Echinococcus multilocularis phosphoglucose isomerase (EmPGI): A glycolytic enzyme involved in metacestode growth and parasite–host cell interactions

International Journal for Parasitology 40 (2010) 1563–1574

Contents lists available at ScienceDirect

International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara

Echinococcus multilocularis phosphoglucose isomerase (EmPGI): A glycolytic enzyme involved in metacestode growth and parasite–host cell interactions q Britta Stadelmann *, Markus Spiliotis, Joachim Müller, Sabrina Scholl, Norbert Müller, Bruno Gottstein, Andrew Hemphill ** Institute of Parasitology, Vetsuisse Faculty, University of Berne, Länggass-Strasse 122, CH-3012 Berne, Switzerland

a r t i c l e

i n f o

Article history: Received 27 April 2010 Received in revised form 25 May 2010 Accepted 26 May 2010

Keywords: Echinococcus multilocularis Metacestode Protein disulphide isomerase Moonlighting protein Proliferation Angiogenesis

a b s t r a c t In Echinococcus multilocularis metacestodes, the surface-associated and highly glycosylated laminated layer, and molecules associated with this structure, is believed to be involved in modulating the host–parasite interface. We report on the molecular and functional characterisation of E. multilocularis phosphoglucose isomerase (EmPGI), which is a component of this laminated layer. The EmPGI amino acid sequence is virtually identical to that of its homologue in Echinococcus granulosus, and shares 64% identity and 86% similarity with human PGI. Mammalian PGI is a multi-functional protein which, besides its glycolytic function, can also act as a cytokine, growth factor and inducer of angiogenesis, and plays a role in tumour growth, development and metastasis formation. Recombinant EmPGI (recEmPGI) is also functionally active as a glycolytic enzyme and was found to be present, besides the laminated layer, in vesicle fluid and in germinal layer cell extracts. EmPGI is released from metacestodes and induces a humoral immune response in experimentally infected mice, and vaccination of mice with recEmPGI renders these mice more resistant towards secondary challenge infection, indicating that EmPGI plays an important role in parasite development and/or in modulating the host–parasite relationship. We show that recEmPGI stimulates the growth of isolated E. multilocularis germinal layer cells in vitro and selectively stimulates the proliferation of bovine adrenal cortex endothelial cells but not of human fibroblasts and rat hepatocytes. Thus, besides its role in glycolysis, EmPGI could also act as a factor that stimulates parasite growth and potentially induces the formation of novel blood vessels around the developing metacestode in vivo. Ó 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction The larval stage (metacestode) of the helminth, Echinococcus multilocularis, grows by asexual proliferation of multivesicular metacestodes, primarily in the liver of its intermediate hosts, which are predominantly mice and other rodents. Humans can become infected accidentally and thereby acquire human alveolar echinococcosis (AE) (Eckert and Deplazes, 2004). Human AE is characterised by tumour-like, infiltrative growth of parasite lesions through the extensive proliferation of metacestodes. These vesicular metacestodes are often surrounded by connective tissue, and parasite growth is associated with the formation of blood vessels around the growing metacestode tissue (Gueret et al., 1998; Walker et al., 2004; Hemphill et al., 2007). Newly formed blood vessels

q Note: Nucleotide and protein sequence information was submitted to GenBank under the Accession No. EU031748. * Corresponding author. Tel.: +41 31 6312384; fax: +41 31 6312477. ** Corresponding author. Tel.: +41 31 6312384; fax: +41 31 6312477. E-mail addresses: [email protected] (B. Stadelmann), hemphill@ ipa.unibe.ch, [email protected] (A. Hemphill).

could be important in terms of providing nutritional factors, but could also serve as mediators of signals that govern the host– parasite relationship and potentially help in metastasis formation. The time span between infection with E. multilocularis eggs and the actual manifestation of the disease AE in humans is usually approximately 10–15 years (Eckert and Deplazes, 2004). Thus, the parasite can reside within the liver of its host and remain clinically unnoticed for an extended period of time. Therefore, the metacestode must have acquired some means of modulating the host immune response, by counteracting adverse reactions of the host and influencing the physiology of the peri-parasitic area to its own advantage. Two distinct fractions of E. multilocularis metacestodes are believed to deliver important key players involved in such processes: (i) the acellular and highly glycosylated laminated layer (LL) which forms an extended glycocalyx on the parasite surface and (ii) the parasite excretory/secretory (E/S) products which are released into the peri-parasitic area (Gottstein and Hemphill, 2008). Both the LL and E/S products are synthesised within the germinal layer (GL), which represents the actual cellular parasite tissue situated adjacent to the proximal surface of the LL. The GL forms microtriches, microvilli-like structures that protrude

0020-7519/$36.00 Ó 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2010.05.009

1564

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

well into the matrix of the LL, thus increasing the resorbing as well as the secretory surface of the parasite (Hemphill et al., 2002, 2007). The LL is a carbohydrate-rich structure that covers the entire metacestode, thereby building up the direct host–parasite interface. The importance of the LL in the survival strategy of the developing E. multilocularis metacestode has been demonstrated earlier (Rausch et al., 1987; Deplazes and Gottstein, 1991; Gottstein and Hemphill, 1997; Gottstein et al., 2002) and a limited number of LL components have been described (Hemphill and Gottstein, 1995; Lawton et al., 1997; Ingold et al., 1998; Walker et al., 2004). E/S products are metabolites that are either released into the metacestode interior, where they are a part of the vesicle fluid (VF), or transported through the LL into the exterior host environment, where they may influence the host’s immune response and/or physiological processes. Thus, further characterisation of these parasite-derived components will lead to a better understanding of the host–parasite relationship during the course of AE. In this study, we have identified and characterised the glycolytic enzyme E. multilocularis phosphoglucose isomerase (EmPGI). In eukaryotes, PGI is an intracellular enzyme responsible for the interconversion of D-glucose-6-phosphate and D-fructose-6-phosphate during glycolysis and gluconeogenesis, thereby recycling D-glucose-6-phosphate for the pentose phosphate pathway. In addition, in mammalian cells, the extracellular form of PGI has been attributed to numerous other functions, including the one described as autocrine motility factor (AMF), which is a cytokine involved in the enhancement of angiogenesis, cell motility, tumour invasion and metastasis formation (Funasaka et al., 2001, 2002, 2005; Yanagawa et al., 2004). Here we show that in E. multilocularis metacestodes, EmPGI functions as an enzyme in glycolytic energy metabolism. However, EmPGI is also released internally into the VF, and externally into the LL, thereby potentially exerting functions related to cellular proliferation within the parasite GL, as well as at the host–parasite interface. 2. Materials and methods Unless otherwise stated, all culture media were purchased from Gibco-BRL (Zürich, Switzerland) and biochemical reagents were from Sigma (St. Louis, MO, USA). 2.1. In vitro culture of E. multilocularis metacestodes Echinococcus multilocularis (isolates KF5 and H95) were cocultured with Reuber rat hepatocytes (Rh) in culture flasks at 37 °C, 5% CO2 as described previously by Spiliotis et al. (2008), with medium changes once per week. Splitting of cultures was carried out when exceeding 15 ml of total vesicle volume. Vesicles were used for experimental procedures when they reached diameters of 4 mm or more. 2.2. Extraction of VF, LL and GL from in vitro-cultured E. multilocularis metacestodes VF extraction from metacestodes was carried out as previously described by Walker et al. (2004). LL was isolated by two distinct techniques. First, the remaining pellet from the VF extraction containing vesicle walls was extracted in 6 M urea in PBS as described earlier and stored at 80 °C (Ingold et al., 2000). For some experiments deglycosylated LL (dLL) was prepared by cleavage of 6 M urea-extracted LL with anhydrous trifluoromethanesulphonic acid (TFMS) employing the GlycoFree™ deglycosylation kit (Oxford Glycosystems Abingdon, UK). Second, LL was isolated by breaking up metacestodes and incubating these in 4 vols. of Trypsin/EDTA

(0.05%, Invitrogen, Carlsbad, Canada) for 10 min at 37 °C with extensive vortexing. After centrifugation (4000g, 10 min, 4 °C), the vesicles were washed twice in PBS, incubated in 4 mM EDTA in PBS (3 h, 20 °C) and centrifuged (16,100g, 10 min, 4 °C). Finally, the pellet was extracted in 1% Triton X-100 (Fluka Chemie, Buchs, Switzerland) in PBS, containing 1 mM phenyl-methyl-sulphonylfluoride (PMSF), for 5 min at 4 °C, and the Triton-soluble and -insoluble fractions were stored separately at 80 °C. Isolation of GL cells and preparation of GL cell protein extract were performed according to Spiliotis et al. (2008). GL cells were used immediately for proliferation assays as described below or were centrifuged and extracted in 1% Triton X-100 (Merck, Darmstadt, Germany) in PBS containing 1 mM PMSF. The GL protein extract was stored at 20 °C until further use. 2.3. Generation and affinity purification of antisera directed against metacestode fractions in rabbits, immunoblots and deglycosylation of nitrocellulose-bound proteins Polyclonal rabbit antisera were generated against three distinct E. multilocularis fractions: (i) entire crushed vesicle suspension (anti-KF5), (ii) LL isolated by 6 M urea extraction (anti-LL), and (iii) dLL (anti-dLL). Prior to immunisation, pre-immune sera were tested by Western blot and immunofluorescence. Animals were immunised as described in Ingold et al. (1998). Sera were aliquoted and stored at 80 °C. VF-fractions, EDTA/Triton-isolated LL and 6 M urea-extracted LL were processed for SDS–PAGE by methanol– chloroform precipitation as described by Wessel and Flügge (1984). The precipitated samples were taken up in 4 concentrated SDS sample buffer and separated by SDS–PAGE according to Laemmli (1970). Western blotting was done according to Towbin et al. (1979), with 3% milk in TBST (0.1 M Tris–HCl, 0.15 M NaCl, 0.3% Tween 20, pH 7.6) as a blocking solution. Antibodies were diluted in 0.3% milk in TBST. Unless otherwise stated, all antibodies were used at a 1:1000 dilution. The secondary anti-rabbit-alkaline phosphatase-conjugated antibody (anti-rabbit IgG (Fc) AP) was obtained from Promega (Madison, WI, USA). Chemical deglycosylation of proteins on Western blots was carried out by sodium acetate treatment (Ingold et al., 1998, 2000). Control blots were incubated in 50 mM sodium acetate buffer only. For affinity purification of antibodies on bands obtained after Western blotting, an established protocol (Hemphill and Gottstein, 1996) was used. Affinity-purified antibodies were aliquoted and stored at 20 °C. 2.4. LR-White embedding of metacestodes and on-section immunofluorescence In vitro-cultured metacestodes were fixed in 3% paraformaldehyde (Merck) in 100 mM sodium phosphate buffer (pH 7.2), dehydrated in a graded series of ethanol and embedded in LRWhite resin as described earlier (Hemphill and Gottstein, 1995). Sections (1–2 lm in thickness) were cut on a Reichert and Jung ultramicrotome and placed onto poly-L-lysine-coated glass slides. Immunofluorescence-labelling employing either metacestode antisera (1:1000) or affinity-purified antibodies (undiluted) was carried out as described earlier (Walker et al., 2004). Prior to antibody labelling, some sections were treated on-slide with 40 mM sodium periodate in sodium acetate buffer, pH 4.5 for 1 h at 20 °C in the dark. 2.5. Separation and identification of VF protein For separation of VF proteins, diethylaminoethyl (DEAE) anionexchange chromatography was performed using a chromatography column filled with 0.5 ml DEAE Sephacel anion exchanger. The

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

1565

matrix was equilibrated in 100 mM Tris–HCl (pH 8.0), loaded with 1 ml VF and washed with 0.02 M NaCl in 100 mM Tris–HCl (pH 8.0). The column was eluted by stepwise increasing salt concentrations (0.05 M up to 1.0 M NaCl in 100 mM Tris–HCl, pH 8.0), and the material was collected in 500 ll aliquots. Eluted fractions were further separated by SDS–PAGE, stained with colloidal Coomassie-blue (Niinaka et al., 2002), and bands of interest were cut out and identified by peptide fragmentation sequencing (LCI-ESI-MS/MS) and a Mascot database search (http://www. matrixscience.com/search_form_select.html) through a commercial service provided by the Core Facility Proteomics, Centre Médical Universitaire, Université de Genève, Switzerland.

ampicillin (0.2 mg/ml) and grown at 37 °C, until A600nm was 0.5. Subsequently, the cultures were rapidly cooled on ice and further maintained at 17 °C in order to avoid protein solubility problems. Expression was induced by the addition of 0.5 mM isopropyl b-D-1-thiogalactopyranoside (IPTG) and after 20 h bacteria were harvested by centrifugation (4000g, 20 min, 4 °C) and stored at 20 °C. His-tagged recombinant protein was purified by affinity chromatography on a Talon Metal column (Clontech Laboratories, Palo Alto, CA, USA), as previously described (Müller et al., 2008). Elutions were measured by NanoDropÒ ND-100 spectrometer, and were concentrated according to Wessel and Flügge (1984) and separated by SDS–PAGE to check for proper protein purification.

2.6. RNA isolation from in vitro-cultured E. multilocularis metacestodes, cDNA synthesis, rapid amplification of cDNA ends (RACE) PCR and cDNA sequencing

2.8. Preparation of anti-recEmPGI antiserum in rat

In vitro-generated vesicles were disrupted by 600 ll RLT lysis buffer (Qiagen, Hilden, Germany). Subsequently, lysates were loaded on a QIAshredder™ column (Qiagen) and centrifuged (16,100g, 2 min, 20 °C). Further RNA isolation and DNase treatment were performed according to the standard protocol of the RNeasy™ Mini Kit (Qiagen). RNA was eluted in 30 ll RNase-free water and stored at 80 °C. Synthesis of cDNA was performed using the Omniscript™ RT kit (Qiagen), and OligodT primers (Promega) were used according to the manufacturer’s instructions. RACE PCR was performed by using the 50 /30 RACE PCR kit as described by Sonda et al. (2000) (Roche Diagnostics, Mannheim, Germany). For amplification of the 30 end, first strand cDNA synthesis with RNA from the KF5 E. multilocularis isolate metacestode stage was performed as described in the instructions of the manufacturer, using an oligo dT-anchor primer (50 -GACCACGCGTA TCGATGTCGACT16V-30 ). For PCR amplification of the 30 end cDNA primers EmSP4 (50 -GGCGTATCTGGTGACAAGTT-30 ) and anchor primer (50 -GACCACGCGTATCGATGTCGAC-30 ) were used. First strand cDNA synthesis for amplification of the 50 end was performed using the specific primer EmSP1 (50 -ATCCCAATGTTGACATCT-30 ). Subsequently, cDNA was purified and poly(A)-tailed. PCR amplification of the dA-tailed cDNA was performed using primers EmSP2 (50 -C TACATGCAATACCGCGCG-30 ) and oligo dT-anchor primer (50 -GAC CACGCGTATCGATGTCGACT16V-30 ). A nested PCR was done with primers EmSP3 and anchor primer at an annealing temperature of 60 °C and elongation at 72 °C for 2 min with 0.75 U Pfu polymerase. Finally, products of 50 /30 RACE were sequenced (Microsynth Sequencing Service, Balgach, Switzerland). In order to obtain the full length Empgi gene sequence, PCR was performed with the primers EmPGIfullF1 (50 -TCTAGCGCAGTTGTCACGTA-30 ) and EmPGIfullR5 (50 -AGCTGACGTGTAATTCATCAG-30 ) and the fragment was sequenced (Microsynth Sequencing Service). 2.7. Heterologous expression and purification of recombinant Em PGI (recEmPGI) For cloning of the cDNA coding for EmPGI into the pET151/ D-TOPO expression plasmid (Invitrogen, Basel, Switzerland), a CACC overlap at the 50 end was added by PCR, in order to allow directional cloning into the vector. Primers EmPGI forward (50 -CACCGCTGCCCTTATGGATTTTGC-30 ) and EmPGI reverse (50 -CT AATGATCTTTTCTGTTGTGC-30 ) were used for amplification of the Empgi cDNA by Pfu polymerase. The amplified DNA was inserted into the pET151 plasmid (Invitrogen), amplified in Escherichia coli TOP 10 cells, and the plasmid containing the insert in the correct orientation was used for transformation into E. coli BL21 Star (Invitrogen). These were grown overnight at 37 °C in 2 ml lysogeny broth (LB) with ampicillin (0.2 mg/ml; Roche Diagnostics), transferred to a 500 ml Erlenmeyer flask with 200 ml LB with

Prior to immunisation, rat pre-immune serum was tested by immunoblotting in order to ensure the absence of antibodies against PGI. The rat was immunised by three successive s.c. injections of recEmPGI (1 lg) dissolved in Gerbu adjuvant 100 (Gerbu Biotechnik, Gaiberg, Germany) at days 1, 14 and 21. Serum was collected at day 28 and stored at 20 °C. Detection of recEmPGI by Western blot was performed as described for rabbit-antisera, with the exception that an anti-rat IgG AP conjugate (Promega) was used as secondary antibody. 2.9. Collection of metacestode secretory products Cultured E. multilocularis metacestodes of 2–5 mm in diameter were washed three times in PBS and were taken up in a medium without phenol red (RPMI, 100 U/ml penicillin G, 100 lg/ml streptomycin sulphate, 10 lg/ml tetracycline–HCl, 20 lg/ml Tavanic). Assays were carried out in 24-well plates, and 25–35 vesicles were transferred to each well. Care was taken to utilise only intact metacestodes. In some assays, the drug nitazoxanide (NTZ, 1 lg/ml) known to induce rapid damage to parasites and release of metacestode contents (Stettler et al., 2003, 2004) was added. Medium and medium containing NTZ were also used. Plates were incubated for 4 days (37 °C, 5% CO2) and subsequently the supernatants of each well were carefully harvested and stored at 20 °C. Detection of EmPGI was performed by the PGI glycolytic assay and Western blotting using anti-recEmPGI serum (see Section 2.11). In order to ensure intactness of vesicles and breakage of vesicles treated with nitazoxanide, respectively, the supernatants were assessed by Western blotting using a monoclonal antibody (clone B-5-1-2, ascites fluid, Sigma) directed against alpha tubulin. 2.10. Detection of anti-EmPGI antibodies in sera of naïve and experimentally infected C57Bl/6 mice by immunoblotting and ELISA Purified recEmPGI was separated by SDS–PAGE, blotted to nitrocellulose and incubated with antisera from naïve and secondary chronically infected C57Bl/6 mice (diluted 1:1000 in TBST/0.3% milk powder) originating from a previous infection study (Walker et al., 2004). Bound antibodies were detected employing an anti-mouse IgG alkaline phosphatase (AP) conjugate (Promega). ELISA was performed in 96-well plates (MaxiSorp, Wiesbaden, Germany) coated overnight at 4 °C with 100 lg of recEmPGI diluted in 0.05 M NaHCO3–Na2CO3, pH 9.6. Coated plates were stored at 20 °C until further use. Blocking in 3% BSA, 0.3% Tween in PBS was performed for 1 h at room temperature and antisera from naïve, acutely and chronically infected C57Bl/6 mice (diluted 1:500 in 0.3% BSA, 0.03% Tween in PBS; Walker et al., 2004) were allowed to bind for 1 h at room temperature. Bound antibodies were detected employing an anti-mouse IgG AP conjugate (Promega) and p-nitrophenyl-phosphate-disodium (1 mg/ml) as a

1566

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

substrate. The change in O.D. (405 nm) was read on a 96-well plate reader (MRXII, Dynex, Chantilly, VA, USA). 2.11. Measurement of EmPGI enzyme activity The glycolytic activity of recEmPGI in vitro was measured by employing the indirect assay described by Stadelmann et al. (2010). The assay was performed in 96-well microtitre plates (Greiner Bio-One, Frickenhausen, Germany). Per well, 95 ll of assay buffer (70 mM Tris–HCl (pH 7.6), 0.5 mM NAD (Fluka), 2 mM EDTA (Merck) and 1 U glucose-6-phosphate dehydrogenase) was mixed with different amounts of E. multilocularis vesicle fluid, secretory fractions or recEmPGI. As an additional negative control, recombinant Neospora caninum protein disulphide isomerase (NcPDI; Müller et al., 2008) produced and purified by the same procedure as recEmPGI was included. The reaction was started by addition of fructose-6-phosphate (Fluka) to 1 mM final concentration. NADH formation was measured by reading the absorbance at 340 nm at various time points (0–20 min) on a 96-well plate reader (MRXII, Dynex). Enzyme blanks (without addition of substrate) and substrate blanks (without enzyme) were also included. The absorbance values of these blanks were subtracted from the enzyme reaction values. Enzymatic activity per gram of total protein was calculated from the increase in A340 over time. 2.12. Vaccination of mice with recEmPGI and challenge infection with E. multilocularis metacestodes Balb/c mice were purchased from Charles River (Sulzfeld, Germany) at 6 weeks of age, and were housed in a temperaturecontrolled, light-cycle room in animal facilities according to the Swiss federal animal protection guidelines, with food and water ad libitum. They were separated into experimental groups with 10 animals each. Experiments were formally approved by the animal ethics commission of the Canton of Berne. They were used for experimentation on reaching 10 weeks of age. Prior to infection with E. multilocularis metacestode vesicle suspension, mice were treated by i.p. injection as follows. Group 1 was treated with 100 ll PBS and served as a positive control. Group 2 was treated with 100 ll saponin adjuvant (SAP) at 100 lg/ml, containing 16.5 lg of purified 6-his-tagged recombinant Neospora protein disulphide isomerase (NcPDI) (Müller et al., 2008). Group 3 was immunised with 100 ll SAP containing 16.5 lg EmPGI. Injections were carried out on days 1, 14 and 28. On day 42, mice were challenged by an i.p. injection of 100 ll E. multilocularis vesicle suspension containing approximately 50 metacestodes. Mice were checked daily for normal development, weight and health status, and on day 120 all the mice were sacrificed by CO2-euthanasia and subjected to necroscopy. For assessments of secondary infections, parasite tissue was carefully removed from the peritoneal cavity, and the parasites’ weights and numbers of metacestodes were determined in each experimental group (Dai et al., 2001; Stettler et al., 2004). To statistically compare the cell numbers in experimental groups with those in medium controls, a Student’s t-test was used and a P-value < 0.05 was considered significant. 2.13. Proliferation assays using endothelial cells, hepatocytes and fibroblasts Cultures of endothelial cells, hepatocytes and fibroblasts were initiated in 48-well plates (Greiner). Adrenal cortex endothelial cells (ACEs) were seeded at a density of 4  104/ml, Rh cells at 3.2  105/ml, and human foreskin fibroblasts (HFFs) at 1.6  105/ ml. Cells were grown in 250 ll medium (low glucose DMEM, containing 100 U/ml penicillin G, 100 lg/ml streptomycin sulphate, 0.2% calf serum for ACEs and 0.2% FCS for Rh cells and HFFs,

respectively). The cells were starved at a low serum concentration for 72 h and stimulated thereafter with recEmPGI (1, 5 and 10 ng/ml) for 72 h. As positive controls, ACEs and HFFs were stimulated with 1 ng/ml fibroblast growth factor-basic (FGF; TecoMedical, Sissach, Switzerland), and Rh cells were treated by adding 25 ng/ml mouse epidermal growth factor (EGF; PeproTech, London, UK). In order to investigate whether potentially contaminating lipopolysaccharides (LPS) in the recEmPGI sample were stimulating cell proliferation, recEmPGI was heat-denatured (100 °C, 10 min), centrifuged (16,100g, 10 min, 4 °C), and the supernatant was applied onto cells. Negative controls were performed by the addition of medium only, sodium phosphate buffer only, and by the addition of recombinant his-tagged proteins N. caninum microneme protein 4 (recNcMIC4; Srinivasan et al., 2007) and N. caninum protein disulphide isomerase (recNcPDI; Müller et al., 2008). After 3 days, adherent cells were washed once with medium, trypsinised and counted in a Neubauer chamber. To statistically compare the cell numbers in experimental groups with those in medium controls, a Student’s t-test was used, and a P-value < 0.05 was considered significant.

2.14. Proliferation assay using E. multilocularis GL cells Equal amounts of E. multilocularis GL cells were seeded into 12-well plates (Greiner) in 1 ml DMEM containing 100 U/ml penicillin G, 100 lg/ml streptomycin sulphate and 0.01 mM bathocuproinedisulphonic acid (BAT). For each well, the amount of cells corresponded to 200 ml net volume of pure metacestodes isolated out of in vitro cultures. As a positive control, cells were incubated in freshly isolated vesicle fluid, containing 100 U/ml penicillin G, 100 lg/ml streptomycin and 0.01 mM BAT. For stimulation by EmPGI, the recombinant protein was added to 1, 5 and 10 ng/ml final concentration. Negative controls were performed by adding an unrelated his-tagged recombinant protein (recNcPDI) at 1, 5 and 10 ng/ml, by supplementing with medium only, or by adding heat inactivated and centrifuged recEmPGI as above. All the tests were performed in duplicate. For the assessment of GL cell proliferation, 5 lCi 3H-thymidine (Hartmann Analytic, Braunschweig, Germany) was added to each well, cells were harvested after 5 days of incubation and 3H-thymidine incorporation was measured in a microplate scintillation counter (Topcount NXT, Packard). To statistically compare the counts in experimental groups to those in medium controls, a Student’s t-test was used and a P-value < 0.05 was considered significant.

3. Results 3.1. Characterisation of rabbit hyperimmune sera directed against whole metacestodes (anti-KF5), laminated layer (anti-LL) and chemically deglycoslylated laminated layer (anti-dLL) On immunoblots of LL that was isolated by 6 M urea extraction, the anti-KF5 and anti-LL antisera reacted with multiple proteins, often migrating as diffuse bands or even smears, which is indicative of the high carbohydrate content of the LL (Fig. 1A). In contrast, anti-dLL antiserum reacted selectively with a defined number of bands (Fig. 1A). For all the three antisera, the banding patterns of reactive proteins were dramatically altered upon on-blot deglycosylation of proteins by sodium-periodate treatment (Fig. 1B). Immunofluorescent staining of sections of metacestodes embedded in LR-White showed that anti-KF5 clearly labelled epitopes on both the LL and the GL, while anti-LL antiserum reacted almost exclusively with the LL (Fig. 1C and D). Anti-dLL antiserum did not label any epitopes on LR-White sections (data

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

A

1

2

3

B

97

97

66

66

45

45

31

31

C

D

F

G

1

2

1567

3

E

Fig. 1. Characterisation of antisera generated against Echinococcus multilocularis extracts and laminated layer (LL). (A and B) Western blots of LL fraction isolated by extraction in 6 M urea and separated by SDS–PAGE. Lane 1, labelled with anti-KF5 antiserum directed against entire metacestode extracts; lane 2, anti-LL antiserum directed against 6 M urea-extracted LL; lane 3, anti-deglycosylated LL (dLL) antiserum, directed against the dLL fraction. Blotted fractions were directly labelled (A), or labelled following chemical deglycosylation using sodium periodate (B). (C–G) Sections of LR-White-embedded metacestode tissue, stained either directly with anti-KF5 antiserum (C), or with anti-LL antiserum (D). In (E) the section is stained with periodic acid Schiff staining. (F) Sodium periodate-treated section stained with anti-dLL antiserum. In (G) the sodium periodate-treated section is stained with periodic acid Schiff staining. Antiserum-labelling was detected by a FITC-labelled antibody conjugate (green), parasite nuclei were labelled with DAPI (blue).

not shown), but deglycosylation treatment of sections with sodium periodate (Fig. 1F and G) resulted in staining of the LL (Fig. 1F). 3.2. Affinity-purified antibodies identify a 55 kDa protein named EmPGI as a LL-associated component In order to obtain specific antibodies for further identification of molecules that constitute the LL, small-scale affinity purification of antibodies reactive to a number of different protein bands within the LL fraction was performed. One of these bands selected for affinity purification was a prominent 55 kDa protein reactive with the anti-dLL antiserum (Fig. 2A). The affinity-purified antibody specifically stained the 55 kDa protein on immunoblots of LL-fractions isolated by 6 M urea extraction, as well as of LL-fractions purified by the Trypsin/EDTA-method (Fig. 2A). The antibody directed against the 55 kDa protein also labelled a 55 kDa protein band in VF, and on-blot deglycosylation of LL protein by sodium-periodate treatment did not alter the reactivity of the antibody, indicating that recognition of this protein occurs via one or several peptide epitopes (Fig. 2A). Upon on-section immunofluorescent labelling of metacestodes tissue embedded in LR-White, no reaction was visible (data not shown), whereas chemical deglycosylation of sections with sodium-periodate treatment rendered the epitopes accessible, and demonstrated

that the corresponding protein was present in the LL as well as in the GL (Fig. 2B). A fraction enriched for the 55 kDa protein was obtained by separating VF by DEAE anion-exchange chromatography. The sample containing the 55 kDa protein was eluted at 100 mM NaCl (data not shown). This fraction was separated by SDS–PAGE (Fig. 3A), and the corresponding colloidal Coomassie-stained protein band was analysed by tandem mass spectrometry. A subsequent Mascot database search identified the protein as a close homologue to the Echinococcus granulosus phosphoglucose isomerase (EgPGI; GenBank Accession No. AY942144). The full-length sequence of EmPGI gene was obtained by performing RACE PCR, finally leading to the amplification of the complete 1644 bp gene sequence, which was submitted to GenBank under the Accession No. EU031748. Both EmPGI and EgPGI comprised of 547 amino acids, and are virtually identical (98% identity and 99% similarity). The deduced amino acid sequence of EmPGI is presented in Fig. 3B, aligned with human PGI. EmPGI is a close homologue to human PGI, with 64% identity and 86% similarity (Fig. 3B). 3.3. Expression and characterisation of recEmPGI EmPGI cDNA was expressed in E. coli as a 6-his-fusion protein (recEmPGI). Attempts to express this protein at 37 °C or at room

1568

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

A

B 1

2

3

4

5

6

97 66 45

31 Fig. 2. Reactivity of affinity-purified antibodies directed against the 55 kDa protein of Echinococcus multilocularis metacestodes. (A) 6 M urea-extracted laminated layer (LL) was separated by SDS–PAGE and blotted to nitrocellulose. Lane 1, anti-deglycosylated LL (dLL) antiserum – the arrow points towards the 55 kDa band corresponding to phosphoglucose isomerase on which this serum was affinity-purified; lane 2, labelled with affinity-purified antibody; lane 3, LL treated on-blot with sodium periodate in sodium acetate buffer and incubated with affinity-purified antibody; lane 4, LL treated on-blot with sodium acetate buffer and incubated with affinity-purified antibody; lane 5, conjugate control; lane 6, vesicle fluid separated by SDS–PAGE, blotted and labelled with affinity-purified antibody. (B) Immunofluorescence on sodium periodate-treated metacestode tissue embedded in LR-White and labelled with affinity-purified antibody (green fluorescence). Nuclei are stained with DAPI (blue).

temperature consistently resulted in the formation of largely insoluble recEmPGI (data not shown). However, expression at a lower temperature (17 °C) resulted in a much larger yield of soluble protein (Fig. 3C), and Co2+-affinity chromatography of bacterial extracts resulted in the isolation of purified and soluble recEmPGI (Fig. 3D). Purified recEmPGI was readily detected by the anti-dLL antiserum by immunoblotting (data not shown). Further, a polyclonal rat antiserum directed against the bacterially expressed recEmPGI was generated. Immunoblotting showed that this antiserum recognised recEmPGI, and detected EmPGI in E. multilocularis LL fractions, VF and in isolated GL cells, but not in medium, medium including FCS, and in medium conditioned with Reuber rat hepatocytes (Fig. 3E). 3.4. Glycolytic activity of EmPGI is detected in VF and GL cells, but not in secretory fractions of E. multilocularis metacestodes The enzymatic activity of purified recEmPGI in relation to its involvement in glycolysis was demonstrated in vitro (Fig. 4A). In contrast, another recombinant protein (recNcPDI), which was produced in the same expression system and purified identically, did not exhibit any activity. Enzymatic activity of EmPGI was also detected in VF and GL cell extracts of in vitro-cultured E. multilocularis metacestodes (Fig. 4B). However, no activity was detected in secretory fractions (medium supernatants) of intact E. multilocularis metacestodes (Fig. 4C). Treatment of vesicles with the anti- parasitic compound nitazoxanide, which resulted in distortion of GL tissue, leads to leakage of VF and thus EmPGI into the medium, and in the detection of EmPGI activity in medium supernatants (Fig. 4C). The absence or presence of EmPGI was confirmed by immunoblotting of respective fractions using polyclonal anti- recEmPGI antibodies (Fig. 4D). 3.5. EmPGI is an immunogenic molecule and induces a humoral immune response during experimental infection Purified recEmPGI was separated by SDS–PAGE, transferred to nitrocellulose, and the presence of antibodies directed against EmPGI was assessed in sera of naïve mice, and in mice after several weeks of secondary infection with E. multilocularis metacestodes. Antibodies directed against EmPGI were hardly detectable in naïve mice, while in infected mice, antibodies were much more abundant

and produced clear staining of the recombinant protein band (Fig. 5A). ELISA was performed using recEmPGI as antigen and sera of naïve and experimentally infected mice taken at different time points p.i. (Fig. 5B). While no increases in antibody titres were seen in sera of mice taken at 4 weeks p.i., we observed a clear increase in antibodies reacting with recEmPGI in sera of mice obtained at 8 weeks p.i. or later. This indicated that EmPGI, although not secreted in a detectable soluble form in vitro, was readily exposed to the immune system during experimental infections in vivo. 3.6. Immunisation of mice with recEmPGI results in protection against challenge infection with E. multilocularis metacestodes RecEmPGI-vaccinated mice were challenge-infected with E. multilocularis metacestodes in order to investigate whether the generation of an immune response against this enzyme would interfere in parasite growth and/or development. All vaccinated mice exhibited a pronounced anti-recEmPGI antibody response (data not shown). Analysis of the parasite burden at 3 months after challenge infection revealed that, compared to mice inoculated with PBS or vaccinated with recNcPDI (an unrelated N. caninum protein produced in the same expression system), the mice vaccinated with recEmPGI exhibited a significantly lower parasite burden (Fig. 6). This suggests that immunisation of mice with recEmPGI interfered with parasite growth and development in secondarily infected mice. 3.7. RecEmPGI stimulates the proliferation of cultured E. multilocularis cells in vitro In cancer cells, extracellular PGI has been shown to be important for ensuring continued proliferation (Tsutsumi et al., 2003a,b). In order to determine whether EmPGI could also have such an intrinsic function within the parasite (e.g. through secretion into the VF), we have grown isolated GL cells in the presence of recEmPGI and VF and measured the proliferation rate via 3H-thymidine uptake (Fig. 7A). As expected, VF increased the GL cell proliferation more than fourfold compared with the medium control. RecEmPGI at 10 and 5 ng/ml also led to a significant increase in proliferation (P = 0.013 and 0.016), whereas the slight increase in 3H-thymidine uptake by the addition of 1 ng/ml recEmPGI was non-significant (P = 0.053). All negative controls (recNcPDI and heat-treated recEmPGI) had no effect.

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

1569

Fig. 3. Identification and molecular characterisation of Echinococcus multilocularis phosphoglucose isomerase (EmPGI). (A) SDS–PAGE (silver staining) of vesicle fluid separated by anion-exchange chromatography; only the fraction containing the 55 kDa band of interest is shown (arrow). The 55 kDa band was identified by MS/MS as EmPGI. (B) Full-length deduced amino acid sequence of EmPGI, aligned with human PGI. Note the conserved amino acid residues marked by arrows, which are responsible for substrate binding at the active site (Read et al., 2001). (C and D) Coomassie-stained SDS–PAGE showing (C) the expression of recombinant EmPGI (recEmPGI) in Escherichia coli at 20 h post-induction (the arrow points towards the over-expressed recombinant protein) and (D) purified recEmPGI. (E) Reactivity of anti-recEmPGI mouse serum on immunoblots of 6 M urea-extracted laminated layer (LL) (lane 1), Triton/EDTA extracted LL (lane 2), vesicle fluid (lane 3), Triton X-100 extract of germinal layer (GL) cells (lane 4), recEmPGI (including his-tag, lane 5), medium (DMEM, lane 6), medium including FCS (lane 7) and conditioned medium (from Reuber rat hepatocytes, lane 8).

3.8. RecEmPGI stimulates the proliferation of mammalian endothelial cells, but not of hepatocytes and fibroblasts, in vitro In tumours, extracellular PGI has been reported to be an important mediator of angiogenesis (Funasaka et al., 2001, 2002; Yanagawa et al., 2004). We therefore assessed the effects on endothelial cell proliferation upon recEmPGI exposure (Fig. 7B). Endothelial cell proliferation was significantly enhanced upon treatment with FGF-2 (1 ng/ml), which was used as a positive control. Similarly, the proliferation of endothelial cells was stimulated by the addition of VF. RecEmPGI also induced endothelial cell proliferation and the effect was dose-dependent: no proliferation was detected upon addition of 1 ng/ml of recEmPGI, while the addition of 5 and 10 ng/ml resulted in significantly enhanced cell division. This proliferative effect was completely abolished upon heat-treatment of recEmPGI, indicating that the recombinant protein itself, and not potential bacterial contaminants such as LPS, is responsible for this effect (Fig. 7B). Additionally, recNcMIC4,

an unrelated protein produced in the same system as recEmPGI, did not have any effect on endothelial cell proliferation, neither at 10 ng/ml (Fig. 7B) nor at 5 or 1 ng/ml (data not shown). In contrast to endothelial cells, exposure of rat hepatocytes and HFF to recEmPGI did not stimulate proliferation, while the addition of mouse EGF and FGF-2, respectively, resulted in increased proliferation of these cells (data not shown). This indicated that the proliferative effect on endothelial cells was the result of specific stimulation and not due to non-specific mitogenic properties of recEmPGI. 4. Discussion In AE, the host–parasite interface is largely influenced by the presence of parasite-derived molecules which interfere in, or at least influence, the host immune response and associated physiological responses to infection. In this respect, E. multilocularis metacestodes employ strategies similar to tumour cells, which

1570

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

B 75

µkat / g total protein

µkat / g total protein

A

50 25

µkat / g total protein

1

0.5

0

0

recEmPGI

C

1.5

recNcPDI

VF

GL

D

3.5 3

1

2.5

2

3

4

72

2

50

1.5 1 0.5 0

VF

secretory

NTZ

Fig. 4. Enzymatic activity of Echinococcus multilocularis phosphoglucose isomerase (EmPGI). Via the linear increase in absorption, activity was calculated in relation to total protein amount, e.g. recombinant protein in (A) and parasite fractions in (B and C). (A) Recombinant EmPGI (recEmPGI) displays PGI-activity, while another recombinant protein (recombinant Neospora caninum protein disulphide isomerase; recNcPDI) does not. (B) EmPGI activity is detected in vesicle fluid (VF) and in Triton X-100 extracts of germinal layer (GL) cells isolated from in vitro-cultured E. multilocularis metacestodes. (C) No PGI activity can be measured in secretory fractions of metacestode in vitro cultures maintained for 4 days, while EmPGI activity is detected in VF and in nitazoxanide-treated (NTZ) metacestode culture supernatants. (D) Detection of EmPGI by immunoblotting using polyclonal anti-recEmPGI antibodies: lane 1, VF (as in (B and C)); lane 2 secretory fraction (as in (C)); lane 3, medium supernatant of NTZ-treated culture (as in (C)); lane 4, medium alone.

release immunologically active molecules, factors that induce angiogenesis, as well as components that facilitate metastasis formation (Klinkert and Heussler, 2006). The LL, the most outer surface of the E. multilocularis metacestode, can be regarded as the most prominent secretory product of the parasite and represents the site where a direct interaction between the parasite and the host takes place. Thus, LL-associated molecules are most likely involved in enabling the parasite to establish itself and to develop within its host. In this study, we raised antisera against (i) extracts of entire E. multilocularis metacestodes (cloned isolate KF5) or against (ii) purified LL. Anti-KF5-antiserum detected epitopes in the GL and LL, while the anti-LL-antiserum detected epitopes mainly in the LL (Fig. 1). Immunoblots of SDS–PAGE-separated purified LL fractions revealed that the epitopes recognised by both antiKF5- and anti-LL-antiserum were largely defined by carbohydrates: first, the reactive LL-associated antigens migrated mainly as diffuse bands when separated by SDS–PAGE, which is typical for glycoproteins with high glycan content (Dai et al., 2001); second, the recognition pattern of both antisera changed dramatically upon on-blot deglycosylation of SDS–PAGE-separated LL, revealing a much more distinct banding pattern (Fig. 1B). These results confirmed and added to earlier findings that had demonstrated the reactivity of a large panel of lectins with E. multilocularis metacestodes, showing that the LL was composed of high molecular weight glycans (Dai et al., 2001; Ingold et al., 2000). An additional antiserum was generated, which was directed against chemically deglycosylated LL (anti-dLL-antiserum). AntidLL-antiserum exhibited a much more defined banding pattern when assessed by immunoblotting on isolated LL (Fig. 1A and B). The fact that only relatively few protein bands are recognised by

this antiserum, which is expected to be reacting with peptide epitopes rather than with carbohydrate epitopes, indicates that most immunogenic protein epitopes are masked by the high degree of glycosylation found within the LL. This is also consistent with the immunolocalisation studies on sections of E. multilocularis metacestodes (Fig. 1F and G). Anti-dLL antiserum reacted with a major protein band that was identified as EmPGI (Fig. 2). Inspection of a first assembly version of the E. multilocularis genome under http://www.sanger.ac.uk/ cgi-bin/blast/submitblast/Echinococcus showed that only one single EmPGI locus is present in E. multilocularis (contig 2290). Alignment of the deduced amino acid sequence of EmPGI with human PGI revealed a high degree of homology between human and Echinococcus PGI (Fig. 3B). The most pronounced difference between EmPGI and human PGI was found within the first 50 N-terminal amino acids, although amino acids 1–4 were identical. The high similarity between the echinococcal and human PGI suggests that they might also exhibit similar properties. PGI is a dimeric enzyme that has been shown to carry out multiple functions. Intracellularly, PGI is responsible for the interconversion of D-glucose-6-phosphate and D-fructose-6-phosphate in glycolysis and in gluconeogenesis. On the other hand, extracellular PGI has been shown to carry out a number of activities related to cellular proliferation, cell motility and angiogenesis. The proposed active sites of human PGI for substrate binding include Lys211, Gln354, Glu358, Gln512, Lys519 and His389 (Read et al., 2001), which are all conserved in the alignment (Fig. 3B). All of these point into the active site cavity and make few bonding interactions with other residues. Crystallisation studies have shown that there is a structural overlap of the regions responsible for the enzymatic and cytokine functions of PGI (Tanaka et al., 2002).

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

A

1

2

3

4

5

6

7

8

72 50

B

*

Δ A405nm /min

8

*

4

*

3

*

2 1 0

n1 n2 n3 n4 n5

i1

i2

i3

i4

i5

Fig. 5. Recognition of recombinant Echinococcus multilocularis phosphoglucose isomerase (recEmPGI) by immune sera of experimentally infected mice. Sera were assessed by immunoblotting (A) and ELISA (B). (A) Sera from naïve (lanes 1–4) and experimentally infected C57BL/6 mice (lanes 5–8) were checked for reactivity with recEmPGI by immunoblotting. Sera were taken at 10 weeks p.i. (lanes 5 and 6), 8 weeks p.i. (lane 7) and at 14 weeks p.i. (lane 8). (B) Sera from naïve (n1–n5) and experimentally infected C57BL/6 mice (i1–i5) were checked for reactivity with recEmPGI by ELISA. Sera were taken at 4 weeks p.i. (i1), 8 weeks p.i. (i2), 10 weeks p.i. (i3 and i4) and at 14 weeks p.i. (i5). Note the increase in anti-EmPGI antibodyreactivity in sera of infected mice from 8 weeks p.i. onwards ().

Our study provides clear indications that EmPGI, in analogy to its mammalian counterparts, could exhibit multiple functional characteristics, intrinsically within the parasite but possibly also extrinsically, in modulating the host–parasite interface. First, we confirmed that purified recombinant recEmPGI was enzymatically active in vitro, and EmPGI glycolytic activity was detected in cultured cells isolated from the E. multilocularis GL (Fig. 4). Second, similar to higher eukaryotes, we also detected EmPGI, either by an activity assay or immunocytochemistry, in extracellular

3.0

p= 1.8E-05 p= 1.4E-03

cyst weight (g)

2.5 2.0 1.5 1.0 0.5 0.0

PBS

recNcPDI

recEmPGI

Fig. 6. Vaccination of mice with recombinant Echinococcus multilocularis phosphoglucose isomerase (recEmPGI) leads to suppression of parasite growth. Balb/c mice (10 animals per group) were treated with PBS as an infection control, recombinant Neospora caninum protein disulphide isomerase (recNcPDI) as an unrelated controlvaccine or with recEmPGI, both in saponin adjuvants. Analysis of parasite weights in the different experimental groups demonstrates the significant growth inhibition associated with recEmPGI vaccination compared with treatments with recNcPDI and PBS (P < 0.05). The box plots indicate the distribution of parasite weights in the different treatment groups.

1571

compartments such as VF and in the LL (Fig. 4). Third, vaccination of mice with recEmPGI rendered these mice less susceptible to challenge infection with E. multilocularis metacestodes (Fig. 6). This is compelling evidence which demonstrates that generating an immune response against this protein interferes in the growth and development of metacestodes. The characteristics of this immune response and the actual protective mechanisms are currently unknown and still under investigation, but our studies suggest that immunity against recEmPGI could affect both intra-parasitic processes as well as physiological events at the host–parasite interface. Echinococcus multilocularis VF represents an extracellular, but still intra-parasitic compartment. The presence of EmPGI in the VF implies that this protein is released by GL cells and could thus play a role in cellular proliferation and/or differentiation of the GL-associated tissue. Indeed, EmPGI-RNA expression was detected not only in metacestodes, but also in protoscoleces and in primary cultures of GL cells (data not shown). Our observation, demonstrating that the addition of recEmPGI to cultured GL cells enhances their proliferation in vitro (Fig. 7A), supports this hypothesis, but further studies are needed to elucidate how EmPGI induces enhanced proliferation of Echinococcus cells. In mammalian cells, it was shown that PGI can act as a cytokine and nerve growth factor (Jeffery et al., 2000). Down-regulation of PGI expression reduced cellular life span (Kondoh et al., 2005) and led to inhibited cellular proliferation and reduced tumourigenicity in cancer cells (Funasaka et al., 2007). Due to the tumour-like characteristics of E. multilocularis metacestodes (including the uncontrolled unlimited proliferation, over-expression of the pro-tumourogenic 14-3-3-zeta-isoform, the potential for metastasis formation (see Siles-Lucas et al., 1998; Hemphill et al., 2007)) and the high similarities between EmPGI and human PGI, it is conceivable that EmPGI could also play similar extracellular roles as a determinant of parasite growth and proliferation, by directly targeting GL cells. In contrast to VF, the LL represents a truly extra-parasitic compartment, whose components are synthesised within the GL and then secreted into the periphery of the metacestode. We showed that EmPGI was a prominent component of the LL, but remained tightly bound to this structure, since no EmPGI activity could be measured in medium supernatants of intact metacestode in vitro cultures (Fig. 4). However, sera from E. multilocularis- infected mice contained antibodies that readily reacted with recEmPGI showing that, in vivo, the protein was exposed to the immune system (Fig. 5). How this exposure occurs is not known but recent observations obtained in vitro suggest that E. multilocularis metacestodes might exhibit two possibilities for proliferation: (i) by exogenous budding and separation of smaller daughter vesicles from larger older ones and (ii) by endogenous formation of small daughter vesicles originating from the GL of older, larger vesicles (Hemphill et al., 2010). In the latter case, these older metacestodes degenerate and release the smaller vesicles and VF into the environment, which would in turn render EmPGI accessible to the immune system. In cancer, the extracellular form of PGI described as cytokine AMF is involved in the enhancement of angiogenesis, tumour invasion and metastasis formation (Haga et al., 2000; Funasaka et al., 2001, 2002, 2005, 2007; Yanagawa et al., 2004). Since earlier studies described the formation of new blood vessels around the developing metacestode (Vuitton et al., 1986; Gueret et al., 1998), we investigated whether VF, or more specifically recEmPGI, could potentially be involved in endothelial cell proliferation in vitro (Fig. 7B). Both VF as well as recEmPGI stimulated cell division of endothelial cells in vitro, whereas other cell types such as hepatocytes or fibroblasts remained unaffected. Thus EmPGI, as well as other components of the VF, could potentially be involved in the formation and/or recruitment of new blood vessels around the developing metacestode, similar to what has been found for

1572

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

*

A

*

*

EmPGI 5ng/ml

cpm

15000

EmPGI 10ng/ml

35000

10000

5000

VF

EmPGIb

NcPDI 10ng/ml

EmPGI 1ng/ml

medium

0

B 6.E+05 5.E+05

*

*

* *

cell number

4.E+05 3.E+05 2.E+05 1.E+05

VF 10ng/ml

NcMic4 10ng/ml

EmPGIb

EmPGI 10ng/ml

EmPGI 5ng/ml

EmPGI 1ng/ml

buffer

medium

FGF 1ng/ml

0.E+00

Fig. 7. Vesicle fluid (VF) and recombinant Echinococcus multilocularis phosphoglucose isomerase (recEmPGI) affect the proliferation of echinococcal germinal layer (GL) cells and of adrenal cortex endothelial (ACE) cells. (A) GL cell proliferation was measured by 3H-thymidine incorporation. GL cells were kept in medium alone or stimulated with recEmPGI (1, 5 and 10 ng/ml), recEmPGIb (boiled control), recombinant Neospora caninum protein disulphide isomerase (recNcPDI) and VF. For assessment of GL cell proliferation 3H-thymidine incorporation was measured after 5 days of incubation. Note the induction of cellular proliferation after the addition of recEmPGI and VF as indicated by (). (B) Endothelial cell proliferation assay: ACEs were seeded at 40,000 cells/ml, starved for 3 days and stimulated for 3 days. Proliferation was assessed by counting cells in a Neubauer chamber. Medium and sodium phosphate buffer (buffer) were used as negative controls. Stimulation was performed with FGF-2 (fibroblast growth factor) as positive control, recEmPGI (1, 5 and 10 ng/ml), recEmPGIb (boiled control), recombinant N. caninum microneme protein 4 (recNcMic4) and VF. Note the significant increase in proliferation as indicated by ().

tumours (Funasaka et al., 2001, 2002; Yanagawa et al., 2004). Thereby, the parasite optimises the acquisition of nutrition and creates a situation that favours the spreading of metastases. In addition to its role in angiogenesis, PGI was described as neuroleukin (NL; Chaput et al., 1988; Faik et al., 1988), differentiation and maturation mediator (DMM; Xu et al., 1996), antigen of rheumatoid arthritis (Matsumoto et al., 1999), sperm-antigen-36 (Yakirevich and Naot, 2000), myofibril-bound serine proteinase inhibitor (Cao et al., 2000) and endocrine factor involved in implantation (Schulz

and Bahr, 2004). Thus, the release of EmPGI into the peri-parasitic compartment could well have other still undiscovered, physiological effects. GL cells are responsible for the growth of vesicles and their spread in the intermediate host (Spiliotis et al., 2008). Our findings, that GL cell proliferation is enhanced upon addition of recEmPGI, imply that EmPGI, as well as other VF components, plays an important role in metacestode growth. In addition, the fact that recEmPGI and other VF components also accelerate endothelial cell

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

proliferation indicates that recEmPGI could be an important mediator of angiogenesis around developing metacestodes. It is not clear how extrinsic or intrinsic release of PGI occurs, since there is no signal peptide targeting the protein towards the secretory pathway. Haga et al. (2000) showed that Casein kinase II phosphorylates human PGI at Ser185 and speculated that this may then lead to a conformational change allowing PGI to be secreted by a non-classical pathway. In conclusion, our results strongly suggest that EmPGI in E. multilocularis could exhibit different activities, ranging from its activity as a glycolytic enzyme to a role in influencing the proliferation of parasite tissue as well as modulating the surrounding host physiology. Which molecules could possibly interact with PGI is not clear. A corresponding receptor for extracellular PGI, the seven-transmembrane glycoprotein 78 (gp78), was identified in human endothelial cells (Silletti et al., 1991; Shimizu et al., 1999). BLAST analyses of the E. multilocularis genome assembly version revealed that a corresponding Echinococcus orthologue (e-value 4e-16) is present on contig 6 (data not shown). However, PGI has also been described as exerting its functional activities through mechanisms that possibly do not involve gp78 (Niinaka et al., 2002). Thus, further studies will reveal whether the Emgp78 orthologue represents the EmPGI receptor in Echinococcus. Interactions of E. multilocularis receptors with specific host ligands, such as in TGF-b/BMP signalling (Zavala-Góngora et al., 2006), EGF-like signalling (Spiliotis et al., 2003, 2006) and insulin signalling (Konrad et al., 2003), have already been described, and it has been demonstrated that the components of the mitogen-activated protein (MAP) kinase cascade in hepatic cells can be activated by E. multilocularis metacestodes (Konrad et al., 2003). Thus it is conceivable that a similar association between a parasite- derived ligand and a host-derived receptor could occur. In this context, EmPGI and its binding partners could provide an additional platform in the host–parasite interplay. Acknowledgements We kindly acknowledge the technological help of Prof. Bernhard Erni and Philipp Schneider from the Department of Chemistry and Biochemistry, University of Berne, Switzerland and thank Prof. Urban Deutsch from the Theodor Kocher Institute, University of Berne, for providing the bovine endothelial cells used in this study. The rat hepatocyte cell line was kindly provided by Prof. Klaus Brehm, University of Würzburg, Germany. We also acknowledge Arunasalam Naguleswaran for his help and support during the initial stages of this study. B.S. has been supported by a fellowship provided through the Karl Enigk Stiftung, and J.M. is a recipient of a research fellowship provided by Novartis Animal Health. This study was carried out within the framework of the Swiss National Science Foundation Grant 31-111,780. References Cao, M.J., Osatomi, K., Matsuda, R., Ohkubo, M., Hara, K., Ishihara, T., 2000. Purification of a novel serine proteinase inhibitor from the skeletal muscle of white croaker (Argyrosomus argentatus). Biochem. Biophys. Res. Commun. 272, 485–489. Chaput, M., Claes, V., Portetelle, D., Cludts, I., Cravador, A., Burny, A., Gras, H., Tartar, A., 1988. The neurotrophic factor neuroleukin is 90% homologous with phosphohexose isomerase. Nature 332, 454–455. Dai, W.J., Hemphill, A., Waldvogel, A., Ingold, K., Deplazes, P., Mossmann, H., Gottstein, B., 2001. Major carbohydrate antigen of Echinococcus multilocularis induces an immunoglobulin G response independent of ab+CD4+ T cells. Infect. Immun. 69, 6074–6083. Deplazes, P., Gottstein, B., 1991. A monoclonal antibody against Echinococcus multilocularis Em2 antigen. Parasitology 103, 41–49. Eckert, J., Deplazes, P., 2004. Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern. Clin. Microbiol. Rev. 17, 107– 135.

1573

Faik, P., Walker, J.I., Redmill, A.A., Morgan, M.J., 1988. Mouse glucose-6-phosphate isomerase and neuroleukin have identical 30 sequences. Nature 332, 455–457. Funasaka, T., Haga, A., Raz, A., Nagase, H., 2001. Tumor autocrine motility factor is an angiogenic factor that stimulates endothelial cell motility. Biochem. Biophys. Res. Commun. 285, 118–128. Funasaka, T., Haga, A., Raz, A., Nagase, H., 2002. Autocrine motility factor secreted by tumor cells upregulates vascular endothelial growth factor receptor (FLT-1) expression in endothelial cells. Int. J. Cancer 101, 217–223. Funasaka, T., Yanagawa, T., Hogan, V., Raz, A., 2005. Regulation of phosphoglucose isomerase/autocrine motility factor expression by hypoxia. FASEB J. 19, 1422– 1430. Funasaka, T., Hu, H., Hogan, V., Raz, A., 2007. Down-regulation of phosphoglucose isomerase/autocrine motility factor expression sensitizes human fibrosarcoma cells to oxidative stress leading to cellular senescence. J. Biol. Chem. 282, 36362–36369. Gottstein, B., Hemphill, A., 1997. Immunopathology of echinococcosis. Chem. Immunol. 66, 177–208. Gottstein, B., Hemphill, A., 2008. Echinococcus multilocularis: the parasite–host interplay. Exp. Parasitol. 119, 447–452. Gottstein, B., Dai, W.J., Walker, M., Stettler, M., Müller, N., Hemphill, A., 2002. An intact laminated layer is important for the establishment of secondary Echinococcus multilocularis infection. Parasitol. Res. 88, 822–828. Gueret, S., Vuitton, D.A., Lance, M., Pater, C., Carbillet, J.P., 1998. Echinococcus multilocularis: relationship between susceptibility/resistance and liver fibrogenesis in experimental mice. Parasitol. Res. 84, 657–667. Haga, A., Niinaka, Y., Raz, A., 2000. Phosphohexose isomerase/autocrine motility factor/neuroleukin/maturation factor is a multifunctional protein. Biochim. Biophys. Acta 1480, 235–244. Hemphill, A., Gottstein, B., 1995. Immunology and morphology studies on the proliferation of in vitro cultivated Echinococcus multilocularis metacestodes. Parasitol. Res. 81, 605–614. Hemphill, A., Gottstein, B., 1996. Identification of a major surface protein on Neospora caninum tachyzoites. Parasitol. Res. 82, 497–504. Hemphill, A., Stettler, M., Walker, M., Siles-Lucas, M., Fink, R., Gottstein, B., 2002. Culture of Echinococcus multilocularis metacestodes: an alternative to animal use. Trends Parasitol. 18, 445–451. Hemphill, A., Spicher, M., Stadelmann, B., Müller, J., Naguleswaran, A., Gottstein, B., Walker, M., 2007. Innovative chemotherapeutical treatment options for alveolar and cystic echinococcosis. Parasitology 134, 1657–1670. Hemphill, A., Stadelmann, B., Scholl, S., Müller, J., Spiliotis, S., Müller, N., Gottstein, B., Siles-Lucas, M., 2010. Echinococcus metacestodes as laboratory models for the screening of drugs against cestodes and trematodes. Parasitology 137, 569– 587. Ingold, K., Gottstein, B., Hemphill, A., 1998. Identification of a laminated layerassociated protein in Echinococcus multilocularis metacestodes. Parasitology 116, 363–372. Ingold, K., Gottstein, B., Hemphill, A., 2000. High molecular mass glycans are major structural elements associated with the laminated layer of in vitro cultivated Echinococcus multilocularis metacestodes. Int. J. Parasitol. 30, 207–214. Jeffery, C.J., Bahnson, B.J., Chien, W., Ringe, D., Petsko, G.A., 2000. Crystal structure of rabbit phosphoglucose isomerase, a glycolytic enzyme that moonlights as neuroleukin, autocrine motility factor, and differentiation mediator. Biochemistry 39, 955–964. Klinkert, M.Q., Heussler, V., 2006. The use of anticancer drugs in antiparasitic chemotherapy. Mini Rev. Med. Chem. 6, 131–143. Kondoh, H., Lleonart, M.E., Gil, J., Wang, J., Degan, P., Peters, G., Martinez, D., Carnero, A., Beach, D., 2005. Glycolytic enzymes can modulate cellular life span. Cancer Res. 65, 177–185. Konrad, C., Kroner, A., Spiliotis, M., Zavala-Góngora, R., Brehm, K., 2003. Identification and molecular characterisation of a gene encoding a member of the insulin receptor family in Echinococcus multilocularis. Int. J. Parasitol. 33, 301–312. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lawton, P., Hemphill, A., Deplazes, P., Gottstein, B., Sarciron, M.E., 1997. Echinococcus multilocularis metacestodes: immunological and immunocytochemical analysis of the relationships between alkaline phosphatase and the Em2 antigen. Exp. Parasitol. 87, 142–149. Matsumoto, I., Staub, A., Benoist, C., Mathis, D., 1999. Arthritis provoked by linked T and B cell recognition of a glycolytic enzyme. Science 286, 1732–1735. Müller, J., Naguleswaran, A., Müller, N., Hemphill, A., 2008. Neospora caninum: functional inhibition of protein disulfide isomerase by the broad-spectrum antiparasitic drug nitazoxanide and other thiazolides. Exp. Parasitol. 118, 80–88. Niinaka, Y., Haga, A., Negishi, A., Yoshimasu, H., Raz, A., Amagasa, T., 2002. Regulation of cell motility via high and low affinity autocrine motility factor (AMF) receptor in human oral squamous carcinoma cells. Oral Oncol. 38, 49–55. Rausch, R.L., Wilson, J.F., Schantz, P.M., McMahon, B.J., 1987. Spontaneous death of Echinococcus multilocularis: cases diagnosed serologically (by Em2 ELISA) and clinical significance. Am. J. Trop. Med. Hyg. 36, 576–585. Read, J., Pearce, J., Li, X., Muirhead, H., Chrigwin, J., Davies, C., 2001. The crystal structure of human phosphoglucose isomerase at a 1.6 Å resolution: implications for catalytic mechanism, cytokine activity and haemolytic anemia. J. Mol. Biol. 309, 447–463. Schulz, L.C., Bahr, J.M., 2004. Potential endocrine function of the glycolytic enzyme glucose-6-phosphate isomerase during implantation. Gen. Comp. Endocrinol. 137, 283–287.

1574

B. Stadelmann et al. / International Journal for Parasitology 40 (2010) 1563–1574

Shimizu, K., Tani, M., Watanabe, H., Nagamachi, Y., Niinaka, Y., Shiroishi, T., Ohwada, S., Raz, A., Yokota, J., 1999. The autocrine motility factor receptor gene encodes a novel type of seven transmembrane protein. FEBS Lett. 456, 295–300. Siles-Lucas, M., Felleisen, R.S., Hemphill, A., Wilson, W., Gottstein, B., 1998. Stagespecific expression of the 14-3-3 gene in Echinococcus multilocularis. Mol. Biochem. Parasitol. 91, 281–293. Silletti, S., Watanabe, H., Hogan, V., Nabi, I.R., Raz, A., 1991. Purification of B16-F1 melanoma autocrine motility factor and its receptor. Cancer Res. 51, 3507–3511. Sonda, S., Fuchs, N., Gottstein, B., Hemphill, A., 2000. Molecular characterization of a novel microneme antigen in Neospora caninum. Mol. Biochem. Parasitol. 108, 39–51. Spiliotis, M., Kroner, A., Brehm, K., 2003. Identification, molecular characterization and expression of the gene encoding the epidermal growth factor receptor orthologue from the fox-tapeworm Echinococcus multilocularis. Gene 323, 57–65. Spiliotis, M., Konrad, C., Gelmedin, V., Tappe, D., Brückner, S., Mösch, H.U., Brehm, K., 2006. Characterisation of EmMPK1, an ERK-like MAP kinase from Echinococcus multilocularis which is activated in response to human epidermal growth factor. Int. J. Parasitol. 36, 1097–1112. Spiliotis, M., Lechner, S., Tappe, D., Scheller, C., Krohne, G., Brehm, K., 2008. Transient transfection of Echinococcus multilocularis primary cells and complete in vitro regeneration of metacestode vesicles. Int. J. Parasitol. 38, 1025–1039. Srinivasan, S., Müller, J., Suana, A., Hemphill, A., 2007. Vaccination with microneme protein NcMIC4 increases mortality in mice inoculated with Neospora caninum. J. Parasitol. 93, 1046–1055. Stadelmann, B., Scholl, S., Müller, J., Hemphill, A., 2010. Application of an in vitro drug screening assay based on the release of phosphoglucose isomerase to determine the structure activity relationship of thiazolides against Echinococcus multilocularis metacestodes. J. Antimicrob. Chemother. 65, 512–519. Stettler, M., Fink, R., Walker, M., Gottstein, B., Geary, T.G., Rossignol, J.F., Hemphill, A., 2003. In vitro parasiticidal effect of nitazoxanide against Echinococcus multilocularis metacestodes. Antimicrob. Agents Chemother. 47, 467–474. Stettler, M., Rossignol, J.F., Fink, R., Walker, M., Gottstein, B., Merli, M., Theurillat, R., Thormann, W., Dricot, E., Segers, R., Hemphill, A., 2004. Secondary and primary murine alveolar echinococcosis: combined albendazole/nitazoxanide chemotherapy exhibits profound anti-parasitic activity. Int. J. Parasitol. 34, 615–624.

Tanaka, N., Haga, A., Uemura, H., Akiyama, H., Funasaka, T., Nagase, H., Raz, A., Nakamura, K.T., 2002. Inhibition mechanism of cytokine activity of human autocrine motility factor examined by crystal structure analyses and sitedirected mutagenesis studies. J. Mol. Biol. 318, 985–997. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350–4354. Tsutsumi, S., Yanagawa, T., Shimura, T., Fukumori, T., Hogan, V., Kuwano, H., Raz, A., 2003a. Regulation of cell proliferation by autocrine motility factor/ phosphoglucose isomerase signaling. J. Biol. Chem. 22, 32165–32172. Tsutsumi, S., Hogan, V., Nabi, I.R., Raz, A., 2003b. Overexpression of the autocrine motility factor/phosphoglucose isomerase induces transformation and survival of NIH-3T3 fibroblasts. Cancer Res. 63, 242–249. Vuitton, D.A., Guerret-Stocker, S., Carbillet, J.P., Mantion, G., Miguet, J.P., Grimaud, J.A., 1986. Collagen immunotyping of the hepatic fibrosis in human alveolar echinococcosis. Z. Parasitenkd. 72, 97–104. Walker, M., Baz, A., Dematteis, S., Stettler, M., Gottstein, B., Schaller, J., Hemphill, A., 2004. Isolation and characterization of a secretory component of Echinococcus multilocularis metacestode potentially involved in modulating the host–parasite interface. Infect. Immun. 72, 527–536. Wessel, D., Flügge, U.I., 1984. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138, 141–143. Xu, W., Seiter, K., Feldmann, E., Ahmed, T., Chiao, J.W., 1996. The differentiation and maturation mediator for human myeloid leukemia cells shares homology with neuroleukin or phosphoglucose isomerase. Blood 87, 4502–4506. Yakirevich, E., Naot, Y., 2000. Cloning of a glucose phosphate isomerase/ neuroleukin-like sperm antigen involved in sperm agglutination. Biol. Reprod. 62, 1016–1023. Yanagawa, T., Funasaka, T., Tsutsumi, S., Watanabe, H., Raz, A., 2004. Novel roles of the autocrine motility factor/phosphoglucose isomerase in tumor malignancy. Endocr. Relat. Cancer 11, 749–759. Zavala-Góngora, R., Kroner, A., Bernthaler, P., Knaus, P., Brehm, K., 2006. A member of the transforming growth factor-beta receptor family from Echinococcus multilocularis is activated by human bone morphogenetic protein 2. Mol. Biochem. Parasitol. 146, 265–271.