Ecological influence of the entomopathogenic nematode, Steinernema carpocapsae, on pistachio orchard soil arthropods

Pedobiologia 55 (2012) 51–58

Contents lists available at SciVerse ScienceDirect

Pedobiologia - International Journal of Soil Biology journal homepage: www.elsevier.de/pedobi

Ecological influence of the entomopathogenic nematode, Steinernema carpocapsae, on pistachio orchard soil arthropods A.K. Hodson a,∗ , J.P. Siegel b , E.E. Lewis c a b c

Department of Land Air and Water Resources, University of California Davis, United States USDA/ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA, United States Department of Entomology/Department of Nematology, University of California Davis, United States

a r t i c l e

i n f o

Article history: Received 31 August 2011 Received in revised form 27 October 2011 Accepted 28 October 2011 Keywords: Entomopathogenic nematode Biological control Non-target effects Biodiversity

a b s t r a c t The entomopathogenic nematode, Steinernema carpocapsae, can reduce pesticide reliance in pistachios by controlling overwintering larvae of the navel orangeworm, Amyelois transitella (Lepidoptera: Pyralidae). But, beyond this, their influence in pistachio soil food webs is unclear. Given soil food webs’ complexity, S. carpocapsae likely interact with more species than just their intended target, infecting alternate hosts or providing food for native predators. This study quantifies the nematodes’ effects on soil arthropod and surface arthropod diversity in two large orchards in Madera County, California. We found significantly more isotomid collembolans, predatory anystid mites and gnaphosid spiders under trees where nematodes were applied indicating either direct predation or indirect trophic effects. Significantly fewer Forficula auricularia (Dermaptera: Forficulidae) and Blapstinus discolor (Coleoptera: Tenebrionidae) were found under treated trees, suggesting a possible non-target infection. Nematode persistence was limited but positively correlated with pitfall catches of the tenebrionid beetles, Nyctoporis cristata and B. discolor. © 2011 Elsevier GmbH. All rights reserved.

Introduction Entomopathogenic nematodes (EPNs) live in soil and lethally parasitize insects, infecting the larvae of many pest species. As an alternative to chemical insecticides, EPNs are used against pests of several fruit and nut crops (Lacey and Shapiro-Ilan 2008). The EPN, Steinernema carpocapsae, can control populations of navel orangeworm (Amyelois transitella) in pistachios, a crop with high and increasing value in California (Boriss 2005; Starrs and Goin 2010). Navel orangeworm moths oviposit during the summer and the larvae spend winter feeding on nuts remaining on trees or the ground after harvest, infesting new nuts the next year (Bentley et al. 2008). Throughout most of the pistachio growing season, navel orangeworm is controlled with insect growth regulators and pyrethroid insecticides (Bentley et al. 2008; Zalom et al. 1984), but these methods do not affect overwintering larvae. In the field, S. carpocapsae can locate and kill >72% of navel orangeworm larvae when applied at a rate of 105 infective juveniles (IJs) × m−2 by manual spraying (Siegel et al. 2004). However, applying EPNs through the irrigation system is more economically feasible and less labor intensive. While pistachio acreage continues to increase (Boriss 2005), the pesticides used to control navel orangeworm are increasingly

∗ Corresponding author. Tel.: +1 530 792 8930; fax: +1 530 752 9659. E-mail address: [email protected] (A.K. Hodson). 0031-4056/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.pedobi.2011.10.005

regulated so that as pistachio producers reduce their pesticide use, EPN applications will likely become a more widely used tactic. Applied S. carpocapsae may interact with native arthropods in several ways. First, they may serve as food for predators. Adding S. carpocapsae at the standard rate (2500 m−2 ) in these ecosystems increases total nematode densities to 35 times above normal (Hodson, unpublished data), representing a substantial pulse of resources for nematode feeding arthropods. Many mesostigmatid mites will eat nematodes (Walter and Ikonen 1989) and astigmatid mites (Sancassania sp.) can also consume IJs emerging from insect cadavers, thereby decreasing their ability to persist and reducing the number of infected hosts (Ekmen et al. 2010). Forschler and Gardner (1991) found increases in predatory mites (family Rodararidae) 1–4 weeks after field-application of EPNs and poor persistence of EPNs has been positively correlated with numbers of total mites and collembolans (Epsky et al. 1988; Gilmore and Potter 1993) indicating that these organisms may be an important mortality factor for naturally occurring and applied EPNs. Alternatively, EPNs may parasitize non-target insects in the orchard. Bathon (1996) reported that the EPNs, Steinernema feltiae and Heterorhabditis megidis, generally had little impact on non-target arthropods, but some studies finding no effects only identified insects to the family or order level (Georgis et al. 1991; Campbell et al. 1995), perhaps hiding effects on individual species. In a large scale multi-year study in citrus, microarthropods and enchytraeid worm densities were reduced in Steinernema riobrave

52

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

treated plots (Duncan et al. 2007). Other studies measuring changes in individual species abundance found that, while most groups remained unchanged, the densities of four non-target species of chrysomelid and carabid beetles were reduced in S. feltiae treated plots, and one species of Curculionidae (Barypeithes spp.) was reduced in H. megidis treated plots (Buck and Bathon 1993; Koch and Bathon 1993). These results indicate the importance of examining as much of the ecological community as possible when assessing non-target effects. One concern of applying EPNs is that they will disrupt native communities and ecosystem services provided by soil biodiversity. For example, Millar and Barbercheck (2001) found that when the exotic Steinernema riobrave was applied, detection of the endemic EPN Heterorhabditis bacteriophora decreased, with possible effects on long term pest suppression. While soil ecosystems are often thought to be resilient (Wardle et al. 1995; De Ruiter et al. 1995), agricultural intensification reduces the abundance of soil biota (Postma-Blaauw et al. 2010) and such losses in biodiversity may leave ecosystems vulnerable to disturbance (Bengtsson et al. 2000). As a potential biological disturbance in pistachios, S. carpocapsae could negatively affect species diversity and community composition either through direct trophic interactions, or indirectly through its mutualistic bacteria. These bacteria, in the genus Xenorhadbus for Steinernematids, secrete toxins which kill the insect host and also antimicrobial and fungicidal metabolites that protect it from degrading (Isaacson and Webster 2002). The effects of S. carpocapsae could also vary within an orchard. For example, if areas of the orchard where diversity is high are more resistant to biological disturbance, S. carpocapsae might have stronger effects in low diversity microsites than in higher diversity microsites. While previous studies have identified S. carpocapsae as tool against navel orangeworm in pistachios (Siegel et al. 2004, 2006), its broader ecological effects in these systems remain unknown. This study examines the response of two pistachio orchard ecosystems to the addition of high densities of S. carpocapsae and quantifies the relationship between arthropod population densities and nematode persistence. By understanding how S. carpocapsae interacts with the ecosystems into which it is applied, we can better predict where it will be able to most successfully survive, persist, and reduce pest populations. Understanding the ecological effects of S. carpocapsae in pistachio orchards could also have broader implications on its effects in other high value perennial crops. Predicting that large numbers of S. carpocapsae would affect the orchard soil ecosystem, we posed the following hypotheses:

(2008: 36◦ 53 58.68 N, 119◦ 48 08.89 W; 2009: 36◦ 54 26.91 N, 119◦ 48 31.34 W). Soils in the experimental areas (classified primarily as Ramona Sandy Loam) possessed the following characteristics: 63.3% sand, 27.14% silt, 9.57% clay, 0.73% organic matter, and 6.93 pH (from an average of 7 samples). In each experiment, we used S. carpocapsae formulated product containing 250 million IJs (supplied by Becker Underwood, Ames, IA), which had been shipped chilled in a plastic tub. The product was stored for no longer than 1 month at 8 ◦ C until used in the experiments. The day of application, nematodes were mixed with water in buckets and viability was confirmed by their movement under a dissecting microscope. Before application, plots were irrigated for several hours. Nematodes were applied through the irrigation system at a rate of 12.5 × 104 × m−1 and their viability re-confirmed following passage through the microsprinklers. Microsprinklers deposited nematodes onto a berm, a raised area extending 91–121 cm from the pistachio tree trunks, which is free of vegetation but often contains moss, decomposing nuts and leaves. Since the microsprinklers’ range did not extend into the areas between tree rows, the local rate of application on the berm was approximately 25 IJs cm−2 . Experimental design The 2008 orchard measured 31.8 ha while the 2009 orchard measured 19 ha. Rows of trees were separated by drive lanes approximately 6 m wide containing weeds that were mowed each season. Within each orchard, we randomly chose seven pairs of rows and sampled five trees in each row. We randomly designated one tree in each row pair as a control, plugging its microsprinkler while nematodes were applied. We removed the plugs after ∼3 h, which gave the pulse of nematodes time to clear from the irrigation system. All trees were then irrigated for an extra ∼4 h to offset the extra water that treatment trees received. Soil sampling dates for each year were March 10, March 19, April 2, April 16 and May 21, which corresponded to 2 days before S. carpocapsae application and 1, 3, 5, and 10 weeks after. For each date we sampled soil under 70 trees within the orchard (35 treatments, 35 controls) using different methods (outlined below) for EPN isolations and measurement of arthropod communities. All soil samples were placed in a chilled cooler for transport back to the laboratory and stored at 10 ◦ C until processing. Soil properties

1. If S. carpocapsae IJs are eaten by predatory arthropod species, these arthropods’ abundance/activity should increase in treated areas and be negatively correlated with nematode persistence. 2. If S. carpocapsae IJs parasitize some arthropod species, host species abundance/activity should decrease in treated areas and be positively correlated with nematode persistence. 3. If adding S. carpocapsae IJs represents an ecological disturbance, species diversity, richness, and evenness values may be negatively affected in treated areas. 4. If orchard microsites with low diversity are more susceptible to biological disturbance, S. carpocapsae application should have stronger effects in those areas.

For all sample time-points, we measured gravimetric soil water content on ∼40 g soil as the percent of oven dry soil after 24 h at 105 ◦ C (Black 1965). Using samples from week 10, we measured the electrical conductivity (EC) of soil under each tree using a Hi 255 combination pH/mV electrode and EC/TDS/NaCl Meter (Hanna Instruments Woonsocket, RI). To test if sand content was related to EPN persistence, we also measured particle size on 8 representative trees from each year where EPNs persisted for varying times (0–70 days). The total sand content of each sample was split into five particle size categories (very coarse sand ≥ 1.000 mm; 1.000 mm > coarse sand ≥ 0.500 mm; 0.500 mm > medium sand ≥ 0.250 mm; 0.250 mm > fine sand ≥ 0.106 mm; 0.106 mm < very fine sand ≥ 0.053 mm) using a sieve-shaker apparatus (Ro-Tap® , model RX-29, W.S. TYLER, OH).

Methods

S. carpocapsae re-isolation and identification

Nematode application

To determine if S. carpocapsae persisted in the orchards, soil samples were taken from the 70 trees immediately after application and at the aforementioned time-points. We also took soil samples 2 days before application to survey for native EPNs. For EPN isolation, we used a spade to sample an area 15 × 15 cm × 3 cm

We conducted two field experiments at the commercially managed S & J ranch in Madera County, California. The field experiments were done in different years in separate pistachio orchards

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

deep on either side of each tree (20 cm from the microsprinklers) for a total of 2 subsamples per tree, cleaning the spade between samples. Since previous surveys of the area discovered no endemic Steinernema, the field sampling depth was optimized to recover S. carpocapsae IJs that forage for hosts on the soil surface, often standing upright on their tails (Lewis et al. 2006). In the laboratory, soil was gently mixed and 250 cm3 divided into two large (14 cm × 2 cm) Petri dishes. The Galleria-bait technique was used to isolate EPNs (Bedding and Akhurst 1975). Briefly, five Galleria mellonella L. larvae were added to each dish, the soil was moistened as needed, and the lid of the dish secured with two pieces of label tape. After 1 week, dead larvae were placed on emergence traps (White 1927) and the presence of EPNs confirmed by infecting other G. mellonella with the emerging IJs. To further confirm that the EPN species isolated was S. carpocapsae, we compared the molecular restriction profiles of a subsample of isolates to predicted patterns and known S. carpocapsae positive controls. S. carpocapsae identification DNA extractions and PCR conditions followed Nadler et al. (2000); the ITS-1 and ITS-2 regions of ribosomal DNA were amplified using 18S and 28S primers (no. 93, 5 TTGAACCGGGTAAAAGTCG and no. 94, 5 TTAGTTTCTTTTCCTCCGCT). A 2 ␮l aliquot of the 25 ␮l amplification product was subjected to agarose gel electrophoresis to confirm product size (approximately 860 base pairs). Amplification products were digested with restriction endonucleases following the manufacturer’s instructions using 5 ␮l PCR product in a 25 ␮l reaction (enzymes Alu I, Dde I, and Sau 3AI, Promega: Madison, WI). Restriction enzymes were selected to maximize different banding patterns between S. carpocapsae and S. feltiae, and S. kraussei, which might also be found in the soil samples (Stock et al. 1999). Ten microliters of the digest was loaded on a 1.8% agarose gel and electrophoresed on a large Fisher biotech electrophoresis system (model FB-DB-2025) in 1× TBE at 100 V for 5 h. Restriction fragments were visualized by GelRed stain (Biotium, Hayward, CA) and the restriction profiles were compared to the profiles of known isolates and restriction digest patterns generated from GenBank sequences. Arthropod communities To measure soil-dwelling arthropod populations, 2 samples were taken per tree with a 7.62 cm diameter soil auger to 12.7 cm depth at random locations approximately 100 cm from the trunk. Soil arthropods were extracted within 10 days of collection in two samples of 80 ml each for each time-point using a modified Berlese–Tullgren funnel at 10 ◦ C. The apparatus consisted of 240 ml plastic funnels (10 cm diameter) supported in 950 ml glass jars under 20 W bulbs with heat reflectors. Each sample was placed in a plastic sleeve and set on a screen (6.35 mm) inside each funnel. Below each funnel, arthropods were collected in 20 ml glass vials containing 70% ethanol. After 3 days, when the soil was completely dry, vials were removed. Recovered arthropods were preserved in 70% ethanol and identified to family or genus. To measure surface arthropods, pitfall traps were placed on the south side berm of each tree. We interpreted pitfall catches as either due to changes in local density or activity since many biotic and abiotic factors can influence pitfall trap catches (Southwood and Henderson 2000). Each pitfall trap consisted of two, 448 ml plastic cups with a 9.6 cm diameter opening, with one set inside the other so that the inner cup could be easily emptied without disturbing the soil. Cups were buried at ground level and filled to 1/3 with propylene glycol. Preapplication samples were not collected but both treatment and control pitfall traps were emptied at each time-point starting 1 week after S. carpocapsae application. After collection,

53

specimens were stored in 70% ethanol. We first identified all specimens (except ants) to morphospecies, and then to genus or species. For week 10 pitfall traps, microarthropods were not counted due to extremely high densities (>5000) of Collembola. Insect identifications were confirmed by comparison with reference specimens at the UC Davis Bohart Museum of Entomology. Specimen vouchers for this project have also been deposited at the Bohart Museum. Data analysis We examined whether sand content, moisture, or individual arthropod species abundance was correlated with S. carpocapsae persistence using Spearman’s rank correlations. For an individual tree, persistence was measured as the maximum number of days after application that nematodes were isolated from soil. For arthropod species, we examined both the abundance under treated trees as well as neighboring paired control trees for possible correlations with persistence. We also examined whether population densities of each species of arthropod were correlated with soil moisture. ANOVAs were performed comparing soil moisture values by treatment for each tree at each time-point. Control trees with sprinkler systems that leaked or had positive re-isolations for EPNs were dropped from all analyses (5 in 2008, 12 in 2009). For soil arthropods, non-parametric statistics were used since ANOVA assumptions of normality were violated and could not be addressed by transformation. The data from both batches were pooled for each week, as there were no significant differences between extraction batches (and no significant interactions according to Wilcoxon signed-rank tests). For each taxonomic group, Wilcoxon signed-rank tests were performed at each time-point and Freidman’s repeated measures analysis was done on all groups accounting for more than 10% of the total soil arthropod abundance. For surface arthropods, abundance data was transformed by taking the square-root to meet assumptions of normality and analyzed using ANOVA. Those groups that were too scarce to meet assumptions of normality even after transformation were analyzed using Wilcoxon signed-rank test. We calculated Shannon diversity, richness, and evenness values for each sample (Shannon and Weaver 1949) and compared treatments using ANOVA. To describe the relationship between faunal diversity and the likelihood of disturbance by S. carpocapsae, we calculated the difference between paired treatment and control trees for each taxonomic group showing a significant response to S. carpocapsae addition. For each tree, we then correlated the magnitude of the response with the average diversity of both the treatment tree and its paired control using Spearman rank tests. If pre-samples were available (as was the case for soil dwelling arthropods), we measured the magnitude of the response before and after application and performed similar correlations. All analyses were performed using SAS 9.1 software (SAS Institute Inc., Cary, NC). Results Soil properties In both years, average soil moisture at week 1 was slightly higher under S. carpocapsae treated trees, which received extra irrigation during application (Fig. 1; P < 0.01, F(1,62) = 16.34, 2008; P = 0.02, F(1,56) = 5.32, 2009). While soils were relatively dry early in the season, moisture content tripled at weeks 5 and 10 in all treatment combinations as the orchards were irrigated. Until week 5, all groups of soil dwelling arthropods were positively correlated with soil moisture, but when moisture levels became higher this correlation disappeared. Electrical conductivity values were low in both years throughout the orchard (ranging from 47 to 651 ␮S cm−1 ) and there was no significant difference in EC between

54

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58 Table 2 Microarthropods recovered from pistachio orchards (using pitfall traps and soil extraction) and their responses to S. carpocapsae addition. Group Collembola Hypogastruridae spp. Isotomidae spp. Neelidae spp. Entomobryidae spp. Acari Prostigmata Anystidae spp. Tetranchidae (Bryobia spp.) Bdellidae spp. Rliagidiidae spp. Mesostigmata Laelapidae (Gaeolaeolaps spp.) Oribatida Oppiidae spp. Endeostigmata Nanorchestidae (Speleorchestes spp.)

Response – Increase – –

Increase – – – – – –

Arthropod communities

Fig. 1. Percentage soil moisture (determined gravimetrically) in the 2008 orchard (A) and 2009 orchard (B) both before (week 0) and in the weeks following S. carpocapsae application. Weeks marked with * had significant treatment effects. Bars are SEM.

treatment and controls. The 2009 orchard had significantly higher total % sand (P < 0.01, X¯ = 65.51%, 58.27%, F(1,14) = 17.5) and higher % medium sand than the 2008 orchard (P < 0.01, X¯ = 17.52%, 13.54%, F(1,14) = 17.8).

Microarthropods recovered from both pitfall traps and the soil spanned a range of taxonomic groups, with most showing no response to S. carpocapsae addition (Table 2). In the soil, the most commonly recovered groups were Collembola in the families Isotomidae and Hypogastruridae, and paleostomatid mites. While all groups were slightly correlated with soil water content until week 5, only the isotomids showed any variation with treatment. Isotomid collembola were significantly more abundant under treated Trees 1 week after application in 2008 (Fig. 2a; P < 0.01, Z = −2.92)

S. carpocapsae isolation and identification No native EPNs were recovered in either orchard during the preapplication sampling and no EPNs other than S. carpocapsae were found in subsequent samples. EPNs were isolated from 34 time-point samples in 2008 and 66 in 2009. From these isolates, a random selection of 20 samples was positively identified as S. carpocapsae since the restriction patterns matched expected patterns and those of S. carpocapsae positive controls. While S. carpocapsae was isolated from most samples immediately after application, the number of trees from which EPNs were isolated quickly decreased after the first week (Table 1), with no nematodes recovered after week 3 in 2008. Nematodes were isolated more frequently and persisted longer in the 2009 orchard. S. carpocapsae persistence (measured as days isolated since initial application) was not correlated with soil moisture, sand content, or overall insect diversity at week 1. However, persistence was postively correlated with pitfall catches of the tenebrionid beetle species, Nyctoporis cristata at week 1 in 2009 (P < 0.05, Spearman Rho = 0.54, df = 31). When the abundances of groups in neighboring control trees was also included, persistence was correlated with the abundance of Blapstinus discolor, a smaller (∼8 mm) tenebrionid beetle (P < 0.005, Spearman Rho = 0.58, df = 29). Table 1 Percentages of samples with S. carpocapsae recovered in both the 2008 and 2009 orchards at sampling times after the initial application. Time

0–3 h

1 week

3 weeks

5 weeks

10 weeks

% positive 2008 % positive 2009

71.4 80.0

8.6 37.1

5.7 14.2

0 2.9

0 2.9

Fig. 2. Isotomid collembolans recovered from (A) 2008 soil extractions and (B) 2009 pitfall traps before (week 0) and in the weeks after S. carpocapsae application. Significantly more isotomids were recovered from treated trees after 1 week using both methods (indicated by *). Bars are SEM.

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

but, after this, their numbers returned to levels comparable to control trees. No significant differences for any groups were observed in 2009. Repeated measures analysis showed that in both years the abundance of isotomid collembolans varied significantly over time (P < 0.01, F(4,319) = 10.25, 2008; P < 0.01, F(4,289) = 4.31, 2009). For all soil arthropod groups, abundances decreased sharply at weeks 5 and 10, regardless of treatment. In pitfall traps, the most common insects recovered were B. discolor and the introduced European earwig, Forficula auricularia. Two families of Collembola, the Entomobyridae and Hypogasturidae were also recovered in high densities (an average of 763 and 119 per trap, respectively). Shannon diversity values per trap ranged from 0.2 to 2, evenness from 0.1 to 0.7 and species richness from 9 to 22. When comparing treatments, we found no significant differences in diversity, richness or evenness values at any time-points in either year. Only 4 groups showed differences in abundance between treatments, with some increasing while others decreased in response to S. carpocapsae addition. A species of isotomid collembolan was more commonly caught in pitfall traps (in addition to being extracted from the soil) under treated trees at week 1 in 2009 (Fig. 2b; P = 0.03, Z = −1.88). In 2008, more predatory mites (families Bdellidae, Rhagiidae, Laelapidae, and Anystidae) were recovered under treated Trees 3 weeks after application (data not shown). The difference was only significant for those in the family Anystidae (most likely Anysitis agilis Grandjean), a red mite commonly observed running on the soil surface (P = 0.01, Z = −2.60). Anystid mites were also more commonly caught under treated trees in week 1, 2009 (Fig. 3; P = 0.02, Z = −2.43). Later in the season, Gnaphosid spiders, too, were caught more often under treated trees (Fig. 3; P = 0.04, F(1,63) = 4.04). Other groups decreased after treatment. F. auricularia, was significantly less common under treated trees at week 1, 2008 (Fig. 4; P = 0.04, F(1,58) = 4.11). B. discolor was also recovered less often under treated trees in week 5, 2009 (Fig. 4; P = 0.003, Z = 3.08). Of all these groups with significant treatment

55

effects, only B. discolor showed a relationship with diversity. As diversity in treated trees increased, the magnitude of the effect on B. discolor decreased (P < 0.05, Spearman Rho = −0.50, df = 21). Discussion S. carpocapsae persistence in both orchards was generally limited to days or a few weeks, decreasing rapidly after application. This was consistent with other studies showing that EPNs rarely become permanently established in the areas to which they are applied (Smits 1996; Campbell et al. 1998), although in some cases the nematodes may persist for several years after application (Parkman et al. 1993; Millar and Barbercheck 2001; Dillon et al. 2008). EPNs may fail to establish due to abiotic factors such as temperature, moisture, and soil type (Kaya 1990; Smits 1996). Additionally, sand content can influence nematode foraging efficacy (Kaspi et al. 2010; Kung et al. 1990; Portillo-Aguilar et al. 1999), and therefore, ability to persist. Our data support these findings, with S. carpocapsae persisting longer in the 2009 orchard with higher percentage sand. Persistence was not correlated with moisture, perhaps because as the season progressed, irrigation maintained high moisture levels. Biotic factors such as host availability and predation can also influence EPNs persistence (Kaya and Koppenhöer 1996). In our study, S. carpocapsae persistence was positively correlated with N. cristata and B. discolor abundance, perhaps because the larvae of these beetles are suitable hosts. Especially in 2009, where some S. carpocapsae persisted up to 10 weeks, recycling in the environment probably occurred at least occasionally. In contrast to other studies with Heterorhabditis megidis, S. carpocapsae persistence was not negatively correlated with the Shannon–Weaver diversity index (Chevalier and Webster 2006) and no individual groups were negatively correlated with S. carpocapsae persistence, suggesting predation was not the main mortality factor in this system.

Fig. 3. Average pitfall catches of predatory anysitid mites and gnaphosid spiders in the 2008 and 2009 orchards in the weeks after S. carpocapsae application. Weeks marked with * showed significant differences due to treatment (white = control, grey = S. carpocapsae addition). Bars are SEM.

56

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

Fig. 4. Average pitfall catches of B. discolor and Forficula aruicularia in the 2008 and 2009 orchards in the weeks after S. carpocapsae application. Weeks marked with * showed significant differences due to treatment (white = control, grey = S. carpocapsae addition). Bars are SEM.

We found several groups which increased with S. carpocapsae amendment and may prey on nematodes. The first group, isotomid collembolans, responded rapidly to application within the first week. Since rapid generation times of 5–6 days are reported within this family (Bandyopadhyaya and Choudhuri 2002; Park 2007) such a quick numerical response is possible, but these highly mobile collembolans may have also migrated to areas where S. carpocapsae were applied. Many species of isotomids will consume animal food (including nematodes and small enchytraeids) in the laboratory, (Chernova et al. 2007) and one species, Folsomia candida Willem, has been negatively correlated with nematode survival in microcosms (Kaneda and Kaneko 2008; Gilmore and Potter 1993). Chernova et al. (2007) also observed F. candida preying directly on nematodes and even recorded aggressive behavior between collembolans during feeding. Indeed, many species of collembolan previously thought to be mycophagous will eat nematodes in the laboratory, preferring them to fungus (Chernova et al. 2007; Lee and Widden 1996). This feeding preference varies with species (Chernova et al. 2007), which may explain why only one species of collembolan in the orchard responded to nematode addition, while three others did not. Unlike predatory mites, which actively search for prey, Isotomidae probably encountered the nematodes while foraging for fungi. Collembolans’ mode of feeding on nematodes actually resembles gathering rather than true predation since single nematodes are incapable of resistance (Chernova et al. 2007). The tendency of S. carpocapsae to stand on its tail for long periods likely facilitated opportunistic consumption by Isotomidae. Anysitid mites also increased in response to nematode addition, with activity peaking during the time period when S. carpocapsae were most commonly isolated. These fast running generalist predators forage in orchards and vineyards feeding on anything they are able to subdue and puncture (Sorensen et al. 1976). In artichoke fields, Goh and Lange (1989) observed anysitids actively searching for and consuming thrips, collembolans and nematodes, and

anysitids are cited as natural enemies in several orchard ecosystems (Cuthbertson and Murchie 2004; Solomon et al. 2000; El Banhawy 1997). In our experiment, the mites may have responded to nematodes directly and/or the nematodes may have caused increases in other anystid prey. The response curve’s shift in 2008 may reflect such indirect effects. Since anysitids are extremely mobile, the responses we observed are most likely due to increased foraging activity in nematode treated areas. The last group responding positively to S. carpocapsae addition was gnaphosid spiders. Unlike anysitids or isotomids, the response of gnaphosids was delayed with more caught under treated Trees 5 weeks after application. Even though juvenile spiders (measuring less than 5 mm) were commonly recovered in pitfall traps, given the delayed response, it unlikely that these small spiders consumed nematodes directly. In detrital-based food webs, there is evidence that gnaphosids can be indirectly affected by inputs at least two trophic links removed from them. For example, Chen and Wise (1999) found that resource addition increased numbers of collembolans, which increased food for gnaphosids, causing their densities to increase. Similarly, in our system, nematode addition may have indirectly affected gnaphosids by increasing numbers of their collembolan prey. However, we observed no correlations between population densities of collembola and gnaphosids to indicate this. Two insect species responded negatively to S. carpocapsae addition, a small tenebrionid beetle, B. discolor, and F. auricularia, or European earwig. Other Blapstinus species are associated with perennial crops such as grapes and peaches (Robinson 2005) and can be occasional pests in fig, cotton and melons (Coviello and Bentley 2006; Godfrey et al. 2005; Natwick et al. 2009). Blapstinus larvae, called false wire worms, feed on decaying organic material on the soil surface where they would be readily accessible to surface foraging S. carpocapsae. The nematodes could have infected larvae soon after application, decreasing the number of surviving adults

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

later in the season. Supporting this hypothesis is the observation that other tenebrionids, such as larvae of Tribolium confusum Duval, are also susceptible to S. carpocapsae (Athanassiou et al. 2010). Since the effect on F. auricularia occurred within the first week and then dissipated, S. carpocapsae could be infecting the adult earwigs in this case. While Nachtigall (1991) found that F. auricularia was not penetrated by S. carpocapsae in either the field or laboratory, our experiments indicate the nematodes can both penetrate and reproduce in this species (Hodson et al. 2011). For many groups, moisture affected abundance in the orchard, but probably had little interaction with treatment. While treatment trees were significantly wetter at week 1, this difference (of <1% soil moisture) was smaller than natural variation within the orchard measured before application. The additional moisture added with the treatment could have affected some taxa, but the nature of the treatment effects observed are consistent with the trophic mechanisms proposed. For example, while all groups of soil dwelling arthropods were correlated with moisture early in the season, the Isotomidae were the only group to show a response with treatment. S. carpocapsae did not typically affect sites with low diversity to a greater extent than sites with high diversity, and of all the taxonomic groups significantly affected by treatment, the abundance of only one, B. discolor, showed any relationship with diversity. As diversity increased under treated trees, the magnitude of the effect of S. carpocapsae on B. discolor decreased. This could be because under more diverse trees there were more hosts for S. carpocapsae to infect, reducing parasite pressure on B. discolor. Alternately, with increased diversity, there may have been more predators to dampen the nematode’s effect. Soil ecosystems are thought to be stable due to: the preponderance of weak interactions (De Ruiter et al. 1995), the inherent stability of donor controlled food webs (De Angelis 1992), the physical buffering nature of soil, and the attributes of individual species (Wardle 2002). In the pistachio orchard, species richness was less than half of that recorded for leaf litter invertebrates of native California woodlands (Sax 2002); however, the arthropod community was still resistant to disturbance by S. carpocapsae addition. Our results are in agreement with previous studies showing short term increases of collembola and predatory mites (Greenwood et al. 2011; Forschler and Gardner 1991) and similarly to others (Duncan et al. 2007; Chevalier and Webster 2006), we found that the effects of the applied nematodes were brief and varied with time and location. These results add to the growing evidence that EPNs, even when exotic species, do not cause dramatic unintended changes when added to soil ecosystems. On the contrary, our research indicates that the potential biological disturbance of S. carpocapsae introduction is mild and short lived. Acknowledgments This project was supported, in part, by a Robert van den Bosch Biological Control Scholarship, awarded to A. Hodson by the University of California. The authors wish to thank Larry Duncan and other anonymous reviewers for their comments, which improved this manuscript. Special thanks to Patricia Noble for field assistance, Melissa Friedman, Lily Wu, Daren Harris and Anna Kehl for laboratory assistance, and Fran Keller for assistance with insect identification. References Athanassiou, C.G., Kavallieratos, N.C., Menti, H., Karanastasi, E., 2010. Mortality of four stored product pests in stored wheat when exposed to doses of three entomopathogenic nematodes. J. Econ. Entomol. 103, 977–984. Bandyopadhyaya, I., Choudhuri, D.K., 2002. Laboratory observations on the biology of Xenylla welchi (Collembola: Hexapoda). Pedobiologia 46, 311–315.

57

Bathon, H., 1996. Impact of entomopathogenic nematodes on non-target hosts. Biocontrol Sci. Technol. 6, 421–434. Bedding, R.A., Akhurst, R.J., 1975. A simple technique for the detection of insect parasitic rhabditid nematodes in soil. Nematologica 21, 109–110. Bengtsson, J., Nilsson, S.G., Franc, A., Menozzi, P., 2000. Biodiversity, disturbances, ecosystem function and management of European forests. Forest Ecol. Manage. 132, 39–50. Bentley, W., Siegel, J.P., Holtz, B.A., Daane, K.M., 2008. Navel orangeworm (Amyelois transitella) (Walker) and obliquebanded leafroller (Choristoneura rosaceana) (Harris) as pests of pistachio. In: Ferguson, L.F., Beede, R.H., Haviland, D.H., Holtz, B.A., Kallsen, C.E., Sanden, B.L. (Eds.), Pistachio Production Manual., pp. 179–191. Black, C.A., 1965. Methods of Soil Analysis: Part I. Physical and Mineralogical Properties. American Society of Agronomy, Madison, WI. Boriss, H., 2005. Commodity Profile: Pistachios. UC Agricultural Issues Center, http://www.aic.ucdavis.edu/profiles/Pistachios-2005.pdf. Buck, M., Bathon, H., 1993. Effects of a field application of entomopathogenic nematodes (Heterorhabditis sp.) on the nontarget fauna. Part 2. Diptera. Anz. Schadlingskd. Pfl. 66, 84–88. Campbell, J.F., Lewis, E., Yoder, F., Gaugler, R., 1995. Entomopathogenic nematode (Heterorhabditidae and Steinernematidae) seasonal population dynamics and impact on insect populations in turfgrass. Biol. Control 5, 598–606. Campbell, J.F., Orza, G., Yoder, F., Lewis, E., Gaugler, R., 1998. Spatial and temporal distribution of endemic and released entomopathogenic nematode populations in turfgrass. Entomol. Exp. Appl. 86, 1–11. Chen, B.R., Wise, D.H., 1999. Bottom-up limitation of predaceous arthropods in a detritus-based terrestrial food web. Ecology 80, 761–772. Chernova, N.M.A.I., Bokova, E.V., Varshav, N.P., Goloshchapova, Y., Savenkova, Y., 2007. Zoophagy in collembola. Zool. Zh. 86, 899–911. Chevalier, R., Webster, J.M., 2006. Temporary changes in populations of soil organisms after field application of entomopathogenic nematodes. J. Nematol. 38, 466–473. Coviello, R.L., Bentley, W.J., 2006. UC IPM Pest Management Guidelines: Fig. UC ANR Publication 3447. Accessed on UC IPM website December 2010. http://www.ipm.ucdavis.edu/PMG/r261300711.html. Cuthbertson, A.G.S., Murchie, A.K., 2004. The phenology, oviposition and feeding rate of Anystis baccarum, a predatory mite in Bramley apple orchards in Northern Ireland. Exp. Appl. Acarol. 34, 367–373. De Angelis, D.L., 1992. Dynamics of Nutrient Cycling and Food Webs. Chapman and Hall, New York, NY. De Ruiter, P.C., Neutel, A.M., Moore, J.C., 1995. Energetics, patterns of interaction strengths, and stability in real ecosystems. Science 269, 1257–1260. Dillon, A.B., Rolston, A.N., Meade, C.V., Downes, M.J., Griffin, C.T., 2008. Establishment, persistence, and introgression of entomopathogenic nematodes in a forest ecosystem. Ecol. Appl. 18, 735–747. Duncan, L.W., Graham, J.H., Zellers, J., Bright, D., Dunn, D.C., El-Borai, F.E., Porazinska, D.L., 2007. Food web responses to augmenting the entomopathogenic nematodes in bare and animal manure-mulched soil. J. Nematol. 39, 176–189. Ekmen, Z.I., Hazir, S., Cakmak, I., Ozer, N., Karagoz, M., Kaya, H.K., 2010. Potential negative effects on biological control by Sancassania polyphyllae (Acari: Acaridae) on an entomopathogenic nematode species. Biol. Control 54, 166–171. El Banhawy, E.M., 1997. Survey of predacious mites on citrus in South Africa. Specific diversity, geographic distribution and the abundance of predacious mites. Anz. Schadlingskd. Pfl. 70, 136–141. Epsky, N.D., Walter, D.E., Capinera, J.L., 1988. Potential role of nematophagous microarthropods as biotic mortality factors of entomgenous nemtoades (Rhabditida: Steinernatmatidae, Heterorhabditidae). J. Econ. Entomol. 81, 821–825. Forschler, B.T., Gardner, W.A., 1991. Field efficacy and persistence of entomogenous nematodes in the management of white grubs (Coleoptera: Scarabaeidae) in turf and pasture. J. Econ. Entomol. 84, 1454–1459. Georgis, R., Kaya, H.K., Gaugler, R., 1991. Effect of Steinernematid and Heterorhabditid nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) on nontarget arthropods. Environ. Entomol. 20, 814–822. Gilmore, S.K., Potter, D.A., 1993. Potential role of collembola as biotic mortality agents for entomopathogenic nematodes. Pedobiologia 37, 30–38. Godfrey, L.D., Goodell, P.B., Natwick, E.T., Haviland, D.R., 2005. UC IPM Pest Management Guidelines: Cotton. UC ANR Publication 3444. Accessed on UC IPM website Dec. 2010. http://www.ipm.ucdavis.edu/PMG/r114302011.html. Goh, K.S., Lange, W.H., 1989. Microarthropods associated with insecticide-treated and untreated artichoke fields in California. J. Econ. Entomol. 82, 621–625. Greenwood, C.M., Barbercheck, M.E., Brownie, C., 2011. Short term response of soil microinvertebrates to application of entomopathogenic nematode-infected insects in two tillage systems. Pedobiologia 54, 177–186. Hodson, A.K., Friedman, M.L., Wu, L.N., Lewis, E.E., 2011. European earwig (Forficula auricularia) as a novel host for the entomopathogenic nematode Steinernema carpocapsae. J. Invertebr. Pathol. 107, 60–64. Isaacson, P.J., Webster, J.M., 2002. Antimicrobial activity of Xenorhabdus sp. RIO (Enterobacteriaceae), symbiont of the entomopathogenic nematode, Steinernema riobrave (Rhabditida: Steinernematidae). J. Invertebr. Pathol. 79, 146–153. Kaneda, S., Kaneko, N., 2008. Collembolans feeding on soil affect carbon and nitrogen mineralization by their influence on microbial and nematode activities. Biol. Fert. Soils 44, 435–442. Kaspi, R., Ross, A., Hodson, A.K., Stevens, G.N., Kaya, H.K., Lewis, E.E., 2010. Foraging efficacy of the entomopathogenic nematode Steinernema riobrave in different soil types from California citrus groves. Appl. Soil Ecol. 45, 243–253.

58

A.K. Hodson et al. / Pedobiologia 55 (2012) 51–58

Kaya, H.K., 1990. Soil ecology. In: Gaugler, R., Kaya, H.K. (Eds.), Entomopathogenic Nematodes in Biological Control. CRC, Boca Raton, FL, pp. 93–115. Kaya, H.K., Koppenhöer, A.M., 1996. Effects of microbial and other antagonistic organism and competition on entomopathogenic nematodes. Biocontrol Sci. Technol. 6, 357–371. Koch, U., Bathon, H., 1993. Results of the outdoor application of entomopathogenic nematodes on nonobjective fauna-I Coleoptera. Anz. Schadlingskd. Pfl. 66, 65–68. Kung, S.P., Gaugler, R., Kaya, H.K., 1990. Soil type and entomopathogenic nematode persistence. J. Invertebr. Pathol. 55, 401–406. Lacey, L.A., Shapiro-Ilan, D.I., 2008. Microbial control of insect pests in temperate orchard systems: potential for incorporation into IPM. Annu. Rev. Entomol. 53, 121–144. Lee, Q., Widden, P., 1996. Folsomia candida, a “fungivorous collembolan”, feeds preferentially on nematodes rather than soil fungi. Soil Biol. Biochem. 28, 689– 690. Lewis, E.E., Campbell, J., Griffin, C., Kaya, H., Peters, A., 2006. Behavioral ecology of entomopathogenic nematodes. Biol. Control 38, 66–79. Millar, L.C., Barbercheck, M.E., 2001. Interaction between endemic and introduced entomopathogenic nematodes in conventional-till and no-till corn. Biol. Control 22, 235–245. Nachtigall, G., 1991. Cited in Bathon 1996. Untersuchungen zur Bekampfung kryptisch lebender Insekten mit entomopathogenen nematoden unter desonderer Berucksichtigung von Synanthedon myopaeformis Borkh. (Lep., Sesiidae). Dissertation, Technische Hochschule Darmstadt, Germany. Nadler, S.A., Adams, B.J., Lyons, E.T., DeLong, R.L., Melin, S.R., 2000. Molecular and morphometric evidence for separate species of Uncinaria (Nematoda: Ancylostomatidae) in California sea lions and northern fur seals: hypothesis testing supplants verification. J. Parasitol. 86, 1099–1106. Natwick, E.T., Stapleton, J.J., Stoddard, C.S., 2009. UC IPM Pest Management Guidelines: Cucurbits. UC ANR Publication 3445. Accessed on UC IPM website December 2010. http://www.ipm.ucdavis.edu/PMG/r116301711. html. Park, E.-K., 2007. Effect of laboratory culture conditions on population growth of Proisotoma minuta (Tullberg) (Collembola: Isotomidae). Entomol. Sci. 10, 135–140. Parkman, J.P., Frank, J.H., Nguyen, K.B., Smart, G.C., 1993. Dispersal of Steinernema scapterisci. (Rhabditida: Steinernematidae) after inoculative applications for mole cricket (Orthoptera: Gryllotalpidae) control in pastures. Biol. Control 3, 226–232. Portillo-Aguilar, C., Villani, M.G., Tauber, M.J., Tauber, C.A., Nyrop, J.P., 1999. Entomopathogenic nematode (Rhabditida: Heterorhabditidae and Steinernematidae) response to soil texture and bulk density. Environ. Entomol. 28, 1021–1035.

Postma-Blaauw, M.B., de Goede, R.G.M., Bloem, J., Faber, J.H., Brussaard, L., 2010. Soil biota community structure and abundance under agricultural intensification and extensification. Ecology (Washington, DC) 91, 460–473. Robinson, W.H., 2005. Handbook of Urban Insects and Arachnids. Cambridge University Press, Cambridge. Sax, D.F., 2002. Equal diversity in disparate species assemblages: a comparison of native and exotic woodlands in California. Global Ecol. Biogeogr. 11, 49–57. Shannon, C.E., Weaver, W., 1949. The Mathematical Theory of Communication. University of Illinois Press, Urbana. Siegel, J., Lacey, L.A., Fritts, R., Higbee, B.S., Noble, P., 2004. Use of steinernematid nematodes for post harvest control of navel orangeworm (Lepidoptera: Pyralidae, Amyelois transitella) in fallen pistachios. Biol. Control 30, 410–417. Siegel, J.P., Lacey, L.A., Higbee, B.S., Noble, P., Fritts Jr., R., 2006. Effect of application rates and abiotic factors on Steinernema carpocapsae for control of overwintering navel orangeworm (Lepidoptera: Pyralidae, Amyelois transitella) in pistachios. Biol. Control 36, 324–330. Smits, P.H., 1996. Post-application persistence of entomopathogenic nematodes. Biocontrol. Sci. Technol. 6, 379–387. Solomon, M.G., Cross, J.V., Fitz Gerald, J.D., Campbell, C.A.M., Jolly, R.L., Olszak, R.W., Niemczyk, E., Vogt, H., 2000. Biocontrol of pests of apples and pears in northern and central Europe. 3. Predators. Biocontrol. Sci. Technol. 10, 91–128. Sorensen, J.T., Kinn, D.N., Doutt, R.L., Cate, J.R., 1976. Biology of the mite, Anystis agilis (Acari: Anystidae): a California vineyard predator. Ann. Entomol. Soc. Am. 69, 905–910. Southwood, T.R.E., Henderson, P.A., 2000. Ecological Methods, 3rd ed. Blackwell Science, London–New York. Starrs, P.F., Goin, P., 2010. Field Guide to California Agriculture. University of California Press, 504 pp. Stock, S.P., Pryor, B.M., Kaya, H.K., 1999. Distribution of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) in natural habitats in California, USA. Biodivers. Conserv. 8, 535–549. Walter, D.E., Ikonen, E.K., 1989. Species, guilds, and functional-groups-taxonomy and behavior in nematophagous arthropods. J. Nematol. 21, 315–327. Wardle, D.A., Yeates, G.W., Watson, R.N., Nicholson, K.S., 1995. The detritus foodweb and the diversity of soil fauna as indications of disturbance regimes in agroecosystems. Plant Soil 170, 35–43. Wardle, D.A., 2002. Communities and Ecosystems: Linking the Aboveground and Belowground Components. Monographs in Population Biology, vol. 31, Princeton University Press, New Jersey. White, G.F., 1927. A method for obtaining infective nematode larvae from cultures. Science 66, 302–303. Zalom, F.G., Barnett, W.W., Weakley, C.V., 1984. Efficacy of winter sanitation for managing the navel orangeworm, Paramyelois transitella (Walker), in California almond orchards. Prot. Ecol. 7, 37–41.