Ecological preferences of Metarhizium spp. from Russia and neighboring territories and their activity against Colorado potato beetle larvae

Accepted Manuscript Ecological preferences of Metarhizium spp. from Russia and neighboring territories and their activity against Colorado potato beetle larvae Vadim Kryukov, Olga Yaroslavtseva, Maksim Tyurin, Yuriy Akhanaev, Evgeniy Elisaphenko, Ting-Chi Wen, Oksana Tomilova, Yuri Tokarev, Viktor Glupov PII: DOI: Reference:

S0022-2011(17)30190-8 http://dx.doi.org/10.1016/j.jip.2017.07.001 YJIPA 6969

To appear in:

Journal of Invertebrate Pathology

Received Date: Revised Date: Accepted Date:

12 April 2017 28 June 2017 6 July 2017

Please cite this article as: Kryukov, V., Yaroslavtseva, O., Tyurin, M., Akhanaev, Y., Elisaphenko, E., Wen, T-C., Tomilova, O., Tokarev, Y., Glupov, V., Ecological preferences of Metarhizium spp. from Russia and neighboring territories and their activity against Colorado potato beetle larvae, Journal of Invertebrate Pathology (2017), doi: http://dx.doi.org/10.1016/j.jip.2017.07.001

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Ecological preferences of Metarhizium spp. from Russia and neighboring territories and their activity against Colorado potato beetle larvae

Vadim Kryukova*, Olga Yaroslavtsevaa, Maksim Tyurina, Yuriy Akhanaeva, Evgeniy Elisaphenkob, Ting-Chi Wenc, Oksana Tomilovaa, Yuri Tokarevd, Viktor Glupova

a

Institute of Systematics and Ecology of Animals SB RAS, Novosibirsk, 630091, Russia

b

Institute of Cytology and Genetics SB RAS, Novosibirsk, 630090, Russia

c

Engineering Research Center of Southwest BioPharmaceutical Resources, Ministry of

Education, Guizhou University, Guiyang, 550025, Guizhou, China d

All-Russia Institute of Plant Protection, St. Petersburg - Pushkin, 196608, Russia

*

corresponding author

Vadim Kryukov* – [email protected] Olga Yaroslavtseva – [email protected] Maksim Tyurin – [email protected] Yuriy Akhanaev – [email protected] Evgeniy Elisaphenko – [email protected] Ting-Chi Wen – [email protected] Oksana Tomilova - [email protected] Yuri Tokarev - [email protected] Viktor Glupov – [email protected]

1

Abstract Thirty-four isolates of Metarhizium spp. from Russian collections were genotyped using 5' EF-1α gene sequence analysis. Four species were identified, of which M. robertsii and M. brunneum were the most frequent, whereas M. anisopliae and M. pemphigum were sporadic. Radial growth studies in the temperature range of 10–40 °C revealed that growth at high temperatures (35–37.5 °C) was inherent for M. robertsii isolates but not for M. brunneum isolates. In contrast, M. brunneum isolates were more active at cold temperatures (10 °C) compared to M. robertsii. Virulence was evaluated against larvae of the Colorado potato beetle (CPB), Leptinotarsa decemlineata Say, under two regimes: humid (21 °C, 80 % relative humidity (RH)) and arid (31 °C, 55 % RH). M. brunneum isolates were less virulent compared to M. robertsii under both regimes. M. robertsii activity did not differ under the two regimes, but M. brunneum was less virulent under the arid regime compared to the humid one. A field experiment under natural conditions (steppe zone of Western Siberia) with daily ranges of 10–43 °C and 13–98 % RH showed that M. robertsii was significantly more active than M. brunneum against CPB larvae.

Keywords entomopathogenic fungi; continental climate; Leptinotarsa decemlineata; thermotolerance; cryptic species; biocontrol

2

1. Introduction Fungi of the genus Metarhizium parasitize a broad range of arthropods and are used as biocontrol agents against plant-feeding and blood-sucking arthropods. More than fourteen products with high activity against target insects and showing high levels of tolerance to environmental factors (high temperature, solar radiation and low humidity) have been developed on the basis of Metarhizium spp. strains (Lomer, 2001; Faria and Wraight, 2007; Aw and Hue, 2017). Species of the Metarhizium genus are common among soil-inhabiting microorganisms in different regions of the world (Zimmermann, 2007). During the last decade, the application of molecular methods has led to significant taxonomical revisions within the genus. The recent classifications are based on a multilocus phylogeny (Bischoff et al., 2006, 2009; Kepler et al., 2014), and the intron-rich 5´ portion of translation elongation factor-1 alpha (5´-TEF) is the most informative region for species identification. It was revealed that the predominant species complex M. anisopliae sensu lato includes several cryptic species that have weak morphological differences (Bischoff et al., 2009). However, it was shown that these species differ in some ecological characteristics, particularly habitat type, specific associations with plant rhizosphere and hygrothermal preferences (Bidocka et al., 2001, 2005; Wyrebek et al., 2011; Fisher et al., 2011; Wyrebek and Bidochka, 2013; Nishi et al., 2013). Knowledge about the Metarhizium species in Russia and neighboring territories is particularly scarce. In previous works (Koval, 1974; Ogarkov and Ogarkova, 2000; Serebrov et al., 2007; Polovinko et al., 2010 and others), M. anisopliae sensu lato was found in different territories of Russia, but molecular identification of the species was not performed. In addition, the ecological preferences of Metarhizium species from this area were not studied. However, this knowledge is necessary to reveal biogeographical patterns and to identify strains for biological control product development. Any differences between cryptic species in efficacy against certain insect pests have been poorly studied. This efficacy may be determined by a complex of virulence factors and adaptations of the fungus to the habitat of the target insect. One economically important species 3

broadly used for study of insect diseases is the Colorado potato beetle (CPB), Leptinotarsa decemlineata Say. The species is the main pest of potato in Eurasia and North America. Dramatic loss of harvest and the rapid formation of resistance to the main groups of insecticides (e.g., Scott et al., 2015) have stimulated the development of biological methods for pest control (Wraight and Ramos, 2002, 2005, 2015, 2017; Wraight et al., 2007) including the use of Metarhizium species (Kryukov et al., 2009; Tomilova et al., 2016; Yaroslavtseva et al., 2017). However, which taxa of Metarhizium are better adapted to CPB larvae, and their habitat remains unknown. Because potato fields are sun-opened habitats, Metarhizium species and isolates should be screened for tolerance to high temperature as well as for virulence against CPB larvae under arid conditions. Such parameters are particularly important in continental regions (e.g., in Siberia) where the temperature of potato fields rises above 40 °C during the period of larval foraging. In recent studies, we identified a few isolates of cryptic M. brunneum and M. robertsii species from continental regions of Russia (Tyurin et al., 2016; Kryukov et al., 2017). It is known that these are common species in temperate zones of Eurasia and North America (Nishi et al., 2011; Steinwender et al., 2014; Kepler et al., 2015; Rehner and Kepler, 2017). It was revealed that the species have different ecological preferences (e.g., habitat association, UV tolerance, temperature preferences) in certain regions such as Canada and Japan (Bidocka et al., 2001; Wyrebek et al., 2011; Nishi et al., 2013). Certain isolates of both species have successfully infected and killed CPB larvae under laboratory conditions at room temperature (Tyurin et al., 2016). However, their virulence has not been estimated under different hygrothermal regimes or under field conditions. We hypothesized that M. brunneum and M. robertsii isolates will differ in their ecological preferences and in activity against CPB larvae under various microclimatic conditions. In this study, we identified Metarhizium isolates from Russia and neighboring territories on the basis of 5´-TEF region sequences. We analyzed their temperature preferences and virulence towards CPB larvae under various hygrothermal regimes in order to identify the taxa that are most active in the continental climate of Siberia. 4

2. Materials and methods

2.1 Fungal cultures

We used 34 Metarhizium isolates from different regions of Russia, Kazakhstan, Latvia and Ukraine, as well as from Northern Iran (Table 1). Cultures were stored in a water-glycerol solution (10 %) frozen at 80 °C. For insect inoculation, fungal conidia were inoculated into Sabouraud dextrose agar with yeast extract (2.5 g/L) (SDAY) in 90 mm Petri dishes. Fungi were cultivated for 14 days at 27 °C in the dark and then scraped off and vortexed 5 min in distilled water containing Tween 20 (0.03 %). The suspensions containing clumps of conidia were sonicated and desilted for 40 min, followed by the uptake of the central layer. Conidia concentrations were determined using a hemocytometer.

2.2 Identification of strains

Fungal mycelia were incubated in Czapek Dox broth with peptone (0.4 %) at 130 rpm and 27 °C on a shaking platform for 6-7 days. The mycelia were centrifuged at 10,000 g and lysed by liquid nitrogen. Total genomic DNA was extracted using DNAeasy Plant Mini Kits (QIAGEN) according to the manufacturer’s protocol. The most informative DNA region, 5' EF-1α, was used as a marker (Bischoff et al., 2009) and amplified with the following primers: EF1T (5' TGGGTAAGGARGACAAGAC 3') and EF2T (5' GGAAGTACCAGTGATCATGTT 3'), which were synthesized by BIOSSET Ltd. The expected PCR product size was approximately 650 bp. PCR was performed in a total volume of 25 μl containing standard PCR buffer, 2.5 mM MgCl2, 10 mM (NH4)2SO4, 0.2 mM each dNTP, 5 pmol of each primer, 50 ng of DNA template and 1.25 U of Taq DNA Polymerase (SibEnzyme Ltd). PCR cycling was performed on a BIS thermocycler 5

for 5 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 40 s at 52 °C and 1 min at 72 °C, with a final extension of 5 min at 72 °C. All PCR products were confirmed by 1 % agarose gel electrophoresis. The PCR products were purified from the agarose gel using a QIAquick Gel Extraction Kit (QIAGEN) according to the manufacturer’s protocol. The concentration of DNA was determined using a spectrophotometer (NanoDrop ND-1000, Labtech). One sequencing reaction contained 5 pmol of primer, 0.5 mkl of BigDye™ Dideoxy Terminators version 3.1, 0.20.5 μg of purified PCR product, 10 × sequencing buffer (Applied Biosystems) and water up to 10 μl. The sequencing reaction was performed in a BIS thermocycler for 5 min at 95 °C, followed by 50 cycles of 30 s at 95 °C, 30 s at 52 °C, and 4 min at 60 °C. DNA sequences were analyzed using an automated sequencer (ABI PRISM 37) at the SB RAS Genomics Core Facility (Novosibirsk) according to the protocol for the ABI PRISM BigDyeTM Terminator Cycler Sequencing Ready Reaction Kit (Applied Biosystems, PerkinElmer Corporation). The obtained 5' EF-1α gene sequences were compared against GenBankavailable

sequences

using

the

built-in

Basic

Local

Alignment

Search

Tool

(https://blast.ncbi.nlm.nih.gov/Blast.cgi) and BioEdit software (Hall, 1999). As there were no unique sequences among the newly revealed isolates, only the reference sequences downloaded from GenBank (Table S1) were used for phylogenetic reconstruction. Indel positions and ambiguous sites were stripped, resulting in an alignment that was 623 bp long. The maximum likelihood method was employed based on the Tamura-Nei model (Tamura and Nei, 1993) using MEGA 7 software (Kumar et al., 2016).

2.3 Temperature preferences

Fungal temperature preferences were determined by the radial growth technique. Plugs, 8 mm in diameter, were cut from 4-day-old cultures, plated on SDAY medium in the center of 90 mm Petri dishes and incubated at different temperatures (10, 15, 20, 25, 30, 35, 37.5 and 40 °C), 6

followed by measurements of colony diameter 12 days after culture initiation (as the fastestgrowing colonies reached the margins of the Petri dish by that time). The measurements of the colonies were made crosswise with an accuracy of up to 0.5 mm. To level out individual differences in growth rate, we used the relative growth parameter (relative growth): = (a – d) / (b – d) × 100 %, where a is the colony diameter at a certain temperature (mm), b is the colony diameter at the temperature optimum (mm), and d is the diameter of the blocks (mm). All experiments were performed in triplicate.

2.4 Laboratory bioassays

Experiments were performed using IV instar CPB larvae (6–12 h after molting) collected from potato fields in the Novosibirsk region (N 53°44' E 77°39'). The insects were treated by immersion in a suspension of conidia (2 × 106 conidia ml-1) in 0.03 % Tween 20 solution for 10 s and were then placed in ventilated 350 ml plastic containers (10 larvae per container). The control larvae were immersed in 0.03 % Tween 20 solution devoid of conidia. Larvae were fed potato leaves (5-8 g per container daily) with petioles inserted into 2.5 ml tubes filled with water and plugged with cotton wool. Both control and treated insects were maintained in thermostatic rooms either at 21 °C or 31 °C. The relative humidity (RH) in the containers was measured by loggers (DS1923-F5, Maxim Semiconductor, USA) every 30 min during the 12 days of the experiment. The average RH was 80 ± 2 % under 21 °C (referred to as “humid regime”) and 55 ± 3 % under 31 °C (referred to as “arid regime”). Insect mortality was assessed every 24 h for 12 days. Treatments were performed in triplicate with 10 larvae in each replicate. Two parameters were used to estimate differences in insect susceptibility to fungal isolates in these regimes: 1) the percent mortality over 12 days, and 2) the median lethal time (LT 50).

2.5 Field bioassay 7

Ten M. robertsii isolates (Ap-1, MB-1, P-72, S-Ir-07, Mak-3, Mak-4, Mak-6, EK-1, UK-7, PA) and ten M. brunneum isolates (Ram-1, Mali, LV-17, GV-1, Q-1, Q-2, Q-5, Q-6, Q-9, Q-10) were randomly selected for field bioassays. Experiments were conducted in the steppe zone of Western Siberia (N 53°43', E 77°51') under the natural daily range of temperature and humidity specific to the continental climate (see below). Larvae were placed in cages (15 individuals per cage) tied to potato stalks that were 30-35 cm in length. The treatment was performed using handheld sprayers in the evening (between 7-9 p.m.) using 10 ml of the suspension (1 × 108 conidia ml-1) per stalk with larvae. Control stalks were sprayed with water-Tween solution. Insect mortality was assessed for 13 days. The microclimate conditions were monitored every 30 min by loggers (see above) inserted into the cages. During the first 9 days post treatment, the daily range in relative humidity was 13–98 % (mean ± SD = 58 ± 26 %), and the variation in temperature was 10–43 °С (mean ± SD = 24 ± 10 °С) (ESM Fig. S1). The level of UV A+B at noon (12 p.m.) was 3.9 ± 0.4 mwt/cm2 in the field and 2.1 ± 0.2 mwt/cm2 inside the cages. At 10-13 days post treatment, the weather was rainy (Fig. S1). All treatments were performed in three simultaneous replicates, each using 15 larvae.

2.6 Statistical analyses

Data analyses were performed using Statistica 8 (StatSoft Inc., USA) and SigmaStat 3.1 (Systat Software Inc., USA). The Fisher exact test was used to compare the ratio between fungal cultures isolated from sun-opened habitats or forests. Data on fungal growth and insect survival were checked for normality distribution using the Shapiro-Wilk W test, and a non-parametric analysis was applied for abnormally distributed data. Two-way ANOVA (analysis of variance) followed by Tukey’s post hoc test was used to estimate differences in the radial growth of fungi. Virulence of fungi under different hygrothermal regimes was analyzed using a non-parametric 8

analogue of two-way ANOVA – the Scheirer-Ray-Hare test (Scheirer et al., 1976) with MannWhitney pairwise comparison followed by Bonferroni adjustment. To obtain equal sample sizes for this analysis, we randomly reduced the number of M. robertsii isolates. Kaplan-Meier survival analysis was used to estimate median lethal time (LT 50). On a daily basis, the Mann-Whitney test was used to analyze the field bioassay data. In all mentioned analyses, the species and conditions were set as categorical predictors (factors) and replicate average values as dependent variables.

3. Results

3.1 Isolate identification

Among the genotyped isolates, sequencing and phylogenetic placement of TEF sequences identified four species (Fig. 1). The most frequent were M. robertsii and M. brunneum, represented by 18 and 13 isolates, respectively. The least frequent were M. anisopliae (1 isolate) and M. pemphigum (2 isolates). Among the M. robertsii cultures, there were ten isolates (from the European part of Russia, Latvia, Siberia, and Kazakhstan) with a TEF gene molecular haplotype identical to that of ARSEF 727. Another group included five isolates from Siberia and Northern Iran with haplotypes identical to that of KVL13-07 from Denmark. Among the M. brunneum cultures genotyped using the TEF sequence, there were three phylogenetic lineages. The first was a group of seven isolates (European part of Russia, Siberia and Russian Far East) identical to isolate Hkd25-1 from Japan. The second group of five isolates from Siberia and Ukraine was identical to ARSEF 5198 from Germany. The third lineage was represented by a single culture from the Moscow region, Ram-1, with a TEF sequence identical to KVL 12-43 from Denmark. The TEF sequence of isolate Klp-96 was identical to reference sequences of M. anisopliae ARSEF 7487 from Africa (Eritrea) and ARSEF 6347 from South America (Columbia). Finally, two isolates, Mak-2 and MBB, belonged 9

to the M. pemphigum group of cultures. Their TEF sequences were identical to each other and to Hkd 35 2 from Japan. It should be noted that as many as 12 out of 18 (67 %) M. robertsii isolates were collected from sun-opened habitats (agro-landscapes, steppes and meadows) and that 6 isolates (33 %) were collected from forests (Table 1). However, preferences of sun-opened habitats by the species were not significant (φ = 1.5, P > 0.05). In contrast, 12 out of 13 (92 %) M. brunneum isolates originated from forested habitats (φ = 2.2, P < 0.05).

3.2 Temperature preferences

Significant differences in temperature preference were observed between M. brunneum and M. robertsii (interaction between effects of species and temperature: F6,203 = 32.0, P < 0.0001). The optimum temperature for the M. brunneum isolates was either 25 or 30 °C. (Fig. 2, Fig. S3). All M. brunneum cultures exhibited an absence of mycelial growth at high temperatures (35–40 °C) but actively developed at low temperatures of 10–20 °C. By contrast, M. robertsii cultures were able to grow at high temperatures (35–37.5 °C) but exhibited poor mycelial growth (2-fold drop compared to M. brunneum, Tukey’s HSD, P = 0.003) under cold conditions (10 °C). The optimum temperature for all cultures of M. robertsii was 30 °C (Fig. S2). Growth of all the cultures ceased when the temperature was under 40 °C. The optimal temperature for M. pemphigum growth was 25 °C, and this isolate was unable to grow at 35 °C and above (Fig. S4). The M. anisopliae isolate exhibited active and proportional growth at temperatures of 20–30 °C, was able to grow at 35 °C and was unable to grow at extreme temperatures such as 10 °C or 37.5–40 °C (Fig. S4).

3.3 Virulence under various hygrothermal regimes

10

The majority of M. robertsii and M. brunneum cultures exhibited decreased virulence under the arid regime compared to the humid one (effect of temperature for LT 50: H1,39 = 4.0, P = 0.05, and for total mortality level: H1,51 = 5.0, P = 0.02; Fig. 3). Moreover, the M. brunneum isolates were less virulent compared to M. robertsii under both regimes (effect of species for LT 50: H1,39 = 15.6, P < 0.0001, and for total mortality level: H1,51 = 17.6, P < 0.0001). Significant interactions between the effects of species and type of regime were not revealed (H < 0.8, P > 0.36). However, the M. robertsii isolates displayed no significant difference under the two regimes, whereas the virulence of the M. brunneum isolates significantly decreased under the arid conditions (Fig. 3a, b). Specifically, 1.5-fold prolongation of the LT50 under the arid regime was registered for M. brunneum infected insects (Z = 2.7, Bonferroni corrected P = 0.04), but prolongation was not observed for M. robertsii infected larvae (Z = 0.9, Bonferroni corrected P = 1.0, Fig 3a). The tendency for total insect mortality to decrease under arid conditions compared humid conditions was clearer for M. brunneum (1.32-fold, Z = 1.9, P = 0.06) than for M. robertsii (1.02-fold, Z = 1.5, P = 0.13; Fig 3b). M. robertsii was 1.4-1.8-fold more active than M. brunneum under arid regime (LT50: Z = 3.8, Bonferroni corrected P = 0.007; total mortality: Z = 3.8, Bonferroni corrected P < 0.0005), but only 1.1-1.2-fold more active under humid conditions (Z < 2.4, Bonferroni corrected P > 0.07). Thus, M. robertsii isolates demonstrated high virulence under arid conditions compared to M. brunneum. The M. anisopliae isolate showed high virulence under both regimes (LT 50: 5-6 days, total mortality: 100 %, Table S2). The culture of M. pemphigi was weakly active against CPB larvae: the total mortality was 17 ± 4.6 % and 43 ± 5.0 % under the arid and humid regimes, respectively (Table S2).

3.4 Field bioassay

11

As in the laboratory bioassays, M. robertsii isolates displayed significantly higher virulence against CPB larvae under field conditions compared to M. brunneum (Fig. 4, Table S3). The increase in median mortality rate was 19, 42, 64, 62 and 53 % at 5, 7, 9, 11 and 13 days post treatment, respectively (Z > 2.6, P < 0.01). The median total mortality over 13 days reached 93 % after M. robertsii treatment and only 40 % after treatment with M. brunneum (Z = 2.6, P = 0.008).

4. Discussion The work is an initial step in the study of biodiversity and ecology of Metarhizium fungi in the broad territory of Russia and neighboring regions. Genotyping of the isolates showed that they all possessed molecular haplotypes of TEF that were identical to those known from the global mycota. M. robertsii and M. brunneum were the most frequent among the sampled fungal species. These species are associated with various orders of insects and are widespread in the world, particularly in the temperate zone of the Holarctic region (Rehner and Kepler, 2017). In our study M. robertsii isolates were collected from both forests and sun-opened habitats (steppes, meadows and agro-landscapes), whereas M. brunneum isolates were predominantly collected from forested coenoses. These results are consistent with previous surveys (Wyrebek et al., 2011) in Ontario (Canada), where rhizosphere-associated M. robertsii was predominantly isolated from wildflowers and grasses, while M. brunneum came from shrubs and trees. The association of M. brunneum with forest biocoenoses was also observed in Japan (Nishi et al., 2011). On the other hand, Steinwender et al. (2014, 2015) showed that M. brunneum was the predominant species in agroecosystems of Denmark. Kepler and coauthors (2015) showed that both M. robertsii and M. brunneum inhabit agricultural landscapes of Maryland (USA), but they found significantly higher abundance and intraspecific diversity for M. robertsii as compared to M. brunneum. Interestingly, Keyser et al. (2015) revealed greater abundance of M. flavoviride than M. brunneum and M. robertsii in agricultural fields of Denmark. Thus, Metarhizium communities significantly differ among locations, and the patterns of habitat distribution of these species require further 12

investigation. Particularly, it will be valuable to compare habitat preferences of cryptic species in regions with maritime versus continental climate.

The temperature preferences of M. robertsii and M. brunneum corresponded to their original habitat. The isolates of M. robertsii were characterized by an optimal temperature of 30 °C and tolerance for high temperatures. By contrast, the M. brunneum isolates were not heat tolerant but were more active at low temperatures. Earlier, Bidochka and coauthors (2001, 2005) revealed that forest isolates of M. anisopliae sensu lato displayed activity at cold temperatures whereas isolates from agricultural habitats were characterized by heat tolerance. Subsequently, the first group of isolates was identified as M. brunneum and the second one as M. robertsii (Bischoff et al., 2009; Wyrebek et al., 2011). Nishi and coauthors (2013) showed that the rate of conidia germination was significantly higher in M. brunneum than in M. robertsii under cold conditions (7–11 °C), while M. robertsii conidia germinated more actively at 34–35 °C. Our study confirms that M. robertsii is heat tolerant and that M. brunneum is not a heat tolerant species.

Interestingly, M. brunneum was less virulent toward CPB larvae compared to M. robertsii under both humid and arid hygrothermal regimes. M. brunneum is most likely less adapted to killing this insect as the fungus and host evolved in different coenoses. Earlier, we showed in laboratory experiments that changes in defense reactions were similar whether CPB larvae were infected by M. brunneum (isolate Ram-1) or M. robertsii (isolates P-72 and Mak-1) (Tyurin et al., 2016). However, analysis of host immunity was not conducted using these groups of isolates. Further physiological studies using samples of isolates could clarify the differences in the virulence of these fungal species. In the present study, the activity of M robertsii was the same under the arid and humid regimes, whereas M. brunneum was significantly less virulent under the arid compared to humid conditions. This finding is in agreement with the temperature preferences of the cryptic species. In addition, we showed that the M. robertsii isolates were significantly more active than M. brunneum in a field experiment with sharp variation in temperature and 13

relative humidity. Therefore, using M. robertsii will be more effective against CPB larvae under continental climate conditions. On the other hand, this fungus should be less effective at managing the overwintering stages of the insect. The fungus M. pemphigum showed weak virulence toward the CPB, especially in the arid regime. This species is known as an aphid pathogen (Aphididae, Pemphigus) (Foster, 1975; Driver et al., 2000); however, we isolated this fungus from scarab beetle larvae (Scarabaeidae). The occurrence of this fungus on beetles (Curculionidae: Scolytinae) was also noted by Brownbridge and coauthors (2010). We showed earlier that M. pemphigum (isolate Mak-2) has a significantly higher LC50 value for CPB larvae compared to M. robertsii and M. brunneum (Tyurin et al., 2016). Moreover, this species was not able to colonize the hemocoel of CPB larvae. The insects died due to strong melanization of the integument, and sclerotia were not formed (Tyurin et al., 2016). M. pemphigum is a cold-active and non-thermotolerant species as noted previously by other authors (Driver et al., 2000; Nishi et al., 2013). Thus, the fungus is not adapted to either CPB larvae or their habitat. This work is the first comparative study of the activity of cryptic Metarhizium species against CPB. The obtained data indicate that M. robertsii isolates are the most promising for biocontrol of CPB larvae under continental climate conditions. Specifically, these isolates exhibited higher levels of heat tolerance and virulence under the conditions observed in the habitat of these insects during the period of larval foraging.

Acknowledgments The authors would like to thank B.A. Borisov and G.R. Lednev for kindly providing the fungal isolates and soil samples, and V.A. Shilo for help in organizing the experiments. The fungal collection and phylogeny study was supported by the Russian Foundation for Basic Research (project № 16-54-53033) and the National Natural Science Foundation of China

14

(No. 31611130034). The laboratory and field bioassays of fungi against CPB were supported by the Russian Science Foundation (grant № 15-14-10014).

References Aw, K.M.S., Hue, S.M., 2017. Mode of infection of Metarhizium spp. fungus and their potential as biological control agents. J. Fungi. 3 (2), 30. Bidochka, M.J., Kamp, A.M., Lavender, M.T., Dekoning, J., De Cross, J.N.A., 2001. Habitat association in two genetic groups of the insect–pathogenic fungus Metarhizium anisopliae: uncovering cryptic species? Appl. Environ. Microbiol. 67 (3), 1335–1342. Bidochka, M.J., Small, C-L.N., Spironello, M., 2005. Recombination within sympatric cryptic species of the insect pathogenic fungus Metarhizium anisopliae. Environ. Microbiol. 7 (9), 1361–1368. Bischoff, F.J., Rehner, S.A., Humber, R.A., 2006. Metarhizium frigidum sp. nov.: a cryptic species of M. anisopliae and a member of the M. flavoviride complex. Mycologia. 98 (5), 737–745. Bischoff, F.J., Rehner, S.A., Humber, R.A., 2009. A multilocus phylogeny of the Metarhizium anispliae lineage. Mycologia 101 (4), 512–530. Brownbridge, M., Reay, S.D., Cummings, N.J., 2010. Association of entomopathogenic fungi with exotic bark beetles in New Zealand pine plantations. Mycopathologia 169 (1), 75–80. Driver, F., Milner, R.J., Trueman, J.W.H., 2000. A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 104 (2), 134–150. Faria, M.R., Wraight, S.P., 2007. Mycoinsecticides and mycoacaricides: a comprehensive list with worldwide coverage and international classification of formulation types. Biol. Control 43, 237–256. Foster, W.A., 1975. The life history and population biology of an intertidal aphid, Pemphigus trehernei Foster. Ecol. Entomol. 127 (3), 193–207. 15

Fisher, J.J., Rehner, S.A., Bruck, D.J., 2011. Diversity of rhizosphere associated entomopathogenic fungi of perennial herbs, shrubs and coniferous trees. J. Invertebr. Pathol. 106 (2), 289–295. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. 41, 95–98. Keyser, C.A., De Fine Licht., H.H., Steinwender, B.M., Meyling, N.V., 2015. Diversity within the entomopathogenic fungal species Metarhizium flavoviride associated with agricultural crops in Denmark. BMC Microbiology 15, 1471–2180. Kepler, R.M., Humber, R.A., Bischoff, J.F., Rehner, S.A., 2014. Clarification of generic and species boundaries for Metarhizium and related fungi through phylogenetics. Mycologia 106 (4), 811–829. Kepler, R.M., Ugine, T.A., Maul, J.E., Cavigelli, M.A., Rehner, S.A., 2015. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system. Environ. Microbiol. 17 (8), 2791– 2804. Koval, E.Z., 1974. Identification entomopathogenic fungi of USSR. Naukova Dumka, Kiev, Ukrain, pp. 1–257, (in Russian). Kryukov, V.Yu., Khodyrev, V.P., Yaroslavtseva, O.N., Kamenova, A.S., Duisembekov, B.A., Glupov, V.V., 2009. Synergistic action of entomopathogenic hyphomycetes and the bacteria Bacillus thuringiensis ssp. morrisoni in the infection of Colorado potato beetle Leptinotarsa decemlineata. Appl. Biochem. Microbiol. 45 (5), 511–516. Kryukov, V.Yu., Tyurin, M.V., Tomilova, O.G., Yaroslavtseva, O.N., Kryukova, N.A., Duisembekov, B.A., Tokarev, Yu.S., Glupov, V.V., 2017. Immunosuppression of insects by the venom of Habrobracon hebetor increases the sensitivity of bait method for the isolation

of

entomopathogenic

fungi

from

soils.

Biology

Bulletin

44,

http://dx.doi.org/10.1134/S1062359017030050. 16

Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lomer, C.J., Bateman, R.P., Johnson, D.L., Lagewald, J., Thomas, M., 2001. Biological control of locusts and grasshoppers. Annu. Rev. Entomol. 46, 667–702. Nishi, O., Hasegawa, K., Iiyama, K., Yasunaga–Aoki, C., Shimizu, S., 2011. Phylogenetic analysis of Metarhizium spp. isolated from soil in Japan. Appl. Entomol. Zool. 46 (3), 301– 309. Nishi, O., Iiyama, K., Yasunaga-Aoki, C., Shimizu, S., 2013. Comparison of the germination rates of Metarhizium spp. conidia from Japan at high and low temperatures. Lett. Appl. Microbiol. 57 (6), 554–560. Ogarkov, B.N., Ogarkova, G.P., 2000. Entomophatogenic fungi of East Siberia. Mikologiya i Fitopatologiya 31 (4), 14–19. Polovinko, G.P., Yaroslavtseva, O.N., Teshebaeva, Z.A., Kryukov, V.Yu., 2010. Dominanting species of entomophilous ascomycetes anamorhps in West Siberia, Primorsky Krai, and Kyrgyzstan. Contemp. Probl. Ecol. 3 (5), 515–521. Rehner, S.A., Kepler, R.M., 2017. Species limits, phylogeography and reproductive mode in the Metarhizium

anisopliae

complex.

J.

Invertebr.

Pathol.

http://dx.doi.org/10.1016/j.jip.2017.05.008. Serebrov, V.V., Maljarchuk, A.A., Shternshis, M.V., 2007. Spontaneous variability of Metarhizium anisopliae (Metsch.) Sor. strains as an approach for enhancement of insecticidal activity. Plant Sci. (Sofia) 44, 236–239. Steinwender, B.M., Enkerli, J., Widmer, F., Eilenberg, J., Thorup-Kristensen, K., Meyling, N.V. 2014. Molecular diversity of the entomopathogenic fungal Metarhizium community within an agroecosystem. J. Invertebr. Pathol. 123, 6–12.

17

Steinwender, B.M., Enkerli, J., Widmer, F., Eilenberg, J., Kristensen, H.L., Bidochka, M.J., Meyling, N.V., 2015. Root isolations of Metarhizium spp. from crops reflect diversity in the soil and indicate no plant specificity. J. Invertebr. Pathol. 132, 142–148. Scott, I.M., Tolman, J.H., MacArthur, D.C., 2015. Insecticide resistance and crossresistance development in Colorado potato beetle Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae) populations in Canada 2008-2011. Pest Manag. Sci. 71, 712–721. Scheirer, CJ, Ray, WS, Hare, N, 1976. The analysis of ranked data derived from completely randomized factorial designs. Biometrics 32, 429–434. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Tyurin, M.V., Kryurov, V.Yu., Yaroslavtseva, O.N., Elisafenko, E.A., Dubovskiy, I.M., Glupov, V.V. 2016. Comparative analysis of immune responses in Colorado potato beetle larvae during development of mycoses caused by Metarhizium robertsii, M. brunneum, and M. pemphigi. J. Evol. Biochem. Physiol. 52, 252–260. Tomilova, O.G., Kryukov, V.Yu., Duisembekov, B.A., Yaroslavtseva, O.N., Tyurin, M.V., Kryukova, N.A., Skorokhod, V., Dubovskiy, I.M., Glupov, V.V. 2016. Immunephysiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae. J. Invertebr. Pathol. 140, 8–15. Wraight, S.P., Ramos, M.E., 2002. Application parameters affecting field efficacy of Beauveria bassiana foliar treatments against Colorado potato beetle Leptinotarsa decemlineata. Biol. Control 23 (2), 164–178. Wraight, S.P., Ramos, M.E., 2005. Synergistic interaction between Beauveria bassiana – and Bacillus thuringiensis tenebrionis – based biopesticides applied against field populations of Colorado potato beetle larvae. J. Invertebr. Pathol. 90 (3), 139–150.

18

Wraight, S.P., Ramos, M.E., 2015. Delayed efficacy of Beauveria bassiana foliar spray applications against Colorado potato beetle: Impacts of number and timing of applications on larval and next-generation adult populations. Biol. Control 83, 51–67. Wraight, S.P., Ramos, M.E., 2017. Characterization of the synergistic interaction between Beauveria bassiana strain GHA and Bacillus thuringiensis morrisoni strain tenebrionis applied

against

Colorado

potato

beetle

larvae.

J.

Invertebr.

Pathol.,

http://dx.doi.org/10.1016/j.jip.2017.01.007. Wraight, S.P., Sporleder, M., Poprawski, T.J., Lacey, A.L., 2007. Application and evaluation of entomopathogens in potato, in: Lacey, L.A., and Kaya, H.K., (eds.), Field manual of techniques in invertebrate pathology. Application and evaluation of pathogens for control of insects and other invertebrate pests. Springer, pp. 329–359. Wyrebek, M., Huber, C., Sasan, R.K., Bidochka, M.J. 2011. Three sympatrically occurring species of Metarhizium show plant rhizosphere specificity. Microbiology 157 (10), 2904– 2911. Wyrebek, M., Bidochka, M.J., 2013. Variability in the Insect and plant adhesins, Mad1 and Mad2, within the fungal genus Metarhizium suggest plant adaptation as an evolutionary force. PLoS ONE 8 (3), e59357. Yaroslavtseva, O.N., Dubovskiy, I.M., Khodyrev, V.P., Duisembekov, B.A., Kryukov, V.Yu., Glupov, V.V., 2017. Immunological mechanisms of synergy between fungus Metarhizium robertsii and bacteria Bacillus thuringiensis ssp. morrisoni on Colorado potato beetle larvae. J. Insect. Physiol. 96, 14–20. Zimmermann, G., 2007. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontr. Sci. Tech. 17 (9), 879–920.

19

Figure legends

Fig. 1 Molecular phylogenetic reconstruction showing the positions of Metarhizium spp. from Russia and neighboring regions (in boxes to the right of the tree) in regard to GenBankaccessible reference isolates (marked in the tree by black rectangles). Regions where fungi were isolated are designated: GA – Gorny Altay, NS – Novosibirsk reg., KK – Krasnodar Krai, LT – Latvia, KZ – Kazakhstan, NI – Northern Iran, MC – Moscow reg., UN – Ukraine, PR – Primorski Krai. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model (Tamura and Nei 1993). A discrete gamma distribution was used to model evolutionary rate differences among sites (6 categories (+G, parameter = 0.5044)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 0.0009 % of sites). There were a total of 623 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016). Values on the intermediate nodes indicate bootstrap values as calculated in MEGA 7 using the bootstrap method. The scale bar is 0.05 expected changes per site.

Fig. 2 Relative radial growth of Metarhizium robertsii (18 isolates) and M. brunneum (13 isolates) at different temperatures. Vertical lines show standard error. Asterisks indicate significant differences in species growth (Tukey’s post hoc test: P < 0.05) within each temperature.

Fig. 3 Median lethal time (LT50) (a) and total mortality (b) of Colorado potato beetle larvae under humid (21 °С, 80 % RH) and arid (31 °С, 55 % RH) hydrothermal regimes after infection with Metarhizium robertsii or M. brunneum. The concentration of inoculum was 2 × 106 conidia ml-1. Ten isolates of each species were randomly selected for LT50 analysis and 13 isolates of 20

each species for analysis of total mortality (Table S2). The death rate in controls untreated by fungi was < 10 % (Table S2). The results are presented as median and 25 %–75 % quartile deviation. The same letters indicate non-significant differences between all treatments (MannWhitney pairwise test, Bonferroni corrected P > 0.05).

Fig. 4 Mortality dynamics of Colorado potato beetle larvae in a potato field in the steppe zone of Western Siberia after treatment with 10 isolates of Metarhizium robertsii and 10 isolates of M. brunneum. The death rate in controls untreated by fungi was < 14 % (Table S3). Weather conditions are presented in Fig. S3. Results are presented as median and 25 %–75 % quartile deviation. Asterisks indicate significant differences between the species (Mann-Whitney test: Z < 2.6, P < 0.01) within each time point.

21

Highlights

M. robertsii and M. brunneum are the most frequent Metarhizium species in Russia Metarhizium robertsii is more adapted to arid conditions compared to M. brunneum Metarhizium robertsii is more active toward Colorado potato beetle than M. brunneum

22

Table 1 Isolates of Metarhizium spp. used in the study Strain

Year and place of isolation

Source of isolation

Habitat

Аp-1

2004 Gorny Altay, Russia N 51°46', E 87°14'

Soil

Pine forest

MB-1

2009 Novosibirsk reg., Russia N 55°17′, E 83°24′

Soil

Grass meadow

Coleoptera, Leptinotarsa decemlineata Say Soil

Potato field

Orthoptera, Calliptamus italicus L. Coleoptera, L. decemlineata Coleoptera, L. decemlineata Soil

Herb-bunchgrass steppe Potato field

†

Р-72

1972 Latvia

S-Ir-07*

2007 Gilan, Northern Iran

Mak-1**

2001 Novosibirsk reg., Russia N 53°41', E 78°14'

Mak-3

2012 Novosibirsk reg., Russia N 53°43', E 77°38'

Mak-4

2013 Novosibirsk reg., Russia N 53°43', E 77°38'

Mak-5

2014 Novosibirsk reg., Russia N 53°43', E 77°39'

Mak-6 EK-1

2014 Novosibirsk reg., Russia N 53°43', E 77°50' 2013 Novosibirsk reg., Russia N 53°43', E 77°38'

EK-2

2013 Novosibirsk reg., Russia N 53°43', E 77°38'

Q-4 Q-8 Q-11 QS-1 UK-7

2014 Novosibirsk reg., Russia N 55°02', E 84°50' 2014 Novosibirsk reg., Russia N 55°02', E 84°50' 2014 Novosibirsk reg., Russia N 55°02', E 84°50' 2014 Novosibirsk reg., Russia N 55°02', E 84°49' 2015 Almaty reg., Kazakhstan N 43°16', E 76°53'

Soil Coleoptera, L. decemlineata Coleoptera, L. decemlineata Soil Soil Soil Soil Soil

PB

2015 Krasnodar Krai, Russia N 45°09', E 38°02'

Soil

Birch-aspen forest Birch-aspen forest Birch-aspen forest Grass meadow Herb-bunchgrass steppe Inundation meadow

PA

2015 Krasnodar Krai, Russia N 45°09', E 38°02'

Soil

Inundation meadow

Coleoptera, Callipogon relictus Semenov Coleoptera, Rhagium inquisitor L.

Coniferous-broadleaved forest Pine forest

Coleoptera, Agelastica alni L. Soil

Alder forest

†

Oak forest

Potato field Herb-bunchgrass steppe Birch-aspen forest Potato field Potato field

85-69-p

1969 Primorski Krai, Russia

Ram-1

2010 Moscow reg., Russia N 55°34′, E 38°14′

Мali*

1999 Krasnodar Krai, Russia N 43°40′, E 39° 45′

LV-17

2015 Vinnitsa, Ukraine N 49°14′, E 28°15′

GV-1

2013 Novosibirsk reg., Russia, N 53°43' E 77°38'

Coleoptera, L. decemlineata

Potato field

Q-1 Q-2 Q-3

2014 Novosibirsk reg., Russia, N 55°02', E 84°50' 2014 Novosibirsk reg., Russia, N 55°02', E 84°50' 2014 Novosibirsk reg., Russia, N 55°02', E 84°50'

Soil Soil Soil

Birch-aspen forest Birch-aspen forest Birch-aspen forest

Q-5

2014 Novosibirsk reg., Russia, N 55°02', E 84°50'

Soil

Birch forest

Q-6

2014 Novosibirsk reg., Russia, N 55°02', E 84°50'

Soil

Birch forest

Q-7

2014 Novosibirsk reg., Russia, N 55°02', E 84°50'

Soil

Birch forest

Q-9

2014 Novosibirsk reg., Russia, N 55°02', E 84°50'

Soil

Birch-aspen forest

Q-10 Klp-96* Мак-2

2014 Novosibirsk reg., Russia, N 55°02', E 84°50' 1996 Moscow, Russia N 55°41′, E 37°46′ 2009 Novosibirsk reg., Russia N 53°44', E 77°39'

Birch-aspen forest Birch forest Birch-aspen forest

MBB**

2014 Moscow reg., Russia, N 55°41', E 36°43'

Soil Diptera Coleoptera, Scarabaeidae Soil

Broad-leaved forest

Broad-leaved forest

23

* – Isolates from the collection of the A.N. Severtsov Institute of Ecology and Evolution RAS; ** – Isolates from the collection of the All-Russia Institute of Plant Protection; Isolates from the collection of the Institute of Systematic and Ecology of Animals SB RAS are not marked;

†-

information about year,

place and source of isolation according to Serebrov et al. (2007)

24

25

26

27

28

Graphical

29