), a transcription factor in the nuclear receptor superfamily [37,46,54]. EcR forms a heterodimer with another nuclear receptor, the retinoid X receptor (RXR), which is called ultraspiracle (USP) in insects; this functional EcR:RXR heterodimer is sometimes referred to as the ‘‘ecdysteroid receptor’’ [29,64]. Binding of ecdysteroids activates the EcR–RXR dimer and regulates transcription of target genes through ecdysteroid responsive elements on the DNA [53,64]. In crustaceans, a diverse group of arthropods closely related to insects [17,68], ecdysteroids regulate molting and limb regeneration [7,21] and have also been associated with regulation of vitellogenesis [14,19,49,55]. EcR sequences and/or expression patterns have been described in several crustaceans, including the fiddler crab Uca pugilator [9,10], the land crab Gecarcinus lateralis [29], the kuruma prawn Marsupenaeus japonicus [2], the brown shrimp

⇑ Corresponding author. Fax: +1 508 457 2134. E-mail addresses: [email protected] (A.M. Tarrant), [email protected] (L. Behrendt), [email protected] (J.J. Stegeman), [email protected] (T. Verslycke). 1 Present address: Gradient, 20 University Road, Cambridge, MA 02138, USA. 2 Present address: Department of Biology, Microbiology Section, University of Copenhagen, Sølvgade 83 h, Copenhagen 1307, Denmark. 0016-6480/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2011.06.010

Crangon crangon [56], the copepod Tigriopus japonicus [24], and the cladoceran Daphnia magna [28,61]. Similarly RXRs have been sequenced from U. pugilator [9,10], G. lateralis [30], M. japonicus [2], C. crangon [56], and D. magna [28,61]. Both the EcR and RXR exhibit the domain structure typical of nuclear receptors (reviewed by [31,44]). The amino terminal A/B domain is highly variable and contains the activation function 1 (AF-1) that helps to regulate transcriptional activity. The C domain, also called the DNA-binding domain (DBD), is the most highly conserved domain and contains two zinc finger motifs that enable binding to regulatory sequences of target genes. The D domain, or hinge region, is a more variable region that adds flexibility to the protein and can enable synergism between domains. The carboxy terminal contains both the ligand-binding domain (LBD, E), which is well-conserved within receptor types, and the divergent F domain. The LBD enables ligand interactions, cofactor binding, dimerization, and ligand-dependent transactivation. EcR splice variants have been identified in both insects and crustaceans, but the patterns differ markedly among species. Variants in the EcR A/B domain are well-characterized in insects [3,8,23,35,51] and have been identified in some crustaceans [2,28]; in insects these forms vary in expression, transcriptional activity and physiological function. Structurally similar A/B domain splice variants have been identified in the EcR from D. magna [28], and their expression patterns suggest distinct physiological roles for these variants during the molt cycle. Different from the A/B domain variants that have been primarily studied in insects, alternatively spliced regions of the hinge domain and

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

ligand-binding domain (LBD) have been identified in M. japonicus [2] and U. pugilator, [10] respectively. In addition, RXR variants cloned from U. pugilator differ in their ability to dimerize with EcR, bind ligands, and and mediate transactivation [22,63]. Such studies indicate complexity in crustacean ecdysteroid signaling and possibly functional distinctions from insects, but how regulatory functions differ among splice variants in diverse crustacean species is unknown. The selectivity of EcR for ligands and the requirement for heterodimerization with RXR also vary among arthropods. For example, while 20-hydroxyecdysone is the primary physiological ecdysteroid in most insects, ecdysone is also highly potent in the mosquito Aedes aegypti [60]. Insects also vary in their EcRmediated sensitivity to phytosteroids and non-steroidal agonists such as diacylhydrazines, differences that are exploited in the design of selective pesticides [12]. Cell-based reporter assays comparing the D. magna and D. melanogaster EcRs revealed subtly different responses to ligands, with D. magna sensitive to lower concentrations of ponasterone A [28]. In addition to variation in ligand affinity, EcRs also vary in their interactions with RXR. Notably, heterodimer formation enhances ecdysteroid binding and potentiates transcriptional activity of EcR in most species, but dimerization with RXR does not enhance ecdysteroid binding in the scorpion Liocheles australasiae [38]. In this study we have provided the first description of the EcR and RXR transcripts from the American lobster, Homarus americanus, and we have measured the affinity of ecdysteroids and environmental contaminants for the EcR/RXR heterodimer. Characterizing EcR/RXR signaling in diverse crustaceans is important for our fundamental understanding of the evolution of this signaling pathway and of hormonal regulation of crustacean physiology. It also forms a basis for evaluating disruption of ecdysteroid signaling by environmental chemicals. For instance, while disruption of insect ecdysteroid signaling has been thoroughly studied in the pursuit of designing selective pesticides [12], the potential impacts of these pesticides on non-target organisms, especially crustaceans, warrants further study. A species of particular interest, the American lobster is a cultural, economical and historical icon in New England. Commercial lobster stocks have significantly declined over the last decade in southern New England, with the exact cause of this decline currently unknown and the subject of active research [57]. Field- and laboratory-based studies have shown that lobsters can accumulate alkyphenols, pesticides and other contaminants in their lipid-rich tissues [4,43,58]. Thus, characterizing ecdysteroid signaling in lobsters and the potential for endocrine disruption may have significant implications for resource management.

2. Materials and methods

347

other ligands were obtained from Sigma–Aldrich (St. Louis MO, USA).

2.3. Cloning of the lobster ecdysone receptor (EcR) and retinoid X receptor (RXR) Complementary DNA (cDNA) was synthesized from total RNA or poly(A)-enriched RNA using the Iscript cDNA synthesis kit (Bio-Rad, Hercules CA, USA). Primer sequences are given in Table 1. To initially clone the EcR, total RNA was extracted and pooled from abdominal muscle, claw muscle, hepatopancreas and ovary and used to prepare poly(A)-enriched RNA. An 825-bp fragment of the EcR was amplified using polymerase chain reaction (PCR) with degenerate primers dEcR_F and dEcR_R. This amplification was conducted using Advantage 2 polymerase with 1 lM primers under the following conditions: 94 °C for 30 s, 4 cycles of (94 °C for 15 s, 56.9 °C for 10 s, 68 °C for 60 s) followed by 40 cycles of (94 °C for 15 s, 54 °C for 10 s, 68 °C for 60 s) and an extension step of 68 °C for 7 min. Initial amplification of the RXR was conducted using cDNA synthesized from ovary total RNA. A 147-bp fragment of the RXR was amplified using Advantage 2 Polymerase and 1 lM of primers dRXR_F and dRXR_R with the following cycling conditions: 94 °C for 30 s, 40 cycles of (94 °C for 5 s, 60 °C for 10 s, 72 °C for 45 s). 72 °C for 7 min. Additional sequence information for both the EcR and RXR was obtained via 50 - and 30 RACE with the Marathon RACE and SMART RACE kits (Clontech, BD Biosciences, Mountain View CA, USA) for EcR and RXR, respectively. The cDNA template for the EcR reactions was constructed from poly(A)-enriched RNA pooled from muscle, ovary and hepatopancreas; the cDNA template for the RXR reactions was constructed from total RNA from hepatopancreas. For in vitro expression, full-length EcR and RXR sequences were amplified from cDNA and cloned into pENTR-D TOPO (Invitrogen, Carlsbad CA, USA). For EcR amplification, the cDNA template was constructed from poly(A)-enriched RNA pooled from muscle, hepatopancreas and ovary; for RXR amplification, the cDNA template was constructed from pooled total RNA from muscle, hepatopancreas, ovary, gill, heart, brain and branchiostegite. The EcR coding sequence was amplified using two rounds of PCR, beginning 17 residues downstream from the putative translational start and extending through the stop codon (Fig. 1). The first round used a high fidelity polymerase with proofreading function (Iproof polymerase, Bio-Rad) and the following cycling conditions: 98° C for 30 s, 35 cycles of (98 °C for 10 s, 68 °C for 20 s, 72 °C for 105 s), and 72 °C for 7 min; in the second round, 2 ll of a 1:10 dilution of the initial reaction was reamplified in a 50 ll reaction using Amplitaq Gold polymerase (Applied Biosystems, Carlsbad CA, USA; cycling conditions: 94 °C for 10 min, 20 cycles of (94 °C for

2.1. Animals and RNA isolation Male and female adult lobsters were collected from Cape Cod Bay, Massachusetts. Tissues were dissected from freshly caught lobsters, flash-frozen and stored at 80° C. Total RNA was extracted using STAT 60 (Tel-Test Inc., Friendswood TX, USA). Poly(A)-enriched RNA was prepared using the Micro-Poly-A purist kit (Ambion, Austin TX, USA).

2.2. Chemicals [24,25,26,27-3H]Ponasterone A, 163.3 Ci/mM, was obtained from PerkinElmer (Shelton CA, USA). 2,4,5-trichlorobiphenyl (PCB 29) and 2,4,6-trichlorobiphenyl (PCB 30) were obtained from AccuStandard (New Haven CT, USA). Unlabeled ponasterone A and all

Table 1 Primer sequences used for EcR and RXR cloning. Sequences of degenerate primers used in cloning initial fragments and of specific primers used to amplify full coding sequences and clone inserts into pENTR/D-TOPO (Invitrogen). Predicted translation of degenerate primers given parenthetically. Note that the forward specific primers contain a ‘‘CACC’’ tag at the 50 end (underlined). This tag is used for directional cloning and is not part of the receptor sequences. PCR primers

Sequence

dEcR_F dEcR_R HaEcR_F

ACNTGYGARGGNTGYAARGGNTT (TCEGCKGF) CTCWGCATTRTCCACYTTCAT (MKVDNAE)

HaEcR_R dRXR_F dRXR_R HaRXR_F2 HaRXR_R

CACCTCTGGTGTCGCCACACTCAACCTC GACTCACAACCTTCTTCTCGCACTCG TATGGCGTGTACAGCTGYGARGG (YGVYSCE) GCATTTTTGGTAGCGGCARTAYTG (QYCRYQKC) CACCATGTCAGGGTCACTGGATCGC CACTTCTTAACTTGATGGGGAGGTG

348

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

Fig. 1. Amino acid alignment of selected EcR sequences. GenBank accession numbers: Americamysis bahia (formerly Mysidopsis bahia, sequence provided by Dr. Hirofumi Yokata, Chemicals Evaluation and Research Institute, Japan; sequence confirmed in our laboratory), H. americanus (EcRa and EcRb AEA29831, this study), Marsupenaeus japonicus (BAF75375), Celuca pugilator (Uca pugilator, O76246), Drosophila melanogaster (A41055, sequence truncated at the carboxy terminal to facilitate alignment). The DNA-binding domain is encased in brackets, the start of the ligand-binding domain is indicated with an arrow and the letters ‘‘LBD’’, and the AF-2 ligand-dependent activation function is boxed. The two lobster sequences differ from one another by 14 residues within the ligand-binding domain, which are indicated by asterisks (spread between residues 461 and 502, as numbered on alignment). For functional characterization, the lobster EcR proteins were expressed in vitro beginning 19 residues downstream from the putative start site (indicated with an arrow and the notation ‘‘expression clone start’’, see Section 2.3 for additional detail).

15 s, 66 °C for 30 s, 70 °C for 90 s), and 72 °C for 7 min). The fulllength RXR was amplified using a high fidelity polymerase (ultra

pfu, Stratagene, La Jolla CA, USA) with primers HaRXR_F2 and HaRXR_R under the following conditions: 95° C for 2 min, 35 cycles of

349

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

(95 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min), and 72 °C for 10 min. During initial PCR and RACE reactions, two apparent splice variants were identified for the EcR and for the RXR. PCR was conducted using variant-specific primers to screen for full-length clones likely to correspond to each form. Full-length EcR and RXR clones were fully sequenced. To check for PCR errors, both EcR and RXR sequences were compared against sequences derived from multiple independent PCR and RACE reactions. EcR and RXR inserts were then recombined into an amino-terminal tagged expression vector (pcDNA3.1/nV5-DEST, Invitrogen) using the Gateway LR-Clonase II enzyme mix (Invitrogen). Lobster EcR and RXR sequences were aligned with homologs from other arthropods using ClustalW, as implemented in BioEdit [18]. 2.4. In vitro expression of HaEcR and HaRXR proteins EcR and RXR proteins were expressed using the TNT T7 Quick Coupled Reticulocyte Lysate System (Promega, Madison WI, USA) according to the manufacturer’s protocol. To confirm expression, proteins were synthesized in the presence of fluorescently labeled lysine (FluoroTect™ GreenLys in vitro Translation Labeling System, Promega). Fluorescently labeled proteins were separated on an 8% SDS–PAGE gel and visualized using a Typhoon 8600 imager (Molecular Dynamics, Sunnyvale, CA). 2.5. Ligand-binding assay EcR and RXR proteins were expressed in vitro in 50 ll reactions. Equal volumes of the two reactions were combined, and the expressed proteins were diluted 1:10 with TEG Buffer (10 mM Tris, 1.5 mM EDTA, 10% v/v sterile glycerol, 1 mM DTT) containing a mixture of protease inhibitors (100 KIU/ml aprotinin, 7 lg /ml pepstatin A, 5 lg/ml leupeptin and 1 mM 4-[2-aminoethyl] benzenesulfonylfluoride hydrochloride). To compare the binding properties of the two EcR variants and their interactions with RXR, diluted proteins (75 ll of EcR, RXR, or a mixture of both) were incubated with 5 nM 3H ponasterone A in borosilicate glass tubes overnight at 4 °C. Proteins were incubated with and without a 10,000-fold excess of unlabeled ponasterone A to assess non-specific and total binding, respectively. Unprogrammed lysate (‘‘UPL,’’ an in vitro translation reaction prepared with an empty expression vector rather than a receptor) was added to reactions containing only a single receptor so the lysate protein concentration would be comparable with reactions containing both EcR and RXR. Total 3H ponasterone A activity was measured in 10 ll of the reaction. At the end of the incubation, 30 ll was transferred from each tube to 1.5 ml polypropylene microcentrifuge tubes containing 30 ll of 50 mg/ml dextran-coated charcoal in TE Buffer. Tubes were vortexed three times, for 5 s at a time, with 5 min incubation on ice between vortexing. The tubes were centrifuged for 1 min at 14,000g to pellet the charcoal. Activity was quantified in 40 ll of the supernatant in 4 ml ScintiVerse II cocktail (Fisher Scientific, Pittsburgh PA, USA) using a Beckman 5000 liquid scintillation counter. In saturation binding experiments, EcR and RXR proteins were incubated with tritiated ponasterone A (seven concentrations in duplicate, nominally 0.1, 0.5, 1, 2, 4, 8, and 10 nM, actual concentrations measured in assay). The number of replicate assays for each EcR or EcR–RXR heterodimer is given in table 2. In these studies, non-specific binding was directly measured as the binding of tritiated ponasterone A to UPL (as in [25]). Specific binding was calculated by subtracting non-specific binding from total binding. Other assay details were as described above. The equilibrium dissociation constant (Kd) and maximum binding capacity (Bmax) were

Table 2 Equilibrium dissociation constants (Kd) and maximum binding capacity (Bmax) for in vitro-expressed HaEcRs, individually and co-expressed with HaRXR(+5). For HaEcRa, Kd and Bmax values are expressed as the mean ± the standard error of the nonlinear curve fit from a single assay (details in Section 2). For the other receptors, Kd and Bmax are expressed as the mean and standard deviation of parameters estimated from two or more independent assays. Protein

Number of assays

Kd (nM)

Bmax (nM)

HaEcRa HaEcRa + HaRXR(+5) HaEcRb HaEcRb + HaRXR(+5)

1 2 4 2

6.7 ± 2.16 5.2 ± 2.3 13.3 ± 9.5 2.5 ± 1.2

0.075 ± 0.014 1.3 ± 0.59 0.92 ± 0.47 1.36 ± 0.65

estimated through non-linear regression using Graphpad Prism version 5 (Graphpad Software, La Jolla CA, USA). To assess the relative affinity of potential ligands for the EcR– RXR complex, proteins were incubated with tritiated ponasterone A (5 nM) and varying concentrations of competitor ligands. Competitor ligands (seven concentrations in duplicate, 1 nM, 10 nM, 100 nM, 1 lM, 10 lM, 100 lM, 1 mM) were diluted in ethanol, added to glass tubes in 75 ll aliquots, and dried under a gentle stream of nitrogen prior to the addition of lysate. Unlabeled ponasterone A was included in each assay as a control. Relative binding affinities (RBAs) were estimated for competitor ligands that were able to displace at least 50% of the tritiated ponasterone A. For these compounds, Kd and IC50 (concentration of competitor that inhibits binding of tritiated ponasterone A by 50%) were estimated from the fitted curve (one-site binding equation, Prism). The RBA was calculated as the ratio of the IC50 of the competitor ligand to the IC50 of ponasterone A, multiplied by 100. 3. Results 3.1. Cloning of lobster EcR and RXR Using RT-PCR and 50 /30 RACE, we isolated sequences for two forms of EcR (HQ335007, Fig. 1) and two forms of RXR (HQ335008, Fig. 2). The full coding region of each RXR variant was amplified, cloned and sequenced. EcR variants were amplified beginning 57 bp downstream from the predicted translational start (Fig. 1). Despite repeated efforts, we were unable to identify the HaEcR start codon. The sequence derived from our longest 50 -RACE product aligns with the second amino acid residue of the U. pugilator EcR. The sequenced HaEcR open reading frame is 1623 bp in length and corresponds to predicted proteins with a length of 541 amino acids and weight of 60.1 KDa. We also amplified a 658-bp partial 30 UTR sequence, which did not contain a polyadenylation signal. For comparison, the complete 30 -UTR from U. pugilator is 2758-bp in length (Accession number AF034086). The two ecdysone receptor variants (HaEcRa and HaEcRb) differed by 14 residues over a 40-residue region of the LBD. The variable residues occurred between the end of helix 2 and the middle of helix 4. The open reading frame of the shorter RXR variant, HaRXR (5) was 1215 bp in length and corresponds to a predicted protein with 405 amino acid residues (44.5 kDa). The longer variant, HaRXR (+5) had a five residue insertion within the T-box of the hinge domain and corresponds to a predicted protein with 410 amino acid residues (44.9 kDa). These variants are structurally similar to RXR variants described in U. pugilator (UpRXR (+5, 33) and UpRXR (5, 33)) [14] and G. lateralis (GlRXR(+7) and GlRXR(+12)) [30]. The lobster RXR variants were numbered similarly to the U. pugilator variants. 3.2. In vitro translation of HaEcR and HaRXR variants The two HaEcR variants and two HaRXR variants were cloned into pcDNA3.1/nV5-DEST, an expression plasmid that produces

350

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

Fig. 2. Amino acid alignment of selected Retinoid X Receptor (RXR) and ultraspiracle (USP) sequences. GenBank accession numbers: H. americanus (AEA29832, this study), Uca pugilator (Celuca pugilator, AAC32789), Gecarcinus lateralis (DQ067280), Carcinus maenas (ACG63788), Marsupenaeus japonicus (Penaeus japonicus, BAF75376), Daphnia magna (BAF49028), Drosophila melanogaster (P20153). The DNA-binding domain is encased in brackets, the start of the ligand-binding domain is indicated with an arrow, and the AF-2 ligand-dependent activation function is boxed. A five amino acid region in the hinge domain that is present in some H. americanus and U. pugilator variants is indicated by asterisks (+5 variant shown for H. americanus,+12 variant for G. lateralis and +5 variant for U. pugilator, see also [14,30]).

proteins with a V5 epitope tag at the amino terminus. Thus, the predicted sizes of the in vitro translated proteins were 63.3 kDa (HaEcRa and HaEcRb), 49.4 kDa (HaRXR(5)), and 49.9 kDa (HaRXR(+5)). Polyacrylamide gel electrophoresis of fluorescently

labeled proteins revealed that the molecular weight of the tagged proteins was consistent with the calculated values (Fig. 3). In each case, two bands were visible, which most likely represent the use of internal initiation sites. In this in vitro system, the two RXR

351

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

A

76 kDa 52 kDa 38 kDa

B

52 kDa 38 kDa

Fig. 3. In vitro transcription and translation of unprogrammed lysate (UPL) and lobster EcR and RXR cDNAs. Receptors were cloned into pcDNA3.1/nV5-DEST and expressed using the T7-Quick Coupled Reticulocyte Lysate System. Proteins were synthesized in the presence of fluorescently-labeled lysine, separated via SDS– PAGE, and visualized using a Typhoon imager. In each case, two bands were produced, likely as a result of internal initiation, as has been observed with other nuclear receptors (Tarrant unpublished data) and transcription factors (e.g., [27]). (A) HaEcRa and HaEcRb were both expressed with bands of the predicted size (63.3 kDa, section 3.2), although HaEcRb consistently produced a stronger band. (B) The larger bands produced by HaRXR (+5 and 5) were of the predicted size (49.4– 49.9 kDa) and of similar intensity.

variants were expressed at similar levels; however, HaEcRb was consistently expressed more strongly than HaEcRa. 3.3. Specific binding of [3H]ponasterone A to the in vitro expressed HaEcR and HaRXR variants We measured binding of tritiated ponasterone A to in vitro translated lobster EcR and RXR proteins, both individually and in

3.4. Competitive binding assays Based on the higher expression of HaEcRb (Fig. 3) and the enhanced ponasterone A binding in the presence of HaRXR (Fig 4a), competitive binding assays were conducted using HaEcRb coexpressed with HaRXR(+5). Mean IC50 and RBA values of 10 test compounds are summarized in Table 3, and representative competitive binding curves are shown in Fig. 6. Ponasterone A and muristerone were the strongest ligands tested and bound HaEcRb–RXR with similar affinity. Tebufenozide and 20-hydroxyecdysone were moderately strong ligands (RBA 5%). Bisphenol A and a-ecdysone were moderately weak ligands, able to fully outcompete ponasterone A, but only at high concentrations. Fenoxycarb and methoprene were both weak ligands, able to partially outcompete

B

10000

[3H] PonA binding (dpm)

[3H] PonA binding (dpm)

A

combination. As shown in Fig. 4a, HaRXR by itself did not specifically bind ponasterone A (total binding was not greater than non-specific binding). However, both HaEcR variants specifically bound ponasterone A (total binding was greater than non-specific binding, p < 0.01 for both EcR variants, t-test) and exhibited enhanced ponsterone A binding in the presence of HaRXR (as a presumed heterodimer). Co-incubation with HaRXR increased specific binding by HaEcRa 9-fold (specific binding for HaEcRa and HaEcRa–RXR was 456 dpm and 4151 dpm, respectively) and specific binding by HaEcRb 3-fold (specific binding for HaEcRb and HaEcRb–RXR was 2259 dpm and 6919 dpm, respectively). The two RXR variants showed a similar capacity to enhance binding (Fig. 4b). HaEcRb consistently bound more ligand than HaEcRa, both by itself and when co-expressed with HaRXR; this is likely influenced by the relative expression of the EcR constructs. Next, we conducted saturation binding experiments with the EcR variants. A representative set of experiments is shown in Fig. 5, and data from all experiments are summarized in Table 2. The Kd calculated for the HaEcRb homodimer was 13.3 nM, similar to the value for HaEcRa (6.7 nM). While the dissociation constants were similar, HaEcRa had a much lower Bmax (Table 2). The apparently reduced binding capacity of HaEcRa may be at least partially attributed to reduced HaEcRa expression in vitro (Fig. 3). Both EcR variants exhibited increased ligand affinity (lower Kd) when co-incubated with RXR (5.2 nM for EcRa–RXR and 2.5 nM for EcRb–RXR, Fig. 5 and Table 2).

8000 6000 4000 2000 0

T EcRa EcRb UPL RXR(+5)

N --+ +

T + -+ --

N

T

N + --+

T

N T -+ + --

10000

5000

0

N -+ -+

T EcRb RXR(+5) RXR(-5)

N + + --

T

N + -+

Fig. 4. Binding of tritiated ponasterone A to in vitro-translated HaEcRs and HaRXR. Expressed proteins were incubated in the absence (total binding, T, solid bars) or presence (non-specific binding, N, open bars) of excess unlabeled ponasterone A. Unprogrammed lysate (UPL, reaction incubated with empty vector only) was used to achieve a constant amount of total protein in all reactions. Error bars represent the standard error. (A) Both forms of EcR specifically bound ponasterone A (total binding was greater than non-specific binding), and specific binding was enhanced in the presence of RXR. HaEcRb consistently bound more ponasterone A than HaEcRa, which may be due to stronger expression of HaEcRb in vitro (Fig. 3). (B) Both HaRXR variants enhanced binding to a similar degree.

352

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

Fig. 5. Representative saturation binding curves for binding of tritiated ponasterone A to in vitro-translated HaEcRs in the absence and presence of HaRXR(+5). Seven concentrations of [3H]ponasterone A were incubated with diluted in vitro-translated proteins, as described in Section 2.5. Non-specific binding, indicated by open circles, was determined using an empty pcDNA3.1 vector (‘‘unprogrammed lysate,’’ UPL). Filled symbols indicate specific binding, as calculated by subtracting the calculated non-specific binding from the total binding for each tube. Non-linear curves were fitted using Prism 5 software, as described in Section 2.5. R2 values for curves depicted were: 0.996 (UPL), 0.937 (HaEcRb), 0.997 (HaEcRa + HaRXR), 0.965 (HaEcRb + HaRXR). Mean curve fit parameters for all experiments summarized in Table 2.

ponasterone A at high concentrations. No significant binding by diethyl phthalate, PCB 29 or PCB 30 was detected. 4. Discussion In this study, we cloned and expressed two EcR splice variants and two RXR splice variants from the American lobster, H. americanus. These variants were identified fortuitously during cloning efforts; it is plausible that additional variants would be identified following a thorough search of diverse tissue types and developmental stages. We also determined the affinity of a suite of potential ligands for the EcR variants when co-expressed with RXR. The results add to a growing picture of diversity in ecdysteroid signaling among arthropods and complexity due to the presence of distinct variants. These studies also provide a molecular foundation for assessing potential effects of pesticides and other environmental chemicals on an economically important non-target species, the American lobster. The two EcR variants identified here differed in the anterior portion (helices 2–4) of the ligand binding domain (LBD). Variants with substitutions at the same position have been recently identified in the kuruma prawn M. japonicus [2] and in the fiddler crab

Table 3 Summary of potential EcR ligands tested through competitive binding assays. The test compound concentration that reduced binding of labeled ponasterone A by 50% (IC50) and the binding affinity relative to unlabeled ponasterone A (RBA) were calculated from fitted curves. Values represent the mean (± standard error) from at least three independent experiments, except for the two PCB compounds which were only tested in two assays. ‘‘Weak’’ indicates a compound that was able to displace 20–50% of the labeled ponasterone A at the highest concentration tested (1 mM). ‘‘NB’’ indicates a compound that was unable to displace more than 20% of the labeled ponasterone A at the highest concentration tested. Compound

IC50 (M)

RBA (%)

Muristerone Tebufenozide 20-Hydroxyecdysone a-Ecdysone Bisphenol A Methoprene Fenoxycarb Diethyl phthalate PCB 29 (n = 2) PCB 30 (n = 2)

1.5 (±0.14)  108 5.9 (±0.4)  107 3.3 (±1.2)  107 3.3 (±0.5)  106 1.6 (±1.4)  104 Weak Weak NB NB NB

87 (±8.3) 4.4 (±1.7) 5.2 (±1.0) 0.30 (±0.043) 0.067 (±0.0019) N/A N/A N/A N/A N/A

U. pugilator (Durica, personal communication). More broadly, it has now become apparent that alternative splicing of EcR is widespread in crustaceans and can occur within the A/B, hinge or ligand-binding domains (Table 4). In contrast, most of the EcR isoforms characterized in insects have been localized within the A/B domain [15,37,62], although hinge domain variants have also been described [15]. The EcR A/B domain variants characterized in cladocerans and insects have been shown to vary in expression and/ or transcriptional activity [28,35,51], but to our knowledge crustacean LBD variants of EcR have not yet been characterized. In our study, both EcR variants specifically bound ponasterone A and binding was greatly enhanced in the presence of HaRXR. The dissociation constants measured for the lobster EcR variants were similar to one another (6.7 nM for HaEcRa and 13.3 nM for HaEcRb) and comparable to dissociation constants reported for EcRs from other arthropods, such as fiddler crab (U. pugilator,1.1 nM cellular extracts, 5.3 nM proteins expressed in vitro, [22]) Colorado potato beetle (Leptinotarsa decemlineata, 73 nM, [40]), rice stem borer (Chilo suppressalis, 55 nM, [34]), and Japanese scorpion (L. australasiae, 4.2 nM, [38]). Additional studies are needed to distinguish the expression patterns and functional roles of these crustacean EcR variants. The lobster RXR variants differed by a five residue insertion/ deletion in the hinge domain. Similar hinge domain variants have been identified in several other crustaceans, and additional LBD variants have been identified in the crabs U. pugilator and G. lateralis ([30,63], Table 4). In G. lateralis, expression of nine RXR variants differed greatly among tissues [30]. In U. pugilator, only RXR variants containing a 33-residue insertion in the LBD formed dimers with the EcR, bound to ecdysteroid-responsive DNA elements, and stimulated ecdysone-mediated transcription [63]. The lobster RXR variants identified here lack the 33-residue insertion, but were still able to enhance specific binding of ponasterone A. Further study is needed to determine whether additional lobster RXR variants exist and to evaluate their properties. While co-expression of RXR has been shown previously to enhance ecdysteroid binding to insect EcRs [34,40], to our knowledge, this is the first direct measurement of such an enhancement in a crustacean. In competitive binding assays, muristerone and ponasterone A were the strongest ligands, followed by tebufenozide, 20-hydroxyecdysone and a-ecdysone. Similarly, the D. magna EcR/RXR was strongly activated by ponasterone A and muristerone, and moderately activated by ecdysone and tebufenozide [28]. The brown

353

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

A

B

Percent bound

80 60 40 20

Percent bound

120

Ponasterone A Muristerone

100

Ponasterone A Tebufenozide

100

20-Hydroxyecdysone alpha-Ecdysone

80 60 40 20 0

0 -9

-7

-5

-9 -7 -5 Log concentration competitor (M)

-3

Log concentration competitor (M)

C

Ponasterone A Bisphenol A

100

D

80 60 40 20

Ponasterone A Methoprene Fenoxycarb

100

Percent bound

Percent bound

120

-3

80 60 40 20

0

0 -9

-7

-5

-3

Log concentration competitor (M)

-9

-7

-5

-3

Log concentration competitor (M)

Fig. 6. Representative competitive binding curves for potential lobster EcR ligands. X-axis indicates log molar concentration of competitor, ranging from 109 to 103 M (i.e., 9 to 3). Y-axis indicates percentage of radiolabeled ponasterone A bound, relative to the binding observed in the absence of a competitor. (A) Muristerone binding was comparable to binding by ponasterone A; (B) tebufenozide, 20-hydroxyecdysone and a-ecdysone were moderately strong ligands; (C) bisphenol A effectively outcompeted ponasterone A at high concentrations; (D) methoprene and fenoxycarb exhibited weak binding at high concentrations.

Table 4 Summary of crustacean EcR and RXR variants reported from the literature. A plus sign (+) indicates an insertion of a number of amino acids that may be present or absent. ‘‘’’ indicates a number of amino acids that are found in EcR sequences from other taxa, but are missing from a variant within the designated species. ‘‘Subst’’ indicates a variant in which a string of amino acids may be substituted by a distinct sequence of equivalent length. Variants may occur in combination; for example, four RXR variants have been identified in U. pugilator, through combinations of +/5 and +/33 forms [14]. The +7 and +12 RXR hinge domain variants identified in G. lateralis correspond to the 5 and +5 hinge domain variants indentified in U. pugilator and H. americanus. The +8 RXR hinge domain variant from G. lateralis represents a more divergent sequence spanning the same region [30]. Species

Variant description

Characterization

Citation

EcR Variants H. americanus M. japonicus U. pugilator

Anterior LBD Subst. Anterior LBD Subst. Hinge 25 A/B 31 Anterior LBD Subst. Three hinge variants

Both bound ponasterone A, Distinct Bmax in vitro

A/B domain 124 (insect EcRa-like) Distinct 50 UTR and A/B domain (insect EcRb-like)

EcRb isoform more dynamic during molt cycle.

Present study [2] (Durica, unpublished) [10] [28]

Hinge (T-box) +5 Hinge (T-box) +7,+8, +12 LBD +33 LBD 35 (distinct site) LBD Cterminal truncated Hinge (T-box) +5 LBD +33 Hinge (T-box) +5

Both facilitated ponaster-one A binding to EcR Tissue-specific expression, e.g. only Hinge +12 variant in thoracic muscle. Only +33 forms formed dimers with EcR

D. magna RXR Variants H. americanus G. lateralis (9 variants) U. pugilator M. japonicus

shrimp EcR/RXR was activated by both 20-hydroxyecdysone and ponasterone A, although dose–response relationships were not reported [56]. Tebufenozide, a diacylhydrazine insecticide, is a more potent ligand of the EcR/USP in lepidopterans than in dipterans or coleopterans, resulting in its selective use for lepidopteran control [37]. The lobster EcR/RXR shows intermediate sensitivity to tebufenozide, with an RBA lower than that of muristerone or ponasterone A but slightly higher than 20-hydroxyecdysone. This result indicates that lobsters and other crustaceans may be vulnerable to non-target toxicity following exposure to tebufenozide. Bisphenol A displaced ponasterone A, but only at high concentrations (lM–mM, Fig 6c). Bisphenol A is an alkylphenol that is used in resins and polycarbonate plastics; alkylphenols have been

Present study [30] [63] [2]

widely detected in human tissues, wildlife and the aquatic environment [6,11,52]. Bisphenol A has been shown previously to bind and activate several nuclear receptors, including estrogen receptors, estrogen-related receptors and thyroid receptors [20,50,65]. Similar to our results, relatively high concentrations of bisphenol A were previously shown to antagonize ecdysteroid signaling in an ecdysteroid-responsive insect cell line [13]. While bisphenol A is not a strong ligand for the lobster EcR, it may disrupt ecdysteroid signaling through other mechanisms. For instance, recent studies have indicated that exposure to bisphenol A can repress EcR expression in copepods [24], and can mimic or potentiate juvenoid hormones in cladocerans and polychetes [4,36,59].

354

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355

Fenoxycarb and methoprene, two juvenile hormone analog pesticides, were only able to weakly antagonize ponasterone A binding. In European lobsters, fenoxycarb has been shown to reduce molt frequency and size at molt [1]. In other crustaceans, fenoxycarb has been shown to reduce hatching success, growth and lipid storage and to alter sex ratios [32,33,39]. Similarly, methoprene has been shown to impair limb regeneration and growth, reduce hatching success and survival, and alter molt frequency and sex ratios in crustaceans [16,41,42,47,48,58]. Because fenoxycarb and methoprene did not bind the lobster EcR, previously reported effects of these compounds on crustaceans are likely to occur through disruption of juvenoid signaling rather than through direct interactions with the EcR. Diethyl phthalate, PCB 29, and PCB 30 did not affect ponasterone A binding to the lobster EcR. Exposure to the plasticizer diethyl phthalate or to PCB 29 results in delayed molting in cladocerans and crabs, and it had been hypothesized that these effects occur through disruption of ecdysteroid signaling [66,67]. PCB 30 and its hydroxylated metabolites can non-competitively inhibit activation of the D. melanogaster EcR in a cell-based assay [26]. Because these compounds do not bind directly to the lobster EcR, the mechanism through which they disrupt crustacean ecdysteroid signaling remains unclear. In summary, this paper reports the sequence of the EcR and RXR from the American lobster, and demonstrates that two EcR splice variants are able to bind ponasterone A and that binding is enhanced by coexpression of RXR. Through competitive binding assays, we show that crustaceans are vulnerable to endocrine disruption from diacylhydrazine (tebufenozide) exposure. Effects of bisphenol A, methoprene, fenoxycarb, diethyl phthalate and PCBs on crustacean molting are likely to be mediated through juvenoid-like activity or indirect effects. Acknowledgments Mr. David Casoni of the Massachusetts Lobstermen’s Association provided lobsters used in this study. This publication is the result of research sponsored by The MIT Sea Grant College Program, under NOAA prime award number NA060AR4170019, subaward number 5710002174, project number 2006-R/RC-106. The funding source had no involvement in the study design; data collection, analysis, or interpretation; or the decision to publish this manuscript. References [1] K.E. Arnold, C. Wells, J.I. Spicer, Effect of an insect juvenile hormone analogue Fenoxycarb on development and oxygen uptake by larval lobsters Homarus gammarus (L.), Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149 (2009) 393– 396. [2] H. Asazuma, S. Nagata, M. Kono, H. Nagasawa, Molecular cloning and expression analysis of ecdysone receptor and retinoid X receptor from the kuruma prawn, Marsupenaeus japonicus, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 148 (2007) 139–150. [3] M. Bender, F.B. Imam, W.S. Talbot, B. Ganetzky, D.S. Hogness, Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms, Cell 91 (1997) 777–788. [4] W.J. Biggers, H. Laufer, Identification of juvenile hormone-active alkylphenols in the lobster Homarus americanus and in marine sediments, Biological Bulletin 206 (2004) 13–24. [5] M.R. Brown, D.H. Sieglaff, H.H. Rees, Gonadal ecdysteroidogenesis in arthropoda: occurrence and regulation, Annu. Rev. Entomol. 54 (2009) 105– 125. [6] A. Calafat, Z. Kuklenyik, J. Reidy, S. Caudill, J. Ekong, J. Needham, Urinary concentration of bisphenol A and 4-nonylphenol in a human reference population, Environ. Health Perspect. 113 (2005) 391–395. [7] E.S. Chang, Endocrine regulation of molting in Crustacea, Rev. Aquat. Sci. 1 (1989) 131–157. [8] L. Cherbas, X. Hu, I. Zihimulev, E. Belyaeva, P. Cherbas, EcR isofoms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue, Development 130 (2003) 271–284.

[9] A.C.-K. Chung, D. Durica, P. Hopkins, Tissue-specific patterns and steady-state concentrations of ecdysteroid receptor and retinoid-X-receptor mRNA during the molt cycle of the fiddler crab, Uca pugilator, Gen. Comp. Endocrinol. 109 (1998) 375–389. [10] A.C.-K. Chung, D.S. Durica, S.W. Clifton, B.A. Roe, P.M. Hopkins, Cloning of crustacean ecdysteroid receptor and retinoid-X receptor gene homologs and elevation of retinoid-X receptor mRNA by retinoic acid, Mol. Cell Endocrinol. 139 (1998) 209–227. [11] A. David, H. Fenet, E. Gomez, Alkylphenols in marine environments: Distribution monitoring strategies and detection considerations, Mar. Pollut. Bull. 58 (2009) 953–960. [12] T.S. Dhadialla, G.R. Carlson, D.P. Le, New insecticides with ecdysteroidal and juvenile hormone activity, Annu. Rev. Entomol. 43 (1998) 545–569. [13] L. Dinan, P. Bourne, P. Whiting, T.S. Dhadialla, T.H. Hutchinson, Screening of environmental contaminants for ecdysteroid agonist and antagonist activity using the Drosophila melanogaster B(II) cell in vitro assay, Environ. Toxicol. Chem. 20 (2001) 2038–2046. [14] D. Durica, X. Wu, G. Anilkumar, P.M. Hopkins, A.C.-K. Chung, Characterization of crab EcR and RXR homologs and expression during limb regeneration and oocyte maturation, Mol. Cell Endocrinol. 189 (2002) 59–76. [15] H. Fujiwara, M. Jindra, R. Newitt, S.R. Palli, K. Hiruma, L.M. Riddiford, Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings, Insect Biochem. Mol. Biol. 25 (1995) 845–856. [16] A. Ghekiere, N. Fockedey, T. Verslycke, M. Vincx, C.R. Janssen, Marsupial development in the mysid Neomysis integer (Crustacea: Mysidacea) to evaluate the effects of endocrine-disrupting chemicals, Ecotoxicol. Environ. Saf. 66 (2007) 9–15. [17] G. Giribet, G.D. Edgecombe, W.C. Wheeler, Arthropod phylogeny based on eight molecular loci and morphology, Nature 413 (2001) 157–161. [18] T.A. Hall, BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symp. Ser. 41 (1999) 95–98. [19] B.H. Hansen, D. Altin, K.M. Hessen, U. Dahl, M. Breitholtz, T. Nordtug, A.J. Olsen, Expression of ecdysteroid and cytochrome P450 enzymes during lipid turnover and reproduction in Calanus finmarchicus (Crustacea: Copepoda), Gen. Comp. Endocrinol. 158 (2008) 115–121. [20] H. Hiroi, O. Tsutsumi, M. Momoeda, Y. Takai, Y. Osuga, Y. Taketani, Differential interactions of bisphenol A and 17beta-estradiol with estrogen receptor alpha (ERalpha) and ERbeta, Endocr. J. 46 (1999) 773–778. [21] P.M. Hopkins, Regeneration of walking legs in the fiddler crab, Uca pugilator, Am. Zool. 33 (1993) 348–356. [22] P.M. Hopkins, D. Durica, T. Washington, RXR isoforms and endogenous retinoids in the fiddler crab, Uca pugilator, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 151 (2008) 602–614. [23] X. Hu, L. Cherbas, P. Cherbas, Transcription activation by the ecdysone receptor (EcR/USP): Identification of activation functions, Mol. Endocrinol. 17 (2003) 716–731. [24] D.-S. Hwang, J.-S. Lee, K.-W. Lee, J.-S. Rhee, J. Han, J. Lee, G. Park, Y.-M. Lee, J.-S. Lee, Cloning and expression of ecdysone receptor (EcR) from the intertidal copepod Tigriopus japonicus, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 151 (2010) 303–312. [25] B.A. Jensen, M.E. Hahn, cDNA cloning and characterization of a high affinity aryl hydrocarbon receptor in a cetacean, the beluga Delphinapterus leucas, Toxicol. Sci. 64 (2001) 41–56. [26] R.P. Jones, C.Y. Ang, L.S. Inouye, Effects of PCB 30 and its hydroxylated metabolites on ecdysteroid-mediated gene expression, Bull Environ. Contam. Toxicol. 69 (2002) 763–770. [27] S.I. Karchner, W.H. Powell, M.E. Hahn, Identification and functional characterization of two highly divergent aryl hydrocarbon receptors (AHR1 and AHR2) in the teleost Fundulus heteroclitus Evidence for a novel subfamily of ligand-binding basic helix-loop-helix Per-ARNT-Sim (bHLH-PAS) factors, J. Biol. Chem. 274 (1999) 33814–33824. [28] Y. Kato, K. Kobayashi, S. Oda, N. Tatarazako, H. Watanabe, T. Iguchi, Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphnia magna, J. Endocrinol. 193 (2007). [29] H.-W. Kim, E. Chang, D. Mykles, Three calpains and ecdysone receptor in the land crab Gecarcinus lateralis: sequences, expression and effects of elevated ecdysteroid induced by eyestalk ablation, J. Exp. Biol. 208 (2005) 3177–3197. [30] H.-W. Kim, S. Lee, D. Mykles, Ecdysteroid-responsive genes, RXR and E75, in the tropical land crab, Gecarcinus lateralis: differential tissue expression of multiple RXR isoforms generated at three alternative splicing sites in the hinge and ligand-binding domains, Mol. Cell Endocrinol. 242 (2005) 80–95. [31] D.J. Mangelsdorf, C. Thummel, M. Beato, P. Herrlich, G. Schutz, K. Umsono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, R.M. Evans, The nuclear receptor superfamily: the second decade, Cell 83 (1995) 835–839. [32] T. Matsumoto, E. Ikuno, S. Itoi, H. Sugita, Chemical sensitivity of the male daphnid, Daphnia magna, induced by exposure to juvenile hormone and its analogs, Chemosphere 72 (2008) 451–456. [33] C.L. McKenny Jr., G.M. Cripe, S.S. Foss, S.R. Tuberty, M. Hoglund, Comparative embryonic and larval developmental responses of estuarine shrimp (Palaemonetes pugio) to the juvenile hormone agonist fenoxycarb, Arch. Environ. Contam. Toxicol. 47 (2004) 463–470. [34] C. Minakuchi, Y. Nakagawa, M. Kamimura, H. Miyagawa, Binding affinity of nonsteroidal ecdysone agonists against the ecdysone receptor complex determines the strength of their molting hormonal activity, Eur. J. Biochem. 270 (2003) 4095–4104.

A.M. Tarrant et al. / General and Comparative Endocrinology 173 (2011) 346–355 [35] J.-F. Mouillet, V.C. Henrich, M. Lezzi, M. Vogtli, Differential control of gene activity by isoforms A, B1 and B2 of the Drosophila ecdysone receptor, Eur. J. Biochem. 268 (2001) 1811–1819. [36] X. Mu, C.V. Rider, G.S. Hwang, H. Hoy, G.A. LeBlanc, Covert signal disruption: anti-ecdysteroidal activity of bisphenol A involves cross talk between signaling pathways, Environ. Toxicol. Chem. 24 (2005) 146–152. [37] Y. Nakagawa, V.C. Henrich, Arthropod nuclear receptors and their role in molting, FEBS J. 276 (2009) 6128–6157. [38] Y. Nakagawa, A. Sakai, F. Magata, T. Ogura, M. Miyashita, H. Miyagawa, Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae, FEBS J. 274 (2007) 6193–6203. [39] S.F. Nates, C.L. McKenny Jr., Growth, lipid class and fatty acid composition in juvenile mud crabs (Rhithropanopeus harrisii) following larval exposure to Fenoxycarb, insect juvenile hormone analog, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 127 (2000) 317–325. [40] T. Ogura, C. Minakuchi, Y. Nakagawa, G. Smagghe, H. Miyagawa, Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata, FEBS J. 272 (2005) 4114–4128. [41] A.W. Olmstead, G.A. LeBlanc, Low exposure concentration effects of methoprene on endocrine-regulated processes in the crustacean Daphnia magna, Toxicol. Sci. 62 (2001) 268–273. [42] J.K. Peterson, D.R. Kashian, S.I. Dodson, Methoprene and 20-OH-ecdysone affect male production in Daphnia pulex, Environ. Toxicol. Chem. 20 (2001) 582–588. [43] R.J. Pruell, B.K. Taplin, D.G. McGovern, R. McKinney, S.B. Norton, Organic contaminant distributions in sediments, polychaetes (Nereis virens) and American lobster (Homarus americanus) from a laboratory food chain experiment, Mar. Environ. Res. 49 (2000) 19–36. [44] J.P. Renaud, D. Moras, Structural studies on nuclear receptors, Cell. Mol. Life Sci. 57 (2000) 1748–1769. [45] L. Riddiford, K. Hiruma, X. Zhou, C. Nelson, Insights into the molecular basis of the hormonal control of molting and metamorphosis from Manduca sexta and Drosophila melanogaster, Insect Biochem. Mol. Biol. 33 (2003) 1327–1338. [46] W.A. Segraves, Steroid receptors and other transcription factors in ecdysone response, Recent Prog. Horm. Res. 49 (1994) 167–195. [47] T.A. Stueckle, J. Likens, C.M. Foran, Limb regeneration and molting processes under chronic methoprene exposure in the mud fiddler crab, Uca pugnax, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147 (2008) 366–377. [48] T.A. Stueckle, B. Shock, C.M. Foran, Multiple stressor effects of methoprene, permthrin and salinity on limb regeneration and molting in the mud fiddler crab, Uca pugnax, Environ. Toxicol. Chem. 28 (2009) 2348–2359. [49] T. Subramoniam, Crustacean ecdysteroids in reproduction and embryogenesis, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 125 (2000) 135–156. [50] S. Takayanagi, T. Tokunaga, X. Liu, H. Okada, A. Matsushima, Y. Shimohigashi, Endocrine disruptor bisphenol A strongly binds to human estrogen-related receptor gamma (ERRgamma) with high constitutive activity, Toxicol. Lett. 167 (2006) 95–105. [51] W.S. Talbot, E.A. Swyryd, D.S. Hogness, Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms, Cell 73 (1993) 1323–1337. [52] E.L. Teuten, J.M. Saquing, D.R.U. Knappe, M.A. Barlaz, S. Jonsson, A. Bjorn, S.J. Rowland, R.C. Thompson, T.S. Galloway, R. Yamashita, D. Ochi, Y. Watanuki, C.

[53]

[54] [55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65] [66] [67]

[68]

355

Moore, P.H. Viet, T.S. Tana, M. Prudente, R. Boonyatumanond, M.P. Zakaria, K. Akkhavong, Y. Ogata, H. Hirai, S. Iwasa, K. Mizukawa, Y. Hagino, A. Imamura, M. Saha, H. Takada, Transport and release of chemicals from plastics to the environment and to wildlife, Phil. Trans. R. Soc. B 364 (2009) 2027–2045. H.E. Thomas, H.G. Stunnenberg, A.F. Stewart, Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle, Nature 362 (1993) 471–475. C.S. Thummel, Flies on steroids–Drosophila metamorphosis and mechanisms of steroid hormone action, Trends Genet. 12 (1996) 306–310. S.H. Tiu, S.M. Chan, S.S. Tobe, The effects of farnesoic acid and 20hydroxyecdysone on vitellogenin gene expression in the lobster, Homarus americanus, and possible roles in the reproductive process, Gen. Comp. Endocrinol. 166 (2010) 337–345. Y. Verhaegen, K. Parmentier, L. Swevers, P. Rouge, T. Soin, W.D. Coen, K. Cooreman, G. Smagghe, The brown shrimp (Crangon crangon L.) ecdysteroid receptor complex: Cloning, structural modeling of the ligand binding domain and functional expresssion in an EcR-deficient Drosophila cell line, Gen. Comp. Endocrinol. 168 (2010) 415–423. R.A. Wahle, M. Gibson, M. Fogarrty, Distinguishing disease impacts from larval supply effects in a lobster fishery collapse, Mar. Ecol. Prog. Ser. 376 (2009) 185–192. A.N. Walker, P. Bush, J. Puritz, T. Wilson, E. Chang, T. Miller, K. Hooloway, M.N. Horst, Bioaccumulation and metabolic effects of the endocrine disruptor methoprene in the lobster, Homarus americanus, Integr. Comp. Biol. 45 (2005) 118–126. H.Y. Wang, A.W. Olmstead, H. Li, G.A. LeBlanc, The screening of chemicals for juvenoid-related endocrine activity using the water flea Daphnia magna, Aquat. Toxicol. 74 (2005) 193–204. S.F. Wang, S. Ayer, W.A. Segraves, D.R. Williams, A.S. Raikhel, Molecular determinants of differential ligand sensitivities of insect ecdysteroid receptors, Mol. Cell Biol. 20 (2000) 3870–3879. Y.H. Wang, G. Wang, G.A. LeBlanc, Cloning and characterization of the retinoid X receptor from a primitive crustacean Daphnia magna, Gen. Comp. Endocrinol. 150 (2007) 309–318. T. Watanabe, H. Tekeuchi, T. Kubo, Structural diversity and evolution of the Nterminal isoform-specific region of ecdysone receptor-A and -B1 isoforms in insects, BMC Evolutionary Biol. 10 (2010) 40. X. Wu, P.M. Hopkins, S.R. Palli, D.S. Durica, Crustacean retinoid-X receptor isoforms: distinctive DNA binding and receptor-receptor interaction with a cognate ecdysteroid receptor, Mol. Cell Endocrinol. 218 (2004) 21–38. T.P. Yao, B.M. Forman, Z. Jiang, L. Cherbas, J.D. Chen, M. McKeown, P. Cherbas, R.M. Evans, Functional ecdysone receptor is the product of EcR and Ultraspiracle genes, Nature 366 (1993) 476–479. R.T. Zoeller, Environmental chemicals impacting the thyroid: targets and consequences, Thyroid 17 (2007) 811–817. E. Zou, M. Fingerman, Effects of estrogenic xenobiotics on molting of the water flea, Daphnia magna, Ecotoxicol. Environ. Saf. 38 (1997) 281–285. E. Zou, M. Fingerman, Effects of exposure to diethyl phthalate, 4-(tert)octylphenol, and 2, 4, 5-trichlorobiphenyl on activity of chitobiase in the epidermis and hepatopancreas of the fiddler crab, Uca pugilator, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 122 (1999) 115–120. J. Zrzavy, P. Stys, The basic body plan of arthropods: Insights from evolutionary morphology and developmental biology, J. Evol. Biol. 10 (1997) 353–367.