- Email: [email protected]
EcoRI Restriction Fragment-Length Polymorphism of the Human Immunoglobulin Variable Lambda 8 (IGLV8) Subgroup Reveals a Gene Family
EcoRI Restriction Fragment-Length Polymorphism of the Human Immunoglobulin Variable Lambda 8 (IGLV8) Subgroup Reveals a Gene Family Geraldo A. S. Passos Jr., Rosane G. P. Queiroz, and Alice Bruˆle´ ABSTRACT: The human immunoglobulin lambda locus (IGL) maps on chromosome 22q11.1– q11.2 and directs the synthesis of lambda-type Ig light chains. This locus is formed by three gene clusters (VA, VB and VC) that encompass the variable coding genes and the J-C cluster plus the joining segments and the constant genes. Recently the variable lambda gene clusters were mapped by the contig methodology which located all the known functional v-lambda genes and pseudogenes. The 30 functional v-lambda genes described so far were subgrouped into ten families (VlI to VlX), but RFLP studies have estimated that the germline repertoire contains about 70 genes. Based on sequence comparisons, we defined specific oligonucleotide primers for the unique IGLV8S1 gene
described. The cloned 244 bp product obtained from genomic DNA with these primers was sequenced and used as probe in Southern hybridization EcoRI RFLP analysis of Brazilian people. We detected the IGLV8S1 gene in a 3.7 kb EcoRI restriction fragment present in all the individuals analyzed, in agreement with the physical map of the IGL locus. Moreover, we detected an 8.0 kb EcoRI monomorphic fragment and a 6.0 kb EcoRI polymorphic fragment. These data suggest that the IGLV8 subgroup is a gene family. Human Immunology 55, 96 –102 (1997). © American Society for Histocompatibility and Immunogenetics, 1997. Published by Elsevier Science Inc.
ABBREVIATIONS bp base pair C constant CDR complementary determining region ds double-strand dNTP deoxynucleotide triphosphate EMBL European Molecular Biology Laboratory FR framework region H heavy Ig immunoglobulin IGLV immunoglobulin lambda variable IGLV8S1 immunoglobulin lambda variable subgroup 8 sequence 1
J Kb L ORF PCR RFLP SDS SSC STS V, v YAC
From the Universidade de Sa˜o Paulo, Faculdade de Odontologia de Ribeira˜o Preto, Dept. Morfologia, Lab. Gene´tica. 14049-904 Ribeira˜o Preto, SP, Brasil. (G.A.S.P.), E-mails: [email protected] or [email protected] FAX: 155 16 633 0069 and Grupo de Imunogene´tica Molecular, Faculdade de Medicina de Ribeira˜o Preto, Departamento Gene´tica. 14040-900 Ribeira˜o Preto, SP, Brasil (G.A.S.P., R.G.P.Q., A.B.). Supported by grants from FAPESP (No. 95/9839-3) and CNPqFAPESP (No. 96/5842-2). Address reprint requests to Dr. Geraldo A. S. Passos Jr. Received March 10, 1997; accepted July 7, 1997. Human Immunology 55, 96 –102 (1997) © American Society for Histocompatibility and Immunogenetics, 1997 Published by Elsevier Science Inc.
joining kilobase light open reading frame polymerase chain reaction restriction fragment length polymorphism sodium dodecyl sulfate saline sodium citrate sequence-tagged site variable yeast artificial chromosome
INTRODUCTION The immunoglobulin molecules are composed of two heavy (H) and two light (L) chains held together by disulfide bonds. Each H and L chain has a constant (C) region at the carboxy end and a variable (V) region at the amino end. The V regions of each chain type are implicated in antibody specificity (antigen recognition) through their complementary determining regions (CDR1, 2 and 3) [1]. In man, about 60% of L chains in functional antibod0198-8859/97/$17.00 PII S0198-8859(97)00099-2
The Human IGL V8 Subgroup is a Gene Family
ies are kappa-type and about 40% are lambda-type [2], indicating the important role played by the lambda chains in the antibody response. The human IGLV locus is localized on chromosome 22q11.1-q11.2 [3, 4] and based on Southern RFLP studies the germline repertoire has been estimated to contain approximately 70 members [2]. The Vl germline sequences described so far comprise ten pseudogenes [5– 12], three vestigial sequences [13–14], one germline sequence (VlN.2) not assigned to any of these subgroups [7] and 37 sequences with open-reading frame (ORF), 30 of which are functional: 5 VlI [5, 9, 15–18], 5 VlII [17–19], 8 VlIII [7, 10, 17], 3 VlV, 1 VlVI [17], 2 VlVII [5, 18, 20], 1 VlVIII [21], 1 VlIX [18] and 1 VlX [22]. The comparison of 60 human Vl protein or amino acid deduced sequences led to the definition of seven subgroups designated VlI to VlVII [23]. Three other Vl genes were described characterizing three new subgroups, VlVIII [21], VlIX [17] and VlX [22], respectively IGLV8S1, IGLV9S1 and IGLV10 according to the recommendations of the Human Gene Mapping Committees [24]. The complex structure of the human IGL locus was elucidated by means of contig methodology using overlapping YAC and cosmid clones; the Vl genes are arranged within about 800 kb [25, 26]. Due to the high homology of the different germline Vl sequences, it is quite difficult to find specific single copy sequences at the IGLV locus. Only two have been described so far on the 800 kb of the locus, i.e., the IGLVA pseudogene [27] and the IGLV9S1 gene [28] and one sequence downstream to the Vl genes, the IGLJ6 joining segment [29]. These are single copy sequences conferring sequencetagged sites (STS). We have compared all the sequences of the ten human Vl gene subgroups described [14, 17, 21–23]. In this paper we defined and cloned a specific sequence for the IGLV8S1 gene. Southern-RFLP using this sequence as a probe in genomic DNA from normal individuals showed the presence of two putative monomorphic DNA fragments containing Vl8 sequences in all individuals analyzed and one polymorphic fragment. These data suggest that the IGLV8 gene subgroup is a gene family.
MATERIALS AND METHODS Individuals and Genomic DNA Samples The Brazilian urban population from the Ribeira˜o Preto region, Sa˜o Paulo state, Southeastern Brazil, is characterized by intense ethnic admixture. For the present study, 30 random volunteers and one family with five members were analyzed. The genomic DNA was prepared from PBL samples as previously described [30].
97
Oligonucleotide Primers and PCR By comparing the sequences of the ten human Vl gene subgroups we defined specific sequences for the IGLV8S1 germ line gene. The oligonucleotides corresponding to these regions (32-mer 59 GTGGCTTGAG CTCTGGCTCAGTTCCTACTAGT 39 forward, positions 244 –275, covering the last two bp from the intron and a portion from the CDR1 region and 33-mer 59 TTAAATCACTGTGAAATGCCACTACCCATATAC 39 reverse, positions 487– 455 covering a portion from the CDR3 and the heptamer) were synthesized. The primers were used in a PCR described below performed on genomic DNA from a normal person. A unique fragment of expected 244 bp was amplified from positions 244 to 487 of the IGLV8S1 gene. The PCR conditions were: 100 ng of human genomic DNA, 100 ng of each primer, 200 mM of each dNTP, 2.5 U of Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) in 100 ml of 13 PCR buffer (10 mM TRIS-HCl pH 8.3, 50 mM KCl). PCR profile: 94°C for 3 min, 60°C for 10 min (one cycle), 72°C for 2 min, 94°C for 1:1/2 min, 60°C for 2 min (thirty cycles) and 72°C for 10 min, and 10°C for 5 min (one cycle). Cloning and Sequencing of the PCR Product After electrophoresis on 2% agarose gel, the PCR product was eluted from the gel using the Spin-X centrifugation-filtration system (Costar, Cambridge, MA, USA), extracted with phenol-chloroform, and cloned in pUC-18 by standard procedures [31]. This clone, designated pVL8S1, was sequenced in both the forward and reverse directions by the Sanger dideoxynucleotide method using 35S-ATP [32]. Sequence homology with all the known human Vl genes was compared in the IMGT DataBase using the DNAPLOT software via Internet www.ebi.ac.uk/imgt. Southern Hybridization The Southern hybridization procedure was performed as previously described [31] using the 32P radiolabeled cloned PCR product as a probe and genomic DNAs digested with EcoRI restriction endonuclease. The digested DNAs were transferred from gels to nylon membranes (Hybond N1, Amersham) using a vacuum blotter apparatus (Pharmacia). The membranes were hybridized overnight at 42°C in 50% formamide in Dennhart’s solution, washed under high stringency at 65°C using 0.1 3 SSC, 0.5% SDS solution, and exposed to XAR-5 Kodak film using intensifying screens at 280°C for 1 week.
98
FIGURE 1 Nucleotide sequence of the IGLV8S1 gene showing the positions of the forward and reverse oligonucleotides (underlined) used in PCR amplifications. The positions of the codons and respective aminoacid residues for the CDRs and Frs are according to Kabat [1]. The heptamer (CACAGTG) is in italic.
RESULTS Sequencing the pVL8S1 Clone We demonstrated a 244 bp insert which covers the CDR1, FR2, CDR2, FR3, CDR3 and heptamer regions of the IGLV8S1 gene as shown in Fig. 1 (EMBL accession n° X75424). Analysis of sequence homology using the DNAPLOT software showed a 100% match with the germline gene IGLV8S1 [21], designated gene Vl8a and located on the VC cluster of the IGL locus on chromosome 22q11.2 [25]. IGLV8 RFLP Analysis Three EcoRI hybridizing fragments were identified in the sample of 30 Brazilian unrelated individuals, two of
G. A. S. Passos Jr. et al.
them monomorphic (8.0 and 3.7 kb) at 100% frequency and one of them polymorphic (6.0 kb) at 10% frequency (Table 1 and Fig. 2A). The Southern blot with DNA samples from the family SI (Fig. 2B) shows that the 8.0 and 3.7 kb bands co-segregate, but the 6.0 kb band, absent in the parents, is present in one son (Be).
DISCUSSION The germline IGLV8S1 gene was originally isolated and sequenced from a human phage genomic library using a cDNA-derived PCR clone of the Vl light chain from a hybridoma secreting IgGl anti-dsDNA antibody as screening probe. Sequence comparison with other known human Vl genes permitted the authors to include this gene into a distinct subgroup with only one member named Vl8 [21]. Recently the human IGL locus was completely mapped [25, 26]. The map proposed by Frippiat et al., [25] locating 52 Vl genes divides this locus into three distinct V-clusters based on the IGLV gene family content. The location of the IGLV8S1 gene in a 3.7 kb
99
The Human IGL V8 Subgroup is a Gene Family
TABLE 1 Distribution of the EcoRI hybridization genomic DNA fragments to the pVL8S1 probe between 30 unrelated individuals DNA fragments in Kb Individuals
8.0
6.0
3.7
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 2
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
EcoRI fragment (gene Vl8a) is about 220 kb downstream from the BCRL2 gene, cluster V-C, 59 extremity (this map is also available on the Internet http://imgt. cnusc.fr:8104 or http://www.ebi.ac.uk/imgt). The PCR-based pVL8S1 gene probe described here detected two non polymorphic fragments and one polymorphic fragment in genomic DNA from normal Brazilian urban individuals (Fig. 2). We digested the DNA samples with EcoRI to compare our RFLP data with the 3.7 kb EcoRI fragment harboring the IGLV8S1 (Vl8a) gene in the physical map [25]. Although the Frippiat map [25] locates a single Vl8 gene in the YAC and cosmid contig, our RFLP results suggest that the Vl8 is a more extensive gene family. We have employed the PCR-based Vl gene probe methodology for detection of an undoubtedly Vl9 single member family, as previously described [28]. The Kawasaki map of the IGLV locus [26] located 69 Vl genes using four Vl probes.
An important technical detail during the detection of new human Vl genes is the washing condition of the hybridized membranes. It has been previously pointed out [14] that the identification of the several Vl genes by Kawasaki’s group [26] may have been due to the low-stringency washes employed, thereby identifying the functional Vl genes and the “weakly hybridizing” genes that are not expressed in the repertoire. The persistence of hybridizing genes after high-stringency washes was a criterion to map the functional Vl genes [25]. The Southern blot results presented here were obtained by washing the membranes at high stringency. The monomorphic 3.7 kb EcoRI hybridizing fragment agrees with the mapped functional germ line Vl gene 8a (IGLV8S1) [25]. The additional monomorphic 8.0 kb EcoRI fragment and the polymorphic 6.0 kb EcoRI fragment also detected may be either functional Vl genes or immunoglobulin lambda like (IGLL) located outside the functional IGL locus (or chromosome 22). There are some known Vl genes whose EcoRI fragments migrate between 5.7 and 6.5 kb and other migrating between 7.5 and 8.6 [14, 25] (see also IMGT DataBase via Internet http://imgt.cnusc.fr:8104/textes/ tables/EcoRI.html). Our studies on RFLP of the different Vl gene families in the Brazilian population, including the same individuals analyzed here, revealed that these fragments are highly polymorphic, including deletions (data not shown). The present results clearly show that the 8.0 kb EcoRI band is present in 100% of the individuals analyzed in a monomorphic fashion. The IGLV7a gene (acc Z73659) migrates in an EcoRI fragment of 7.9 kb, but it has only 66% sequence homology with the pVL8S1 probe. Considering that our Southern membranes were submitted to high-stringency washes, it is unlikely that they remained cross-hybridized with the IGLV7a gene after the washes. The IGLV9S1 gene (Vl9) is an STS for the IGL locus and migrates in a 5.6 kb EcoRI fragment. Our previous RFLP results showed that it is present in 100% of the individuals analyzed [28]. The 6.0 kb EcoRI band detected with the pVL8S1 probe is present in only 10% of the population analyzed. Thus, we have polymorphism and/or sequence homology evidence suggesting that the additional IGLV8 bands reported here are not simply cross-hybridization bands with other Vl genes. We have previously cloned the genomic restriction fragments bearing these two additional Vl8 genes and suggested the possibility that these genes are located outside the functional IGL locus (or chromosome 22) [33]. While this paper was under review, Frippiat et al., (1997) [34] reported that a Vl8 sequence, the TL6 Vl gene, previously described [35], but not assigned to any
100
FIGURE 2 Southern blots of genomic DNA samples digested with EcoRI and hybridized to the pVL8S1 probe. 2A unrelated individuals and 2B family SI (Fa 5 father; Fe, Lu and Be are sons; Mo 5 mother).
G. A. S. Passos Jr. et al.
The Human IGL V8 Subgroup is a Gene Family
YAC clones covering the IGL locus is a translocation from chromosome 22q11.2 to 8q11.2. The authors concluded that the IGL locus on chromosome 22q11.2 does not contain the Vl8 TL6 gene sequence. Further experiments with our pVL8S1 probe and primers, that are specific for the germline gene Vl8a on the IGL locus 22q11.2, will include the use of human/ rodent somatic cell hybrid DNAs to map these additional Vl8 segments outside the functional IGLV locus, chromosome 22q11.2. ACKNOWLEDGMENTS
Part of this work was carried out in the Laboratoire d’Immunoge´ne´tique Mole´culaire (directed by Prof. MariePaule Lefranc), Institut de Ge´ne´tique Mole´culaire de Montpellier, France, were GASPJr spent a post-doctoral period of training on a fellowship from CAPES-Brazil (1992–1994). RGPQ and AB are predoctoral fellows from CAPES and CNPq-Brazil, respectively. The pVL8S1 sequence was submitted to the EMBL by MPL. GASPJr received grants from FAPESP and CNPq-Brazil.
REFERENCES 1. Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C: Sequences of Proteins of Immunological Interest. US Department of Health and Human Services, NIH, Public Health Service, Washington, D.C., 1991. 2. Lai E, Wilson R, Hood L: Physical maps of the mouse and human immunoglobulin like loci. Adv Immunol 46:1, 1989. 3. McBride OW, Hieter PA, Hollis GF: Chromosomal location of human kappa and lambda immunoglobulin light chain constant region genes. J Exper Med 155:1480, 1982. 4. de la Chapelle A, Lenoir G, Boue´ J, Boue´ A, Gallano P, Huerre C, Szajnert MF, Jeanpierre M, Lalouel JM, Kaplan JC: Lambda Ig constant region genes are translocated to chromosome 8 in Burkitt’s lymphoma with t(8,22). Nucleic Acids Res 11:1133, 1983. 5. Alexandre D, Chuchana P, Brockly F, Blancher A, Lefranc G, Lefranc M-P: First genomic sequence of a human Ig variable l gene belonging to subgroup I. Functional genes, pseudogenes and vestigial sequences are interspersed in the IGLV locus. Nucleic Acids Res 17:3975, 1989. 6. Bauer TR, Blomberg B: The human l L chain Ig locus: recharacterization of JCl6 and identification of a functional Jcl7. J Immunol 146:2813, 1991. 7. Combriato G, Klobeck HG: Vl and Jl-Cl gene segments of the human immunoglobulin l light chain locus are separated by 14 kb and rearrange by a deletion mechanism. J Immunol 21:1513, 1991.
101
8. Dariavach P, Lefranc G, Lefranc M-P: Human immunoglobulin Cl6 gene encodes the Kern Oz l chain and Cl4 and Cl5 are pseudogenes. Proc Natl Acad Sci USA 84: 9074, 1987. 9. Daley DM, Olee T, Peng HQ, Soto-Gil RW, Chen PP, Siminovitch KA: Molecular analysis of human immunoglobulin VlIII and VlIV. Mol Immunol 29:1515, 1992. 10. Daley DM, Olee T, Peng HQ, Soto-Gil RW, Chen PP, Siminovitch KA: Molecular analysis of human immunoglobulin VlIII and VlIV. Mol Immunol 29:1515, 1992. 11. Heiter PA, Hollis GF, Korsmeyer SF, Waldman TA, Leder P: Clustered arrangement of immunoglobulin L constant region genes in man. Nature 294:536, 1987. 12. Vasicek TJ, Leder P: Structure and expression of the human immunoglobulin l genes. J Exp Med 172:609, 1993. 13. Frippiat JP, Lefranc M-P: Genomic organization of 34 kb of the human immunoglobulin lambda locus (IGLV): Restriction map and sequences of new VlIII genes. Mol Immunol 31:657, 1994. 14. Williams SC, Frippiat J-P, Tomlinson IM, Ignatovich O, Lefranc M-P, Winter G: Sequence and evolution of the human germline Vl repertoire. J Mol Biol 264:220, 1996. 15. Siminovitch KA, Misener V, Kwong PC, Song Q-L, Chen PP: A natural autoantibody is encoded by germline heavy and lambda light chain variable region genes without somatic mutation. J Clin Invest 84:1675, 1989. 16. Bernard F, Chuchana P, Frippiat J-P, Buluwela L, Lefranc M-P: Genomic sequence of IGLV1S2, a human immunoglobulin variable lambda gene belonging to subgroup I. Nucleic Acids Res 18:7139, 1990. 17. Williams SC, Winter G: Cloning and sequencing of human immunoglobulin Vl segments. Eur J Immunol 23: 1456, 1993. 18. Broclky F, Alexandre D, Chuchana P, Huck S, Lefranc G, Lefranc M-P: First nucleotidic sequence of a human immunoglobulin variable lambda gene belonging to subgroup II. Nucleic Acids Res 17:3976, 1989. 19. Frippiat J-P, Chuchana P, Bernard F, Buluwela L, Lefranc G, Lefranc M-P: First genomic sequence of a human Ig variable lambda gene belonging to subgroup III. Nucleic Acids Res 18:7134, 1990. 20. Anderson MLM, Szajnert MF, Kaplan JC, McColl L, Young BD: The isolation of a human IGVl gene from a recombinant library of chromosome 22 and estimation of its copy number. Nucleic Acids Res 12:6647, 1984. 21. Winter TH, Fehr H, Kalden J: Analysis of immunoglobulin variable region genes from human IgG anti-DNA hybridomas. Eur J Immunol 22:1719, 1992. 22. Stiernholm NBJ, Kusniar B, Berinstein N: Identification of a new human Vl gene family—VlX. J Immunol 152:4969, 1994. 23. Chuchana P, Blancher A, Brockly F, Alexandre D, Lefranc
102
24.
25.
26.
27.
28.
G. A. S. Passos Jr. et al.
G, Lefranc M-P: Definition of the human immunoglobulin variable lambda (IGLV) gene subgroups. Eur J Immunol 20:1317, 1990. Shows TB, McAlpine PJ, Boucheix C, Collins FS, Conneally PM, Frezal J, Gershowitz H, Goodfellow PN, Hall JG, Issitt P, Jones CA, Knowles BB, Lewis M, McKusick VA, Meisler M, Morton NE, Rubinstein P, Schanfield MS, Schimickel RD, Skolnick MH, Spence MA, Sutherland GR, Traver M, Van Cong N, Willard HF: Guidelines for human gene nomenclature. An international system for human gene nomenclature (ISGN, 1987). (9th International Workshop on Human gene Mapping.) Cytogenet Cell Genet 46:11, 1987. Frippiat J-P, Williams S, Tomlinson I, Cook GP, Cherif D, LePaslier D, Collins JE, Dunham I, Winter G, Lefranc M-P: Organization of the human immunoglobulin lambda light-chain locus on chromosome 22q11.2. Hum Mol Genet 4:983, 1995. Kawasaki K, Minoshima S, Schooler K, Kudoh J, Asakawa S, de Jong PJ, Shimizu N: The organization of the human immunoglobulin l gene locus. Genome Res 5:125, 1995. Chuchana P, Alexandre D, Lefranc G, Lefranc M-P: The IGLVA gene as an STS in the human immunoglobulin lambda light chain variable gene locus (located at 22q11). Nucleic Acids Res 19:4786, 1991. Passos Jr GAS, Frippiat J-P, Lefranc M-P: Definition of a sequence-tagged site for the human immunoglobulin
29.
30.
31.
32.
33.
34.
35.
IGLV9S1 gene located at chromosome 22q11. Exp Clin Immunogenet 11:222, 1994. Poul MA, Zhang XM, Ducret F, Lefranc M-P: The IGLJ6 joining segment as a STS in the human immunoglobulin lambda light chain constant region gene locus (located at 22q11). Nucleic Acids Res 19:4785, 1991. Ghanem N, Lefranc M-P, Lefranc G: Definition of RFLP alleles in the human immunoglobulin IGHG gene locus. Eur J Immunol 18:1054, 1988. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, Cold Spring Harbor Laboratory Press, 1989. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitor. Proc Natl Acad Sci USA 74:5463, 1977. Queiroz RGP, Bruˆle´ A, Passos Jr GAS: RFLP analysis and cloning genomic segments containing members of human lambda light-chain immunoglobulin genes. Braz. J. Genetics 19(3) supp.:295, 1996. Frippiat J-P, Dard P, Marsh S, Winter G, Lefranc M-P: Immunoglobulin lambda light chain orphons on human chromosome 8q11.2. Eur J Immunol 27:1260, 1994. Lee G, Ware RR, Latov N: Somatically mutated member of the human VlVIII gene family encodes anti-myelin associated glycoprotein (MAG) activity. J Neuroimmunol 51:45, 1994.
described. The cloned 244 bp product obtained from genomic DNA with these primers was sequenced and used as probe in Southern hybridization EcoRI RFLP analysis of Brazilian people. We detected the IGLV8S1 gene in a 3.7 kb EcoRI restriction fragment present in all the individuals analyzed, in agreement with the physical map of the IGL locus. Moreover, we detected an 8.0 kb EcoRI monomorphic fragment and a 6.0 kb EcoRI polymorphic fragment. These data suggest that the IGLV8 subgroup is a gene family. Human Immunology 55, 96 –102 (1997). © American Society for Histocompatibility and Immunogenetics, 1997. Published by Elsevier Science Inc.
ABBREVIATIONS bp base pair C constant CDR complementary determining region ds double-strand dNTP deoxynucleotide triphosphate EMBL European Molecular Biology Laboratory FR framework region H heavy Ig immunoglobulin IGLV immunoglobulin lambda variable IGLV8S1 immunoglobulin lambda variable subgroup 8 sequence 1
J Kb L ORF PCR RFLP SDS SSC STS V, v YAC
From the Universidade de Sa˜o Paulo, Faculdade de Odontologia de Ribeira˜o Preto, Dept. Morfologia, Lab. Gene´tica. 14049-904 Ribeira˜o Preto, SP, Brasil. (G.A.S.P.), E-mails: [email protected] or [email protected] FAX: 155 16 633 0069 and Grupo de Imunogene´tica Molecular, Faculdade de Medicina de Ribeira˜o Preto, Departamento Gene´tica. 14040-900 Ribeira˜o Preto, SP, Brasil (G.A.S.P., R.G.P.Q., A.B.). Supported by grants from FAPESP (No. 95/9839-3) and CNPqFAPESP (No. 96/5842-2). Address reprint requests to Dr. Geraldo A. S. Passos Jr. Received March 10, 1997; accepted July 7, 1997. Human Immunology 55, 96 –102 (1997) © American Society for Histocompatibility and Immunogenetics, 1997 Published by Elsevier Science Inc.
joining kilobase light open reading frame polymerase chain reaction restriction fragment length polymorphism sodium dodecyl sulfate saline sodium citrate sequence-tagged site variable yeast artificial chromosome
INTRODUCTION The immunoglobulin molecules are composed of two heavy (H) and two light (L) chains held together by disulfide bonds. Each H and L chain has a constant (C) region at the carboxy end and a variable (V) region at the amino end. The V regions of each chain type are implicated in antibody specificity (antigen recognition) through their complementary determining regions (CDR1, 2 and 3) [1]. In man, about 60% of L chains in functional antibod0198-8859/97/$17.00 PII S0198-8859(97)00099-2
The Human IGL V8 Subgroup is a Gene Family
ies are kappa-type and about 40% are lambda-type [2], indicating the important role played by the lambda chains in the antibody response. The human IGLV locus is localized on chromosome 22q11.1-q11.2 [3, 4] and based on Southern RFLP studies the germline repertoire has been estimated to contain approximately 70 members [2]. The Vl germline sequences described so far comprise ten pseudogenes [5– 12], three vestigial sequences [13–14], one germline sequence (VlN.2) not assigned to any of these subgroups [7] and 37 sequences with open-reading frame (ORF), 30 of which are functional: 5 VlI [5, 9, 15–18], 5 VlII [17–19], 8 VlIII [7, 10, 17], 3 VlV, 1 VlVI [17], 2 VlVII [5, 18, 20], 1 VlVIII [21], 1 VlIX [18] and 1 VlX [22]. The comparison of 60 human Vl protein or amino acid deduced sequences led to the definition of seven subgroups designated VlI to VlVII [23]. Three other Vl genes were described characterizing three new subgroups, VlVIII [21], VlIX [17] and VlX [22], respectively IGLV8S1, IGLV9S1 and IGLV10 according to the recommendations of the Human Gene Mapping Committees [24]. The complex structure of the human IGL locus was elucidated by means of contig methodology using overlapping YAC and cosmid clones; the Vl genes are arranged within about 800 kb [25, 26]. Due to the high homology of the different germline Vl sequences, it is quite difficult to find specific single copy sequences at the IGLV locus. Only two have been described so far on the 800 kb of the locus, i.e., the IGLVA pseudogene [27] and the IGLV9S1 gene [28] and one sequence downstream to the Vl genes, the IGLJ6 joining segment [29]. These are single copy sequences conferring sequencetagged sites (STS). We have compared all the sequences of the ten human Vl gene subgroups described [14, 17, 21–23]. In this paper we defined and cloned a specific sequence for the IGLV8S1 gene. Southern-RFLP using this sequence as a probe in genomic DNA from normal individuals showed the presence of two putative monomorphic DNA fragments containing Vl8 sequences in all individuals analyzed and one polymorphic fragment. These data suggest that the IGLV8 gene subgroup is a gene family.
MATERIALS AND METHODS Individuals and Genomic DNA Samples The Brazilian urban population from the Ribeira˜o Preto region, Sa˜o Paulo state, Southeastern Brazil, is characterized by intense ethnic admixture. For the present study, 30 random volunteers and one family with five members were analyzed. The genomic DNA was prepared from PBL samples as previously described [30].
97
Oligonucleotide Primers and PCR By comparing the sequences of the ten human Vl gene subgroups we defined specific sequences for the IGLV8S1 germ line gene. The oligonucleotides corresponding to these regions (32-mer 59 GTGGCTTGAG CTCTGGCTCAGTTCCTACTAGT 39 forward, positions 244 –275, covering the last two bp from the intron and a portion from the CDR1 region and 33-mer 59 TTAAATCACTGTGAAATGCCACTACCCATATAC 39 reverse, positions 487– 455 covering a portion from the CDR3 and the heptamer) were synthesized. The primers were used in a PCR described below performed on genomic DNA from a normal person. A unique fragment of expected 244 bp was amplified from positions 244 to 487 of the IGLV8S1 gene. The PCR conditions were: 100 ng of human genomic DNA, 100 ng of each primer, 200 mM of each dNTP, 2.5 U of Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) in 100 ml of 13 PCR buffer (10 mM TRIS-HCl pH 8.3, 50 mM KCl). PCR profile: 94°C for 3 min, 60°C for 10 min (one cycle), 72°C for 2 min, 94°C for 1:1/2 min, 60°C for 2 min (thirty cycles) and 72°C for 10 min, and 10°C for 5 min (one cycle). Cloning and Sequencing of the PCR Product After electrophoresis on 2% agarose gel, the PCR product was eluted from the gel using the Spin-X centrifugation-filtration system (Costar, Cambridge, MA, USA), extracted with phenol-chloroform, and cloned in pUC-18 by standard procedures [31]. This clone, designated pVL8S1, was sequenced in both the forward and reverse directions by the Sanger dideoxynucleotide method using 35S-ATP [32]. Sequence homology with all the known human Vl genes was compared in the IMGT DataBase using the DNAPLOT software via Internet www.ebi.ac.uk/imgt. Southern Hybridization The Southern hybridization procedure was performed as previously described [31] using the 32P radiolabeled cloned PCR product as a probe and genomic DNAs digested with EcoRI restriction endonuclease. The digested DNAs were transferred from gels to nylon membranes (Hybond N1, Amersham) using a vacuum blotter apparatus (Pharmacia). The membranes were hybridized overnight at 42°C in 50% formamide in Dennhart’s solution, washed under high stringency at 65°C using 0.1 3 SSC, 0.5% SDS solution, and exposed to XAR-5 Kodak film using intensifying screens at 280°C for 1 week.
98
FIGURE 1 Nucleotide sequence of the IGLV8S1 gene showing the positions of the forward and reverse oligonucleotides (underlined) used in PCR amplifications. The positions of the codons and respective aminoacid residues for the CDRs and Frs are according to Kabat [1]. The heptamer (CACAGTG) is in italic.
RESULTS Sequencing the pVL8S1 Clone We demonstrated a 244 bp insert which covers the CDR1, FR2, CDR2, FR3, CDR3 and heptamer regions of the IGLV8S1 gene as shown in Fig. 1 (EMBL accession n° X75424). Analysis of sequence homology using the DNAPLOT software showed a 100% match with the germline gene IGLV8S1 [21], designated gene Vl8a and located on the VC cluster of the IGL locus on chromosome 22q11.2 [25]. IGLV8 RFLP Analysis Three EcoRI hybridizing fragments were identified in the sample of 30 Brazilian unrelated individuals, two of
G. A. S. Passos Jr. et al.
them monomorphic (8.0 and 3.7 kb) at 100% frequency and one of them polymorphic (6.0 kb) at 10% frequency (Table 1 and Fig. 2A). The Southern blot with DNA samples from the family SI (Fig. 2B) shows that the 8.0 and 3.7 kb bands co-segregate, but the 6.0 kb band, absent in the parents, is present in one son (Be).
DISCUSSION The germline IGLV8S1 gene was originally isolated and sequenced from a human phage genomic library using a cDNA-derived PCR clone of the Vl light chain from a hybridoma secreting IgGl anti-dsDNA antibody as screening probe. Sequence comparison with other known human Vl genes permitted the authors to include this gene into a distinct subgroup with only one member named Vl8 [21]. Recently the human IGL locus was completely mapped [25, 26]. The map proposed by Frippiat et al., [25] locating 52 Vl genes divides this locus into three distinct V-clusters based on the IGLV gene family content. The location of the IGLV8S1 gene in a 3.7 kb
99
The Human IGL V8 Subgroup is a Gene Family
TABLE 1 Distribution of the EcoRI hybridization genomic DNA fragments to the pVL8S1 probe between 30 unrelated individuals DNA fragments in Kb Individuals
8.0
6.0
3.7
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 2 1 2 2 2 2 2
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
EcoRI fragment (gene Vl8a) is about 220 kb downstream from the BCRL2 gene, cluster V-C, 59 extremity (this map is also available on the Internet http://imgt. cnusc.fr:8104 or http://www.ebi.ac.uk/imgt). The PCR-based pVL8S1 gene probe described here detected two non polymorphic fragments and one polymorphic fragment in genomic DNA from normal Brazilian urban individuals (Fig. 2). We digested the DNA samples with EcoRI to compare our RFLP data with the 3.7 kb EcoRI fragment harboring the IGLV8S1 (Vl8a) gene in the physical map [25]. Although the Frippiat map [25] locates a single Vl8 gene in the YAC and cosmid contig, our RFLP results suggest that the Vl8 is a more extensive gene family. We have employed the PCR-based Vl gene probe methodology for detection of an undoubtedly Vl9 single member family, as previously described [28]. The Kawasaki map of the IGLV locus [26] located 69 Vl genes using four Vl probes.
An important technical detail during the detection of new human Vl genes is the washing condition of the hybridized membranes. It has been previously pointed out [14] that the identification of the several Vl genes by Kawasaki’s group [26] may have been due to the low-stringency washes employed, thereby identifying the functional Vl genes and the “weakly hybridizing” genes that are not expressed in the repertoire. The persistence of hybridizing genes after high-stringency washes was a criterion to map the functional Vl genes [25]. The Southern blot results presented here were obtained by washing the membranes at high stringency. The monomorphic 3.7 kb EcoRI hybridizing fragment agrees with the mapped functional germ line Vl gene 8a (IGLV8S1) [25]. The additional monomorphic 8.0 kb EcoRI fragment and the polymorphic 6.0 kb EcoRI fragment also detected may be either functional Vl genes or immunoglobulin lambda like (IGLL) located outside the functional IGL locus (or chromosome 22). There are some known Vl genes whose EcoRI fragments migrate between 5.7 and 6.5 kb and other migrating between 7.5 and 8.6 [14, 25] (see also IMGT DataBase via Internet http://imgt.cnusc.fr:8104/textes/ tables/EcoRI.html). Our studies on RFLP of the different Vl gene families in the Brazilian population, including the same individuals analyzed here, revealed that these fragments are highly polymorphic, including deletions (data not shown). The present results clearly show that the 8.0 kb EcoRI band is present in 100% of the individuals analyzed in a monomorphic fashion. The IGLV7a gene (acc Z73659) migrates in an EcoRI fragment of 7.9 kb, but it has only 66% sequence homology with the pVL8S1 probe. Considering that our Southern membranes were submitted to high-stringency washes, it is unlikely that they remained cross-hybridized with the IGLV7a gene after the washes. The IGLV9S1 gene (Vl9) is an STS for the IGL locus and migrates in a 5.6 kb EcoRI fragment. Our previous RFLP results showed that it is present in 100% of the individuals analyzed [28]. The 6.0 kb EcoRI band detected with the pVL8S1 probe is present in only 10% of the population analyzed. Thus, we have polymorphism and/or sequence homology evidence suggesting that the additional IGLV8 bands reported here are not simply cross-hybridization bands with other Vl genes. We have previously cloned the genomic restriction fragments bearing these two additional Vl8 genes and suggested the possibility that these genes are located outside the functional IGL locus (or chromosome 22) [33]. While this paper was under review, Frippiat et al., (1997) [34] reported that a Vl8 sequence, the TL6 Vl gene, previously described [35], but not assigned to any
100
FIGURE 2 Southern blots of genomic DNA samples digested with EcoRI and hybridized to the pVL8S1 probe. 2A unrelated individuals and 2B family SI (Fa 5 father; Fe, Lu and Be are sons; Mo 5 mother).
G. A. S. Passos Jr. et al.
The Human IGL V8 Subgroup is a Gene Family
YAC clones covering the IGL locus is a translocation from chromosome 22q11.2 to 8q11.2. The authors concluded that the IGL locus on chromosome 22q11.2 does not contain the Vl8 TL6 gene sequence. Further experiments with our pVL8S1 probe and primers, that are specific for the germline gene Vl8a on the IGL locus 22q11.2, will include the use of human/ rodent somatic cell hybrid DNAs to map these additional Vl8 segments outside the functional IGLV locus, chromosome 22q11.2. ACKNOWLEDGMENTS
Part of this work was carried out in the Laboratoire d’Immunoge´ne´tique Mole´culaire (directed by Prof. MariePaule Lefranc), Institut de Ge´ne´tique Mole´culaire de Montpellier, France, were GASPJr spent a post-doctoral period of training on a fellowship from CAPES-Brazil (1992–1994). RGPQ and AB are predoctoral fellows from CAPES and CNPq-Brazil, respectively. The pVL8S1 sequence was submitted to the EMBL by MPL. GASPJr received grants from FAPESP and CNPq-Brazil.
REFERENCES 1. Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C: Sequences of Proteins of Immunological Interest. US Department of Health and Human Services, NIH, Public Health Service, Washington, D.C., 1991. 2. Lai E, Wilson R, Hood L: Physical maps of the mouse and human immunoglobulin like loci. Adv Immunol 46:1, 1989. 3. McBride OW, Hieter PA, Hollis GF: Chromosomal location of human kappa and lambda immunoglobulin light chain constant region genes. J Exper Med 155:1480, 1982. 4. de la Chapelle A, Lenoir G, Boue´ J, Boue´ A, Gallano P, Huerre C, Szajnert MF, Jeanpierre M, Lalouel JM, Kaplan JC: Lambda Ig constant region genes are translocated to chromosome 8 in Burkitt’s lymphoma with t(8,22). Nucleic Acids Res 11:1133, 1983. 5. Alexandre D, Chuchana P, Brockly F, Blancher A, Lefranc G, Lefranc M-P: First genomic sequence of a human Ig variable l gene belonging to subgroup I. Functional genes, pseudogenes and vestigial sequences are interspersed in the IGLV locus. Nucleic Acids Res 17:3975, 1989. 6. Bauer TR, Blomberg B: The human l L chain Ig locus: recharacterization of JCl6 and identification of a functional Jcl7. J Immunol 146:2813, 1991. 7. Combriato G, Klobeck HG: Vl and Jl-Cl gene segments of the human immunoglobulin l light chain locus are separated by 14 kb and rearrange by a deletion mechanism. J Immunol 21:1513, 1991.
101
8. Dariavach P, Lefranc G, Lefranc M-P: Human immunoglobulin Cl6 gene encodes the Kern Oz l chain and Cl4 and Cl5 are pseudogenes. Proc Natl Acad Sci USA 84: 9074, 1987. 9. Daley DM, Olee T, Peng HQ, Soto-Gil RW, Chen PP, Siminovitch KA: Molecular analysis of human immunoglobulin VlIII and VlIV. Mol Immunol 29:1515, 1992. 10. Daley DM, Olee T, Peng HQ, Soto-Gil RW, Chen PP, Siminovitch KA: Molecular analysis of human immunoglobulin VlIII and VlIV. Mol Immunol 29:1515, 1992. 11. Heiter PA, Hollis GF, Korsmeyer SF, Waldman TA, Leder P: Clustered arrangement of immunoglobulin L constant region genes in man. Nature 294:536, 1987. 12. Vasicek TJ, Leder P: Structure and expression of the human immunoglobulin l genes. J Exp Med 172:609, 1993. 13. Frippiat JP, Lefranc M-P: Genomic organization of 34 kb of the human immunoglobulin lambda locus (IGLV): Restriction map and sequences of new VlIII genes. Mol Immunol 31:657, 1994. 14. Williams SC, Frippiat J-P, Tomlinson IM, Ignatovich O, Lefranc M-P, Winter G: Sequence and evolution of the human germline Vl repertoire. J Mol Biol 264:220, 1996. 15. Siminovitch KA, Misener V, Kwong PC, Song Q-L, Chen PP: A natural autoantibody is encoded by germline heavy and lambda light chain variable region genes without somatic mutation. J Clin Invest 84:1675, 1989. 16. Bernard F, Chuchana P, Frippiat J-P, Buluwela L, Lefranc M-P: Genomic sequence of IGLV1S2, a human immunoglobulin variable lambda gene belonging to subgroup I. Nucleic Acids Res 18:7139, 1990. 17. Williams SC, Winter G: Cloning and sequencing of human immunoglobulin Vl segments. Eur J Immunol 23: 1456, 1993. 18. Broclky F, Alexandre D, Chuchana P, Huck S, Lefranc G, Lefranc M-P: First nucleotidic sequence of a human immunoglobulin variable lambda gene belonging to subgroup II. Nucleic Acids Res 17:3976, 1989. 19. Frippiat J-P, Chuchana P, Bernard F, Buluwela L, Lefranc G, Lefranc M-P: First genomic sequence of a human Ig variable lambda gene belonging to subgroup III. Nucleic Acids Res 18:7134, 1990. 20. Anderson MLM, Szajnert MF, Kaplan JC, McColl L, Young BD: The isolation of a human IGVl gene from a recombinant library of chromosome 22 and estimation of its copy number. Nucleic Acids Res 12:6647, 1984. 21. Winter TH, Fehr H, Kalden J: Analysis of immunoglobulin variable region genes from human IgG anti-DNA hybridomas. Eur J Immunol 22:1719, 1992. 22. Stiernholm NBJ, Kusniar B, Berinstein N: Identification of a new human Vl gene family—VlX. J Immunol 152:4969, 1994. 23. Chuchana P, Blancher A, Brockly F, Alexandre D, Lefranc
102
24.
25.
26.
27.
28.
G. A. S. Passos Jr. et al.
G, Lefranc M-P: Definition of the human immunoglobulin variable lambda (IGLV) gene subgroups. Eur J Immunol 20:1317, 1990. Shows TB, McAlpine PJ, Boucheix C, Collins FS, Conneally PM, Frezal J, Gershowitz H, Goodfellow PN, Hall JG, Issitt P, Jones CA, Knowles BB, Lewis M, McKusick VA, Meisler M, Morton NE, Rubinstein P, Schanfield MS, Schimickel RD, Skolnick MH, Spence MA, Sutherland GR, Traver M, Van Cong N, Willard HF: Guidelines for human gene nomenclature. An international system for human gene nomenclature (ISGN, 1987). (9th International Workshop on Human gene Mapping.) Cytogenet Cell Genet 46:11, 1987. Frippiat J-P, Williams S, Tomlinson I, Cook GP, Cherif D, LePaslier D, Collins JE, Dunham I, Winter G, Lefranc M-P: Organization of the human immunoglobulin lambda light-chain locus on chromosome 22q11.2. Hum Mol Genet 4:983, 1995. Kawasaki K, Minoshima S, Schooler K, Kudoh J, Asakawa S, de Jong PJ, Shimizu N: The organization of the human immunoglobulin l gene locus. Genome Res 5:125, 1995. Chuchana P, Alexandre D, Lefranc G, Lefranc M-P: The IGLVA gene as an STS in the human immunoglobulin lambda light chain variable gene locus (located at 22q11). Nucleic Acids Res 19:4786, 1991. Passos Jr GAS, Frippiat J-P, Lefranc M-P: Definition of a sequence-tagged site for the human immunoglobulin
29.
30.
31.
32.
33.
34.
35.
IGLV9S1 gene located at chromosome 22q11. Exp Clin Immunogenet 11:222, 1994. Poul MA, Zhang XM, Ducret F, Lefranc M-P: The IGLJ6 joining segment as a STS in the human immunoglobulin lambda light chain constant region gene locus (located at 22q11). Nucleic Acids Res 19:4785, 1991. Ghanem N, Lefranc M-P, Lefranc G: Definition of RFLP alleles in the human immunoglobulin IGHG gene locus. Eur J Immunol 18:1054, 1988. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, Cold Spring Harbor Laboratory Press, 1989. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitor. Proc Natl Acad Sci USA 74:5463, 1977. Queiroz RGP, Bruˆle´ A, Passos Jr GAS: RFLP analysis and cloning genomic segments containing members of human lambda light-chain immunoglobulin genes. Braz. J. Genetics 19(3) supp.:295, 1996. Frippiat J-P, Dard P, Marsh S, Winter G, Lefranc M-P: Immunoglobulin lambda light chain orphons on human chromosome 8q11.2. Eur J Immunol 27:1260, 1994. Lee G, Ware RR, Latov N: Somatically mutated member of the human VlVIII gene family encodes anti-myelin associated glycoprotein (MAG) activity. J Neuroimmunol 51:45, 1994.