EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex

Article

EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex Highlights d

EED-targeted PROTACs bind to EED and promote ternary complex formation with VHL

d

EED, EZH2, and SUZ12 are selectively degraded by EEDtargeted PROTACs

d

EED-targeted PROTACs reduce proliferation of EZH2dependent cancer cells

Authors Jessie Hao-Ru Hsu, Timothy Rasmusson, James Robinson, ..., M. Paola Castaldi, Stephen Fawell, Andrew Bloecher

Correspondence [email protected]

In Brief Hsu et al. describe the discovery of EEDtargeted PROTACs that lead to the degradation of multiple components of the PRC2 complex. Furthermore, they demonstrate that these PROTACs inhibit the proliferation of PRC2-dependent cancer cells and may be considered an attractive alternative to EZH2 catalytic inhibitors currently in clinical development.

Hsu et al., 2020, Cell Chemical Biology 27, 1–6 January 16, 2020 ª 2019 Elsevier Ltd. https://doi.org/10.1016/j.chembiol.2019.11.004

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Cell Chemical Biology

Article EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex Jessie Hao-Ru Hsu,1 Timothy Rasmusson,3 James Robinson,4 Fiona Pachl,3 Jon Read,4 Sameer Kawatkar,1 Daniel H. O’ Donovan,2 Sharan Bagal,2 Erin Code,3 Philip Rawlins,4 Argyrides Argyrou,4 Ronald Tomlinson,3 Ning Gao,3 Xiahui Zhu,3 Elisabetta Chiarparin,2 Kelly Jacques,1 Minhui Shen,1 Haley Woods,1 Emma Bednarski,1 David M. Wilson,2 Lisa Drew,1 M. Paola Castaldi,3 Stephen Fawell,1 and Andrew Bloecher1,5,* 1Oncology

R&D, AstraZeneca, Waltham, MA 02451, USA R&D, AstraZeneca, Cambridge CB4 0FZ, UK 3Discovery Sciences, BioPharmaceuticals R&D, AstraZeneca, Waltham, MA 02451, USA 4Discovery Sciences, BioPharmaceuticals R&D, AstraZeneca, Cambridge CB4 0FZ, UK 5Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.chembiol.2019.11.004 2Oncology

SUMMARY

Deregulation of the PRC2 complex, comprised of the core subunits EZH2, SUZ12, and EED, drives aberrant hypermethylation of H3K27 and tumorigenicity of many cancers. Although inhibitors of EZH2 have shown promising clinical activity, preclinical data suggest that resistance can be acquired through secondary mutations in EZH2 that abrogate drug target engagement. To address these limitations, we have designed several hetero-bifunctional PROTACs (proteolysis-targeting chimera) to efficiently target EED for elimination. Our PROTACs bind to EED (pKD  9.0) and promote ternary complex formation with the E3 ubiquitin ligase. The PROTACs potently inhibit PRC2 enzyme activity (pIC50  8.1) and induce rapid degradation of not only EED but also EZH2 and SUZ12 within the PRC2 complex. Furthermore, the PROTACs selectively inhibit proliferation of PRC2-dependent cancer cells (half maximal growth inhibition [GI50] = 49–58 nM). In summary, our data demonstrate a therapeutic modality to target PRC2-dependent cancer through a PROTACmediated degradation mechanism.

INTRODUCTION The polycomb repressive complex 2 (PRC2) is an epigenetic modulator of transcription and plays a role in a variety of biological processes, such as stem cell maintenance, DNA repair, and epithelial to mesenchymal transition (Dimou et al., 2017). EED, SUZ12, and EZH2 form the core essential subunits of the PRC2 complex that regulate gene expression through the methylation of H3K27. EZH2, the catalytic subunit of PRC2, is regulated by the EED subunit through two mechanisms; recruitment of the PRC2 complex to chromatin, and allosteric activation of EZH2 methyltransferase activity (Qi et al., 2017; He et al., 2017).

The role of PRC2 in disease has been the focus of intense research. Supporting a role for PRC2 in oncogenesis, activating mutations in EZH2 are frequently found in both GCB-DLBCL and follicular lymphoma (Morin et al., 2010). These activating mutations lead to increased H3K27me3 which represses expression of key tumor suppressor genes as well as genes involved in B cell differentiation (Kim and Roberts, 2016). In support of a critical role for EZH2 in oncogenesis, EZH2 SAMcompetitive inhibitors have been identified that demonstrate preclinical and clinical activity in B cell lymphomas (GarapatyRao et al., 2013; McCabe et al., 2012; Knutson et al., 2014; Italiano et al., 2018). Recently, a novel mechanism of inhibition of the PRC2 complex has been reported using inhibitors that bind to an allosteric site on EED thereby preventing recruitment to histones and activation of EZH2 in the PRC2 complex (Qi et al., 2017; He et al., 2017). These inhibitors have demonstrated anti-tumor activity in EZH2 mutant DLBCL models and also in the EZH2 inhibitor-resistant setting. Given the likelihood of resistance emerging against EZH2 small-molecule inhibitors, new therapeutic approaches against the activity of the PRC2 complex are much needed. Proteolysis-targeting chimaeras (PROTACs) represent an emerging pharmacological mode of action that may offer advantages over traditional small-molecule inhibitors (Lai and Crews, 2017). PROTACs combine two small molecules via a linker motif, one of which binds to an E3 ligase while the other engages a target protein. In this manner, PROTACs recruit the cellular protein degradation machinery to the proximity of the protein of interest to ubiquitinate and ultimately degrade the target protein. To determine whether PROTACs could serve as an alternative strategy to inhibit PRC2 activity, we have designed, developed, and characterized novel EED-targeted PROTACs that can potently and selectively degrade both EED and associated proteins within the PRC2 complex. RESULTS Design of EED-Targeted PROTACs We sought to develop a novel mechanism of inhibiting PRC2 activity by synthesizing PROTACs targeting the EED subunit

Cell Chemical Biology 27, 1–6, January 16, 2020 ª 2019 Elsevier Ltd. 1

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Figure 1. Chemical Structures of the Capped VHL Ligand, EED Targeting PROTACs, and Capped EED Ligand

(Figure 1). PROTACs are bifunctional molecules which comprise a ligand binding to the target protein (EED) covalently linked to a second ligand binding to an E3 ubiquitin ligase, thereby recruiting the E3 ligase to induce ubiquitination and subsequent degradation of the target protein (Bondeson et al., 2015). After evaluating several reported EED ligands (Huang et al., 2017) (patent US20160176882A1), we generated an X-ray structure of an EED ligand compound bound to EED, which highlighted a solvent-exposed vector suitable to append a PROTAC linker (Read et al., unpublished). For the E3 ligase component, we used a well-studied ligand of von Hippel-Lindau (VHL) (Buckley et al., 2012) and evaluated various linker motifs to ultimately generate the compounds 2 and 3 (PROTACs 1 and 2). As tools for comparison, we also synthesized the inactive PROTACs analogs, compounds 5 and 6, which modify the stereochemistry of the VHL binding motif to ablate affinity for VHL while maintaining similar EED binding and physicochemical properties.

EED-Targeted PROTACs Bind and Inhibit the PRC2 Complex We profiled the two EED-targeted PROTACs (compounds 2 and 3) alongside the parent EED ligand (compound 4), the VHL ligand (compound 1), and the two inactive PROTACs (compounds 5 and 6) using surface plasmon resonance to assess EED binding affinity and a biochemical MTase Glo assay (Promega) to measure effects on PRC2 catalytic activity (Figures 2A and 2B). Compound 4 bound to EED with a pKD of 9.61 ± 0.11 and inhibited PRC2 function with a pIC50 of 8.43 ± 0.04. Attachment of the linkers and VHL warheads resulted in a slight decrease in EED affinity and potency of PRC2 inhibition for compounds 2, 3, 5, and 6; however, all compounds nonetheless inhibit PRC2 catalytic activity with low nM potency and bind to EED with low nM or pM affinity. As expected, capped VHL ligand compound 1 does not bind to EED or inhibit PRC2 function. Next, we used a TR-FRET in vitro ternary complex formation assay to measure EED:PROTAC:VHL ternary complex formation (Figure 2C). Ternary complex formation occurs only in the presence of compounds 2 and 3, which incorporate the appropriate stereochemistry on the VHL warhead. We observed a bell-shaped curve in agreement with previously published observations for PROTAC-induced ternary complex formation (Smith et al.,

Figure 2. EED-Targeted PROTACs Bind to EED and Promote Ternary Complex Formation with VHL (A) MTase Glo biochemical assay measuring PRC2 catalytic activity shows that the capped EED ligand, the two active PROTACs, and the two inactive PROTACs all inhibit PRC2 function. (B) Table shows mean MTase Glo pIC50 values and mean EED surface plasmon resonance (SPR) pKD values for all six compounds tested. (C) TR-FRET in vitro ternary complex formation assay shows that EED:PROTAC:VHL ternary complex formation only occurs in the presence of the two active PROTACs, which have the correct stereochemistry on the VHL warhead.

2 Cell Chemical Biology 27, 1–6, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

PROTAC Inactive #1 PROTAC #1

O

O

Figure 3. EED-Targeted PROTACs Promote Degradation of EED, EZH2, and SUZ12

EED Ligand

DMS

DMS

DMS

DMS

O

PROTAC #2

O

A

EED EZH2 GAPDH H3K27me3 0.12, 1, 3 PM

1 2 46 8

O

PROTAC #1 Inactive PROTACs (hrs) (24hr )

24 DM S

DM

SO

PROTAC #2 (hrs)

24 DM + SO ++ + ++ DM SO

B

(A) Karpas422 cells were treated with 0.1, 1, and 3 mM of the compounds for 48 h and the protein levels of EZH2, EED, and H3K27me3 were analyzed by western blot. (B) Karpas422 cells were treated with 1 mM of the PROTACs for 1–24 h or 0.3 (+) or 1 (++) mM of the inactive PROTACs for 24 h. Protein levels of EZH2, EED, SUZ12, EZH1, H3, GAPDH, and H3K27me3 in the treated cells were analyzed by western blot. (C) Quantification of the western blot shown in (B) by densitometry analysis. Protein band intensity was normalized to GAPDH and DMSO control samples.

#1 #2

1 24 68

EZH2 EED SUZ12 EZH1 GAPDH H3K27me3

not significantly modulate EED and EZH2 protein expression (Figures 3A, 3B, and S2). To understand the kinetics of degradation, a time course experiment was performed with PROTACs 1 and 2. EED protein levels decreased within 1– 2 h of PROTAC treatment. EZH2 and SUZ12 also decreased but with slightly slower kinetics (Figures 3B and 3C). Finally, the inactive PROTACs 1 and 2 did not lead a decrease in EED, EZH2, or SUZ12 within 24 h (Figure 3B).

Total H3

PROTAC-Mediated Degradation of EED Is Dependent on the Ubiquitin EZH1 level in PROTAC #1 treated cells Proteasome Pathway EZH1 level in PROTAC #2 treated cells To further corroborate that EED-targeted 100 SUZ12 level in PROTAC #1 treated cells PROTACs lead to degradation of EED via SUZ12 level in PROTAC #2 treated cells an E3 ubiquitin ligase-dependent mechaEZH2 level in PROTAC #1 treated cells nism, we treated cells with EED-targeted 50 EZH2 level in PROTAC #2 treated cells PROTAC 1 and PROTAC 2 in the presEED level in PROTAC #1 treated cells ence of excess VHL or MLN4924, which EED level in PROTAC #2 treated cells outcompetes PROTAC-mediated binding 0 to E3 ubiquitin ligase or inhibits E3 ligase 0 2 4 6 8 1015 20 25 activity, respectively. We observed that Hours excess VHL or MLN4924 treatment alone did not affect EED or EZH2 expression 2019). As expected, compounds 1, 4, 5, and 6 fail to induce (Figures 4 and S3). Treatment with PROTACs in the presence ternary complex formation (Figure 2C). of excess VHL or MLN4924 prevented PROTAC-mediated decrease in EED protein levels (Figures 4 and S3). We found EED-Targeted PROTACs Promote Degradation of EED, that PROTAC 2 requires higher amounts of VHL to fully inhibit EED degradation (Figure S3). Furthermore, treatment with a proEZH2, and SUZ12 Having established that our EED-targeted PROTACs can bind teasome inhibitor MG132 in PROTAC-treated cells also stabiEED and VHL as well as inhibit PRC2 enzymatic activity, lized PROTAC-mediated loss of EED protein expression. we determined whether they lead to degradation of EED in Together, these observations suggest that our PROTACs procells. As expected, H3K27me3 was reduced upon PROTAC mote degradation of EED via the ubiquitin proteasome pathway. treatment (Figure 3A, S1, and S2). The inactive PROTACs and the EED ligand inhibited tri-methylation of H3 at lysine 27, EED-Targeted PROTAC Is Selective against EED, EZH2, suggesting that all our compounds bind to EED and inhibit and SUZ12 PRC2-mediated methylation of histone 3 (Figures 3A, S1, and S2). To help establish the selectivity profile of our EED-targeted Interestingly, PROTAC 1 and PROTAC 2 treatment led to PROTAC, we performed a global proteomics analysis to quantify marked decrease in not only EED, but also EZH2. We also the relative abundance of proteins in PROTAC 1-treated cells as demonstrated that the inactive PROTAC or the EED ligand do compared with DMSO-treated cells. We found that EED, EZH2, 150

% Relative to DMSO

C

Cell Chemical Biology 27, 1–6, January 16, 2020 3

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

5PM VHL 5PM MLN4924 5PM MG132 0.3PM PROTAC #2 0.3PM PROTAC  #1 DMSO

                

    

    

    

    

    

    

    

   

     

    

    

      EED EZH2 GAPDH H3K27me3

Figure 4. PROTAC-Mediated Degradation of EED Is Dependent on the Ubiquitin Proteasome Pathway Karpas422 cells were pre-treated with 5 mM of MG132, VHL warhead, and MLN4924 for 2 h, followed by treatment with of 0.3 mM of PROTACs for an additional 4 h. Protein levels of EZH2, EED, and H3K27me3 were analyzed by western blot.

and SUZ12 were the only proteins that were significantly decreased 24 h after treatment (Figure 5; Table S3). As expected, the abundance of EED was the most significantly decreased, followed by EZH2 and SUZ12. This suggests that PROTAC 1 is highly selective against EED, EZH2, and SUZ12. EED-Targeted PROTACs Reduce Proliferation of EZH2 Mutant Karpas422 Cells To assess whether the EED-targeted PROTACs would affect the proliferation of EZH2 mutant cells, the DLBCL cell line Karpas422 was treated with PROTACs 1 and 2 as well as the EED targeting ligand and the VHL warhead. PROTAC 1 and PROTAC 2 treatment impaired cell proliferation similar to treatment with the EED ligand alone (Figures 6A–6D). The VHL warhead did not affect cell growth (Figure 6D). These data suggest that inhibition of EED can lead to a profound decrease in cell proliferation in EZH2-dependent cells. DISCUSSION Herein we have demonstrated that EED-targeted PROTACs can degrade EED and its associated proteins EZH2 and SUZ12 in the PRC2 complex. In-cell concentration experiments also demonstrate that the PROTACs are found in both the nuclear and cytoplasmic fractions (Table S1, see the STAR Methods). Both PROTACs show comparable binding affinity for EED and promote ternary complex formation with VHL in vitro. Co-immunoprecipation experiments have corroborated that EED, EZH2, and VHL are found together in the same complex in the presence of PROTACs (Figures S4A and S4B). In cells, both PROTACs induce rapid degradation of EED, whereas the inactive PROTACs and the EED ligand do not. Interestingly, PROTAC 2 seems to show faster kinetics and more profound degradation of EED than PROTAC 1. Together, these data suggest that the linker structure is a key contributing factor to efficient VHL/E3 recruitment and subsequent EED degradation. The observation that these PROTACs induce EED degradation more rapidly than EZH2 and SUZ12 implies that rapid loss of 4 Cell Chemical Biology 27, 1–6, January 16, 2020

log2 FC PROTAC#1/DMSO Figure 5. EED-Targeted PROTAC 1 Selectively Degrades EED, EZH2, and SUZ12 Global proteomic analysis of Karpas422 cells treated with 1mM of PROTAC 1 for 24 h. EED, EZH2, and SUZ12 protein/peptides were significantly decreased in the PROTAC-treated cells as compared with DMSO-treated cells. The log2 fold change for EED, EZH2, and SUZ12 are 1.2, 0.6, and 0.4, respectively (adjusted p < 0.05).

EED destabilizes of the PRC2 complex. Studies in the literature show that knockout or knockdown of individual components of the PRC2 complex leads to loss of the other members of the complex (Leeb et al., 2010; Xu et al., 2015). Consistent with the published reports, we have also found that knockout of EED protein in Karpas422 using CRISPR-based technology leads to concomitant downregulation of EZH2 and SUZ12 (Figure S1), comparable with PROTAC-mediated degradation pf EED. Thus, PROTAC-induced degradation of EED likely triggers subsequent degradation of EZH2 and SUZ12. Alternatively, it is possible that once the ternary complex is formed, exposed lysine residues in EZH2 or SUZ12, which are in proximity to the EED binding site, could be sites of PROTAC-mediated ubiquitin attachment. Intriguingly, we have observed rapid polyubiquitination of EZH2 within 1 h of PROTAC treatment (Figures S4B–S4D). Further studies are needed to determine the mechanism(s) of ubiquitination of EZH2 with EED-targeted PROTACs. We have found that PROTAC 1 and PROTAC 2 can potently inhibit proliferation of an EZH2 mutant DLBCL cell line, as well as an EZH2 WT rhabdoid cancer cell line (Figure 6; Table S2). The PROTACs are 3- to 4-fold less potent than the EED inhibitor as antiproliferative agents. This suggests that the binding of PROTACs to EED and subsequent inhibition of EZH2 catalytic activity is the primary driver of the antiproliferative effects. However, PROTACs could provide extended durability of inhibition compared with the EED ligand. EED ligand and PROTAC washout experiments are necessary to confirm this hypothesis. Previous publications have reported on non-catalytic functions for EZH2 in prostate and breast cancer (Xu et al., 2012; Lawrence and Baldwin, 2016; Lee et al., 2011). Hypothetically, it is conceivable that our EED-targeted PROTACs may have activity in this setting. However, this hypothesis relies on the assumption that the PROTAC would efficiently lead to degradation of all cellular EZH2. We have tested our PROTACs for

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

B

PROTAC #1 Day 4 Day 8 Day 12 Day 14

% cell growth

100

50

0

Day 4

0.1

1

10

Day 8

100

-50 0.01

PROTAC #2

Day 12

% cell growth

A

Day 14

50

0

-50

100

0.01

0.1

cmpd,PM

1

10

100

cmpd,PM

C

D

EED Ligand Day 4

% cell growth

100

Compound EED ligand PROTAC #1 PROTAC #2 VHL warhead

Day 8 Day 12 Day 14

50

GI50, PM (Day 14) 0.014 0.057 0.045 >31

0

-50 0.01

0.1

1

10

100

cmpd,PM Figure 6. EED-Targeted PROTACs and EED Ligand Reduce Proliferation of Karpas422 Cells (A–C) Dose-response curves for Karpas422 cells treated with PROTACs (A and B) or the EED ligand (C) from day 4 to 14. Percent cell growth relative to DMSO was measured from day 4 to 14 after treatment. The error bars represent standard deviation. (D) Summary of Karpas422 half maximal growth inhibition (GI50) values measured after 14 days of treatment with indicated compounds (cmpds).

anti-proliferative effects in a limited number of reported EZH2dependent (catalytically independent) cell lines and have not observed growth inhibition (Table S2). At present, it is unclear whether the lack of growth inhibition is due to a cellular fraction of EZH2 that is immune to PROTAC-mediated degradation. Further studies are warranted to further understand the non-catalytic functions of EZH2. In summary, we have discovered a novel PROTAC-based approach to target the PRC2 complex. The PROTACs possess a unique and selective degradation profile that may serve as promising tools to help unravel PRC2 biology. In addition, they may represent a novel therapeutic modality to treat PRC2dependent cancers.

pathway. Importantly, the PROTACs inhibit cell proliferation in PRC2-dependent cancer cells, comparable with EED small-molecule inhibitor. This drug modality may potentially help combat resistance to catalytic inhibitors or eliminate cancer cells that are dependent on the non-catalytic function of the PRC2 complex. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d

SIGNIFICANCE

d d

We have discovered a highly potent and selective EED-targeted PROTAC that can inhibit PRC2 activity. The PROTACs target EED and its associated proteins including EZH2 and SUZ12 for elimination via the ubiquitin proteasome

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS METHOD DETAILS B Expression and Purification of Human PRC2 B Preparation of Biotinylated EED B Surface Plasmon Resonance (SPR) Assay for EED Binding Cell Chemical Biology 27, 1–6, January 16, 2020 5

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

B

Methyltransferase Assay Ternary Complex Formation B Proliferation Assay B Western Blot B Immunoprecipitation (IP) B Cas9/RNP Nuceofection B Reagents B Sample Prep for Global Proteomics Analysis B LC-MS/MS Analysis B Peptide and Protein Identification and Quantification B Mass Spectrometry Analysis of Compound Concentration in Cells B Chemical Synthesis of Compounds QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY B

d d

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. chembiol.2019.11.004. ACKNOWLEDGMENTS

Garapaty-Rao, S., Nasveschuk, C., Gagnon, A., Chan, E.Y., Sandy, P., Busby, J., Balasubramanian, S., Campbell, R., Zhao, F., Bergeron, L., et al. (2013). Identification of EZH2 and EZH1 small molecule inhibitors with selective impact on diffuse large B cell lymphoma cell growth. Chem. Biol. 20, 1329–1339. He, Y., Selvaraju, S., Curtin, M.L., Jakob, C.G., Zhu, H., Comess, K.M., Shaw, B., The, J., Lima-Fernandes, E., Szewczyk, M.M., et al. (2017). The EED protein-protein interaction inhibitor A-395 inactivates the PRC2 complex. Nat. Chem. Biol. 13, 389–395. Huang, Y., Zhang, J., Yu, Z., Zhang, H., Wang, Y., Lingel, A., Qi, W., Gu, J., Zhao, K., Shultz, M.D., et al. (2017). Discovery of first-in-class, potent, and orally bioavailable embryonic ectoderm development (EED) inhibitor with robust anticancer efficacy. J. Med. Chem. 60, 2215–2226. Italiano, A., Soria, J.C., Toulmonde, M., Michot, J.M., Lucchesi, C., Varga, A., Coindre, J.M., Blakemore, S.J., Clawson, A., Suttle, B., and McDonald, A.A. (2018). Tazemetostat, an EZH2 inhibitor, in relapsed or refractory B-cell nonHodgkin lymphoma and advanced solid tumours: a first-in-human, open-label, phase 1 study. Lancet Oncol. 19, 649–659. Kim, K.H., and Roberts, C.W.M. (2016). Targeting EZH2 in cancer. Nat. Med. 22, 128–134. Knutson, S.K., Kawano, S., Minoshima, Y., Warholic, N.M., Huang, K.C., Xiao, Y., Kadowaki, T., Uesugi, M., Kuznetsov, G., Kumar, N., et al. (2014). Selective inhibition of EZH2 by EPZ-6438 leads to potent antitumor activity in EZH2mutant non-Hodgkin lymphoma. Mol. Cancer Ther. 13, 842–854.

The authors thank Sylvie Guichard, James Brownell, Alan Rosen, Nin Guan, Jingwen Zhang, Scott Boiko, Kurt Pike, Beth Williamson, and members of the AstraZeneca drug discovery team for various technical support and helpful discussions throughout the project.

Lai, A.C., and Crews, C.M. (2017). Induced protein degradation: an emerging drug discovery paradigm. Nat. Rev. Drug Discov. 16, 101–114.

AUTHOR CONTRIBUTIONS

Lee, S.T., Li, Z., Wu, Z., Aau, M., Guan, P., Karuturi, R.K., Liou, Y.C., and Yu, Q. (2011). Context-specific regulation of NF-kB target gene expression by EZH2 in breast cancers. Mol. Cell 43, 798–810.

Conceptualization, J.H.-R.H., T.R., and A.B.; Methodology, J.H.-R.H., T.R., S.B., J.R., F.P., J.R., S.K., E.C., P.R., and A.A.; Investigation, J.H.-R.H., T.R., J.R., F.P., S.K., E.Code, P.R., D.H.O’D., A.A., M.S., H.W., E.B., and E.Chiarparin; Resources, R.T., N.G., X.Z., and K.J.; Writing – Original Draft, J.H.-R.H., T.R., J.R., F.P., S.K., E.C., N.G., X.Z., E.Chiarparin, D.H.O., and A.B.; Writing – Review & Editing, J.H.-R.H., D.H.O’D., and A.B.; Supervision, D.M.W., L.D., M.P.C., S.F., and A.B. DECLARATION OF INTERESTS The authors are current or former employees of AstraZeneca. Received: May 31, 2019 Revised: September 3, 2019 Accepted: November 8, 2019 Published: November 27, 2019 REFERENCES Bondeson, D.P., Mares, A., Smith, I.E.D., Ko, E., Campos, S., Miah, A.H., Mulholland, K.E., Routly, N., Buckley, D.L., Gustafson, J.L., et al. (2015). Catalytic in vivo protein knockdown by small-molecule PROTACs. Nat. Chem. Biol. 11, 611–617. Buckley, D.L., Van Molle, I., Gareiss, P.C., Tae, H.S., Michel, J., Noblin, D.J., Jorgensen, W.L., Ciulli, A., and Crews, C.M. (2012). Targeting the von Hippel-Lindau E3 ubiquitin ligase using small molecules to disrupt the VHL/ HIF-1a interaction. J. Am. Chem. Soc. 134, 4465–4468. Dimou, A., Dincman, T., Evanno, E., Gemmill, R.M., Roche, J., and Drabkin, H.A. (2017). Epigenetics during EMT in lung cancer: EZH2 as a potential therapeutic target. Cancer Treat. Res. Commun. 12, 40–48.

6 Cell Chemical Biology 27, 1–6, January 16, 2020

Lawrence, C.L., and Baldwin, A.S. (2016). Non-canonical EZH2 transcriptionally activates RelB in triple negative breast cancer. PLoS One 11, e0165005.

Leeb, M., Pasini, D., Novatchkova, M., Jaritz, M., Helin, K., and Wutz, A. (2010). Polycomb complexes act redundantly to repress genomic repeats and genes. Genes Dev. 24, 265–276. McCabe, M.T., Ott, H.M., Ganji, G., Korenchuk, S., Thompson, C., Van Aller, G.S., Liu, Y., Graves, A.P., Della Pietra, A., 3rd, and Diaz, E. (2012). EZH2 inhibition as a therapeutic strategy for lymphoma with EZH2-activating mutations. Nature 492, 108–112. Morin, R.D., Johnson, N.A., Severson, T.M., Mungall, A.J., An, J., Goya, R., Paul, J.E., Boyle, M., Woolcock, B.W., Kuchenbauer, F., et al. (2010). Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nat. Genet. 42, 181–185. Qi, W., Zhao, K., Gu, J., Huang, Y., Wang, Y., Zhang, H., Zhang, M., Zhang, J., Yu, Z., Li, L., et al. (2017). An allosteric PRC2 inhibitor targeting the H3K27me3 binding pocket of EED. Nat. Chem. Biol. 13, 381–388. Seki, A., and Rutz, S. (2018). Optimized RNP transfection for highly efficient CRI SPR/Cas9-mediated gene knockout in primary T cells. J. Exp. Med. 215, 985–997. Smith, B.E., Wang, S.L., Jaime-Figueroa, S., Harbin, A., Wang, J., Hamman, B.D., and Crews, C.M. (2019). Differential PROTAC substrate specificity dictated by orientation of recruited E3 ligase. Nat. Commun. 10, 131. Xu, K., Wu, Z.J., Groner, A.C., He, H.H., Cai, C., Lis, R.T., Wu, X., Stack, E.C., Loda, M., Liu, T., et al. (2012). EZH2 oncogenic activity in castration-resistant prostate cancer cells is polycomb-independent. Science 338, 1465–1469. Xu, J., Shao, Z., Li, D., Xie, H., Kim, W., Huang, J., Taylor, J.E., Pinello, L., Glass, K., Jaffe, J.D., et al. (2015). Developmental control of polycomb subunit composition by GATA factors mediates a switch to non-canonical functions. Mol. Cell 57, 304–316.

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

FlagM2

Sigma

F3165; RRID: AB_259529

EZH2

Cell Signaling Technology

5246; RRID: AB_10694683

EED

R&D Systems

AF5827; RRID: AB_2246350

GAPDH

Cell Signaling Technology

2118; RRID: AB_561053

SUZ12

Cell Signaling Technology

3737; RRID: AB_561053

EZH1

Invitrogen

PA1-41114; RRID: AB_2102295

Antibodies

H3K27me3

Cell Signaling Technology

9733; RRID: AB_2616029

H3

Cell Signaling Technology

14269; RRID: AB_2756816

VHL

Cell Signaling Technology

68547; RRID: AB_2716279

IgG Isotype Control

Cell Signaling Technology

3900; RRID: AB_1550038

Ubiquitin, clone FK2

Millipore

04-263; RRID: AB_612093

Sf21 Baculovirus expression system

Invitrogen

10359016

E. coli expression strain BL21(DE3)

New England BioLabs

C2527H

MLN4924

Selleckchem

S7109

MG132

Selleckchem

S2619

Cell Lysis Buffer

Cell Signaling Technology

9809

DynabeadsProtein G

ThermoFisher

10009D

Anti-Ub Agarose TUBE2

Lifesensors

UM402

TrueCut Cas9 protein v2

ThermoFisher

A36496

Bacterial and Virus Strains

Chemicals, Peptides, and Recombinant Proteins

Critical Commercial Assays CellTiter Glo Luminescent Cell Viablity Assay

Promega

G7570

Mtase Glo

Promega

N/A

Streptavidin-terbium

CisBio

N/A

Streptavidin-XL665

CisBio

N/A

Trypsin/Lys-C mix

Promega

V5073

This study

ProteomeXchange PRIDE: PXD016107

Deposited Data Global proteomic profiling Experimental Models: Cell Lines Karpas422

DSMZ

ACC 32

G401

ATCC

CRL-1441

NCI-H1299

ATCC

CRL-5803

MDA-MB-231

ATCC

HTB-26

CHP134

ECACC

06122002

DLD1

ATCC

CCL-221

HCC2218

ATCC

CRL-2343

IMR32

ATCC

CCL-127

LNCAP

ATCC

CRL-1740

MCF7

ATCC

HTB-22

MDA-MB453

ATCC

HTB-131

Alt-RCRISPR-Cas9 EED crRNA #1

Integrated DNA Technologies (IDT)

Hs.Cas9.EED.1.AA

Alt-RCRISPR-Cas9 EED crRNA #2

Integrated DNA Technologies (IDT)

Hs.Cas9.EED.1.AB

Oligonucleotides

(Continued on next page)

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e1

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Alt-RCRISPR-Cas9 EED crRNA #3

Integrated DNA Technologies (IDT)

Hs.Cas9.EED.1.AC

Alt-RCRISPR-Cas9 tracrRNA

Integrated DNA Technologies (IDT)

1072534

None-targeting control crRNA sequence: GTAGCGAACGTGTCCGGCGT

Integrated DNA Technologies (IDT)

CTRL0001 (Custom-made)

pFastBac EZH2

This study

pAZB0549

pFastBac FLAG EED

This study

pAZB0547

pFastBac SUZ12

This study

pAZB0543

pFastBac AEBP2

This study

pAZB0542

pFastBac RBBP4

This study

pAZB0541

Recombinant DNA

Software and Algorithms Proteome Discoverer 2.1

Thermo Fisher

N/A

GraphPad Prism 8

GraphPad Software

https://www.graphpad.com/

Perseus

Max Planck Institute of Biochemistry

https://maxquant.net/perseus/

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Andrew Bloecher. There are restrictions to the availability of chemical reagents (Compounds 1 - 6) due to proprietary reasons, however, we have provided full experimental details for the preparation of these reagents from commercial sources in this paper. EXPERIMENTAL MODEL AND SUBJECT DETAILS Karpas422 (female) cell line was obtained from DSMZ. All the other cell lines including G401 (male), NCI-H1299 (male), MDA-MB-231 (female), DLD1 (male), HCC2218 (female), IMR32 (male), LNCAP (male), MCF7 (female), and MDA-MB-453 (female) were obtained from ATCC. CHP134 (male) cell line was obtained from ECACC. Cancer cell lines were grown in recommended growth media supplemented with 10% FBS and 1% L-Glutamine at 37 C and 5% CO2. All cell lines were authenticated and tested negative for mycoplasma contamination. The Sf21 baculovirus expression system was purchased from Invitrogen. The E.Coli expression strain used was BL21(DE3). METHOD DETAILS Expression and Purification of Human PRC2 PRC2 is a 5-member complex, which was formed with the following members: human EZH2 (GenBank: NM_004456) untagged(MW= 86 kDa), human EED (GenBank: NM_003797) with N-terminal Flag-tag(MW= 51 kDa), human SUZ12 (GenBank: NM_015355) untag (MW = 87 kDa), Human AEBP2 (GenBank: NM_153207) (amino acids 1-295, MW= 33 kDa), and human RbAp48 (GenBank: NM_005610, MW = 48 kDa). The members of the complex were individually cloned into pFastBac1. All the subunits were co-expressed in baculovirus expression system. Sf21 cells were co-infected with five viruses at a density of 2 x106 cells/ml in Sf-900 III SFM (Invitrogen). Sf21 cells were harvested by centrifugation 48 hr post infection. Cell pastes were stored at -20 C. The frozen cells were suspended in Buffer A consisting of 25 mM Tris HCl, pH 8.0, 150 mM NaCl, 2 mM MgCl2, 1mM DTT, 0.4 mM EDTA, 0.005% Triton X-100, and 10% glycerol, supplemented with protease inhibitor cocktail tablets (Roche Molecular Biochemical). Cells were lysed by sonication and clarified by centrifugation at 150,000 g, for 40 min at 4 C. The supernatant was then incubated with M2-agarose beads (Sigma) preequilibrated with Buffer B with the composition of 25 mM Tris HCl, pH 8.0, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, 0.4 mM EDTA, 0.005% Triton X-100, and 10% glycerol for 1 hr, and then extensively washed with 20 CV of buffer B. Proteins were eluted with 15 min incubations with 150 mg/ml 3X-FLAG peptide (Sigma). The fractions containing PRC2 complex were pooled and concentrated using Amicon ultra 100 kDa MWCO concentrators (Millipore). Concentrated sample was then applied onto a size exclusion chromatography Superdex200 Hiload 16/60 (GE healthcare) preequilibrated with buffer B at a flow rate of 1.0 mL/min. The PRC2 fractions were identified by SDS-PAGE, and pooled and concentrated. Protein concentration was determined by absorbance at 280 nm. Protein was snap frozen with liquid nitrogen and store at -80 C. Preparation of Biotinylated EED The EED gene from H. sapiens was custom-synthesized with N-terminal His6 tag, thrombin protease cleavage site and AVI tag (Life Technology). The synthetic gene comprising H. sapiens EED (Uniprot: O75530) was cloned into pET28a(+) as His6-ThrombinTEV-EED using NdeI and XhoI restriction sites to create plasmid pAZB0739. The EED was transformed into E. coli expression strain e2 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

BL21(DE3) and expressed with 0.25 mM IPTG at 16 C overnight. The frozen cell paste from 2 L of cell culture was suspended in 50 ml of Buffer A consisting of 25 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5% (v/v) glycerol, supplemented with 1 EDTA-free protease inhibitor cocktail tablet (Roche Molecular Biochemical). Cells were disrupted by French pressure at 18,000 psi twice at 4 C, and the crude extract was centrifuged at 150,000 g (45Ti rotor, Bechman-Coulter) for 30 min at 4 C. The supernatant was applied at a flow rate of 2.0 ml/min onto a 5-ml HiTrap Ni2+ chelating column (GE Healthcare Life Sciences) pre-equilibrated with Buffer A. The column was washed with Buffer A, and EED was eluted by a linear gradient from 0 M to 0.5 M imidazole in Buffer A. Fractions containing EED were pooled. And EED was biotinylated by using BirA biotin-protein ligase standard reaction kit (Avidity) and the biotinylation was confirmed by analytical LC-MS. To remove free biotin, the EED biotinylation reaction mixture was concentrated to 5 ml by Amicon Ultracel-10K (Millipore, Billerica, MA). The 5 ml sample was applied at a flow rate of 1.5 ml/min to a 120-ml Superdex 200 (HR 16/60) (GE Healthcare Life Sciences) pre-equilibrated with Buffer B consisting of 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, 1 mM dithiothreitol, 5% (v/v) glycerol. The fractions containing biotinylated EED were pooled and concentrated by Amicon Ultracel-10K (Millipore). The protein concentration was determined by Bradford method and characterized by SDS-PAGE analysis. The final yield of purified biotinylated EED was 12 mg from 2 L of cell culture. The protein was stored at –80 C. Surface Plasmon Resonance (SPR) Assay for EED Binding A Biacore T200 or 8K instrument (GE Healthcare) was used to monitor binding interactions via SPR. 10 mg/mL 6His-AVI-EED (1 441) was injected for 180 seconds on a streptavidin Biacore chip (GE Healthcare) at a flow rate of 10 mL/min in buffer containing 20 mM HEPES, 150 mM NaCl, 1 mM TCEP, 0.005% tween-20 (filtered), 1% DMSO (v/v), pH 7.5 at 25 C. Typical immobilization density was 6000-8000 RU. The surface was blocked with 1 min. injection of 50 mM PEG-amine-biotin. Reference flow cells were prepared without protein. All binding measurements were performed in the buffer used for immobilisation, at 25 C. Prior to analysis, solvent calibration and double referencing subtractions were made to eliminate bulk refractive index changes, injection noise, and data drift. Affinity and binding kinetic parameters were determined by global fitting to a 1:1 binding model within the Biacore Evaluation software (GE Healthcare). Methyltransferase Assay PRC2 methyltransferase activity is determined using a luminescent coupled assay, Promega Mtase-Glo, to detect transfer of methyl groups from S-adenosylmethionine (SAM, Promega) to Lysine 27 of Histone H3 peptide 21-44 (Anaspec) by following production of the product S-adenosylhomocysteine (SAH). The methyltransferase portion of the assay is performed in a reaction volume of 4 ul containing 10 uM SAM, 20 uM peptide, and 20 nM PRC2 enzyme complex (Human EZH2, Flag-EED, SUZ12, AEBP2 and RbAp48, AstraZeneca) in 20 mM Bicine pH 8.5, 0.01% triton x 100, 0.01% BSA, 0.5 mM DTT. The Mtase-Glo assay is run in 5 steps. In step 1, SAM and peptide are added to 384 well compound plates (Greiner 784075) for a final DMSO of 1%. In step 2, the reaction is initiated by addition of PRC2 enzyme and incubated at RT for 3 hours. In step 3, methyltransferase activity is stopped by addition of trifluoracetic acid (TFA, Sigma) for a final of 0.2%. In step 4, 6X Mtase-Glo reagent (in reaction buffer supplemented for a final concentration of 3 mM MgCl2 and 50 mM NaCl) is added to convert SAH into ADP for 30 minutes at RT. In step 5 (30 minutes RT), ADP is converted to ATP and then to light by addition of Mtase–Glo detection solution (contains luciferase). The final coupled reaction volume is 12 ul. Luminescence is read on a PHERAStar reader and quantitated by comparison to a SAH (Promega) standard curve. Ternary Complex Formation Formation of ternary complexes composed of EED, PROTAC and VHL was monitored by time-resolved fluorescence energy transfer from a terbium donor to an XL665 acceptor. Assays were carried out in black 384-well low volume microplates (Greiner Bio-One, catalog no. 784900) in a total volume of 10 mL. Compounds were dispensed in the assay plate using a Hewlett Packard HP D300 digital dispenser (TECAN). Mix 1 was prepared by preincubating 2 nM biotin-EED with 2 nM of streptavidin-terbium (Cis-Bio) for 15 min in Buffer C [50 mM Tris pH 7.5, 100 mM NaCl, 1 mM TCEP, 0.01% (w/v) pluronic F127, 1% (v/v) DMSO]. Mix 2 was prepared by preincubating 40 nM biotin-VHL with 40 nM streptavidin-XL665 (Cis-Bio) for 15 min also in Buffer C. Mix1 and Mix2 were then mixed at a ratio of 1:1 to give the following final concentrations: 1 nM biotin-EED:1 nM streptavidin-terbium complex and 20 nM biotin VHL:20 nM streptavidin-XL665 complex. This solution was then added to the assay plate containing the compounds and incubated for 3 h prior to fluorescence measurements [lex = 337 nm (laser), terbium emission (l = 620 nm), sensitized emission (l = 665 nm)] using a PHERAstar FSX multimode reader (BMG LABTECH). Fluorescence data were normalized by taking the ratio of the sensitized emission to the terbium emission (TR-FRET ratio) and plotted versus the compound concentration as shown in Figure 2C. Proliferation Assay Tumor cell lines were seeded onto 96-well tissue culture treated plates containing compound dilution from 30mM to 0.005mm (10 point, 3-fold dilution). Karpas422 cells were split every 4 days and cell viability was determined by CellTiter-Glo Luminescent Cell Viability Assay (Promega) from day 4-14. For adherent cell lines, cell viability was measured 7 or 10 days after seeding. Luminescence readings were normalized to day 0 and the DMSO control readings. Dose-response curves were analyzed using Prism software (GraphPad) or Genedata Screener.

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e3

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Western Blot Cells were lysed in lysis buffer (100mM Tris-HCl, pH7.4, 10% glycerol, and 1%SDS). The lysates were boiled briefly for 5 minutes and then centrifuged at maximum speed at 4 C for 15 minutes. Protein quantification was done using the Bio-Rad DCTM Protein Assay kit according to the manufacturer’s protocol. 5-20mg of protein were loaded onto 4-12% NuPAGE Bis-Tris protein gels, transferred to PVDF membranes, and probed with antibodies of interest. Antibodies against the following proteins were used: Flag M2 (Sigma: F3165), EZH2 (CST:#5246), EED (R&D Systems: AF5827), GAPDH(CST:#2118), SUZ12(CST:#3737) EZH1 (Invitrogen: PA141114), H3K27me3 (CST:#9733), VHL(CST:#68547) and Histone H3(CST: #14269). CST, Cell Signaling Technology. Western blot images were quantified using ImageQuant TL (General Electric Company). Immunoprecipitation (IP) Cells were lysed in 1x cell lysis buffer (CST: #9803) containing protease inhibitor cocktail (Roche). Protein lysates were pre-cleared and quantified. Cell lysates and Dynabeads Protein G (ThermoFisher) were incubated with anti- EZH2, anti- EED, anti-ubiquitinylated protein (Millipore: 04-263) or IgG isotype control antibody (CST:#3900) overnight at 4 C. The beads were washed three times with 1x cell lysis buffer the following day. The immunoprecipitated proteins were eluted by heating the samples in 2x SDS sample to 95 C. TUBE (tandem Ubiquitin Binding Entity)-based IP was conducted by incubating cell lysates with agarose-TUBE2 (Lifesensors: UM402) overnight at 4 C. The beads were washed three times with 1x cell lysis buffer ,and then the proteins were eluted as described above. Cas9/RNP Nuceofection Preparation of crRNA-tracrRNA duplex, pre-complexing of Cas9/RNA, and nucleofection using a 4D-nucleofector (Lonza) were previously described (Seki and Rutz, 2018). Briefly, we mixed three EED specific crRNA-tracrRNA (IDT:Hs.Cas9.EED.1.AA, AB; Alt-R CRISPR-Cas9 tracrRNA) duplexes ( 3mL of each crRNA-tracrRNA equal to 150pmol, total of 9mL) and 6mL(180pmol) TrueCut Cas9 protein v2 (Thermo Fisher) at room temperature for 10 minutes. 20mL of cells(200,000 cells) in SF Cell Line Nucleofector  Solution was combined with the Cas9/RNP mixture for 2 minutes at room temperature, followed by electroporation using a 4D nucleofector (Lonza). Reagents MLN4924 and MG132 were purchased from Selleckchem. Sample Prep for Global Proteomics Analysis 2 million Karpas422 cells were treated with DMSO or 1uM PROTAC in biological triplicates for 24h, and cells were harvested by trypsination. Lysis buffer (8 M urea, 50 mM NaCl, 50mM Tris-HCl, pH 8.5, 1% SDS, 1x Pierce HALT Protease and Phosphatase Inhibitor Cocktail) was added to the cell pellets, cells were homogenized by sonication and protein concentration was determined by DC Protein Assay (Bio-Rad). 50mg protein for each sample were reduced by TCEP (tris(2-carboxyethyl)phosphine hydrochloride) and alkylated using MMTS (methyl methanethiosulfonate) followed by protein precipitation using methanol/ chloroform. Precipitated protein was resuspended in 4 M urea, 50 mM Tris HCl, pH 8.5 for digestion with Lys-C (1:50) for 12h at room temperature, diluted to 0.5 M urea, 50mM Tris-HCl, pH 8.5, and digested with trypsin (1:50) for another 6h at room temperature. Peptide samples were labeled with TMT 6-plex (Thermo Fisher Scientific) at a ratio of 4:1 TMT reagent : sample according to manufacturer’s instructions. Labeled peptides were combined into a single sample and desalted using C18 solid phase extraction cartridges (Sep-Pak, Waters). Samples were then subjected to offline fractionation by high pH reverse-phase HPLC (Agilent 1200) on a Gemini C18 column (5 uM, 110 A˚, 150 x 2 mm; Phenomenex) with 20mM ammonium hydroxide in water as mobile phase A and 20 mM ammonium hydroxide in acetonitrile. The 96 resulting fractions were pooled in a non-continuous manner into 24 fractions and every fraction was used for subsequent mass spectrometry analysis. LC-MS/MS Analysis Nanoflow LC-MS/MS was performed by coupling an easy-nLC 1200 (Thermo Fisher Scientific) to a Q Exactive HF (Thermo Fisher Scientific). Peptides were trapped on an Acclaim Pepmax column (2 cm x 75 um, 3um, 100 A˚; Themro Fisher) in water with 0.1% formic acid (FA)and separated on a C18 EASY-spray column (50 cm x 75 um, 2 um, 100 A˚, Thermo Fisher Scientific) at 45 C. Gradient elution was performed from 2% acetonitrile to 30% acetonitrile in 0.1% formic acid over 2h at 250 nL/min flow rate. The Q Exactive HF mass spectrometer was operated in data dependent top 12 mode. Full scan MS spectra were acquired at 60,000 resolution after accumulation to a target value of 3e6 ions. Higher energy collisional dissociation (HCD) scans were performed with 34% NCE at 60,000 resolution and the ion target settings was set to 5e5 after accumulation for max 140ms.

e4 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Peptide and Protein Identification and Quantification RAW mass spectral data was processed using Proteome Discoverer 2.1 (Thermo Fisher Scientific) for peptide and protein identification and TMT quantification, and MS/MS spectra were searched against a SwissProt human database (January 2017). Search parameters were the following: full tryptic specificity with up to two missed cleavage sites, a precursor mass tolerance of 10 ppm, fragment ion mass tolerance of 0.02 Da, static methylthio alkylation of cysteine (45.988 Da), dynamic TMT labeling of lysine residues and peptide N-termini (229.163 Da), and dynamic oxidation of methionine (15.995 Da) and acetylation of protein N-termini (42.011 Da). Peak integration for TMT reporter ion intensities was done within a 20 ppm mass window and spectra with a co-isolation value >50 were excluded from quantification. Search results were filtered to a maximum false discovery rate (FDR) of 0.01 for proteins and peptides. Statistical analysis was performed in Perseus and Excel, and GraphPad Prism was used for visualization. Statistical significance between each pair of groups was calculated using Student’s T-test and p-values were adjusted for multiple testing to control the false discover rate at 5%. Data are available via ProteomeXchange with identifier PXD016107. Mass Spectrometry Analysis of Compound Concentration in Cells G401 cells were treated with 10mM of compounds 1, 2 and 3 for 2 hours. Cells were trypsinised, washed three times with ice-cold PBS and counted, before lysing in RIPA buffer. For cellular fractionation experiments, cells were processed using the ThermoFisher subcellular fractionation kit (78840). Samples were analysed by UPLC-MS utilising a Waters Xevo TQ-XS (WBA0259) and an Acquity UPLC system from Waters consisting of Sample Manager (M16UFL953M), Acquity PDA (F17UPD457A), Column Oven (E17CMP703G) and Binary Solvent Manager (E17BUR621G). Chemical Synthesis of Compounds General Information All solvents and chemicals used were reagent grade. Anhydrous solvents THF, DCM and DMF were purchased from Aldrich. Flash column chromatography was carried out using prepacked silica cartridges (from 4 g up to 330 g) from RedisepTM or Silicycle and eluted using an Isco Companion system. Purity and characterization of compounds were established by a combination of liquid chromatography-mass spectroscopy (LC-MS), gas chromatography-mass spectroscopy (GC-MS) and NMR analytical techniques and was >95% for all test compounds. 1H NMR were recorded on a Varian INOVA (600 MHz), Varian Gemini 2000 (300 MHz) or Bruker Avance DPX400 (400 MHz) and were determined in CDCl3, DMSO-d6 or MeOH-d4. Chemical shifts are reported in ppm relative to TMS (0.00 ppm) or solvent peaks as the internal reference. Splitting patterns are indicated as follows: s, singlet; d, doublet; t, triplet; m, multiplet; br, broad peak. Elevated temperatures were used where necessary to sharpen broad NMR peaks due to rotamers and the temperature used is noted for such compounds. Merck precoated TLC plates (silica gel 60 F254, 0.25 mm, art. 5715) were used for TLC analysis. Abbreviations used: DIPEA, N,N-diisopropylethylamine; EtOAc, ethyl acetate; EtOH, ethanol; MeOH, methanol; HATU, 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate; pTSA, 4-methylbenzenesulfonic acid; DIAD, diisopropyl (E)-diazene-1,2-dicarboxylate; n-BuOH, n-butanol; ether, diethylether; TEA, triethylamine; DMF, dimethylformamide; DCM, dichloromethane; THF, tetrahydrofuran; TFA, trifluoroacetic acid. Scheme 1. Synthesis of cpd 1, Capped VHL Ligand.

Reagents and conditions: (a) Acetic anhydride, Et3N, DMSO, rt, 81%.

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e5

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

(2S,4R)-1-((S)-2-acetamido-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (Capped VHL Ligand).

A vial was charged with acetic anhydride (0.017 mL, 0.18 mmol) and (2S,4R)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (7, 69 mg, 0.16 mmol). Et3N (0.068 mL, 0.48 mmol) was added and the reaction was stirred for 4.5 h. Solvents were removed in vacuo and the mixture was purified by C18-flash chromatography, using gradient elution of MeCN in water (with 0.1 % formic acid). The purified fractions were combined and evaporated to afford the desired product (2S,4R)-1-((S)-2-acetamido-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (Capped VHL ligand, 61 mg, 81%). 1H NMR (400 MHz, DMSO-d6) d 8.98 (s, 1H), 8.54 (t, J = 6.0 Hz, 1H), 7.92 (d, J = 9.4 Hz, 1H), 7.35 – 7.46 (m, 4H), 5.10 (d, J = 3.6 Hz, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.38 – 4.48 (m, 2H), 4.36 (s, 1H), 4.22 (dd, J = 15.8, 5.5 Hz, 1H), 3.66 (d, J = 4.0 Hz, 2H), 2.45 (s, 3H), 1.91 (s, 2H), 1.89 (s, 3H), 0.94 (s, 9H). 13C NMR (126 MHz, DMSO, 27 C) 172.41, 170.16, 169.57, 152.00, 148.06, 140.02, 131.71, 130.05, 129.11, 127.90, 69.35, 59.15, 56.88, 56.85, 42.12, 38.43, 35.66, 26.83, 22.80, 16.35. HRMS (ESI+): m/z found [M+ H]+ 473.2213, C24H32N4O4S requires 473.2223. Scheme 2. Synthesis of cpd 2, PROTAC 1.

Reagents and conditions: (a) HATU, Et3N, DMF, rt, 85%; (b) HCl, dioxane, rt, 23%; (c) HATU, DIPEA, DMF, 76%.

e6 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

tert-butyl N-[5-[[(1S)-1-[(2S,4R)-4-hydroxy-2-[[4-(4-methylthiazol-5-yl)phenyl]methylcarbamoyl]pyrrolidine-1-carbonyl]-2,2-dimethylpropyl]amino]-5-oxo-pentyl]carbamate (8).

Et3N (2.59 mL, 18.58 mmol) and HATU (2.65 g, 6.97 mmol) were added to (2S,4R)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (7, 2.0 g, 4.65 mmol) and 5-((tert-butoxycarbonyl)amino)pentanoic acid (1.009 g, 4.65 mmol) in DMF (30 mL) at 25 C . The reaction mixture was stirred at 25 C for 1 h. The reaction mixture was diluted with EtOAc (500 mL) and washed with saturated brine. The organic layer was dried over Na2SO4, filtered and evaporated to afford crude product. The crude product was purified by flash silica chromatography, elution gradient 0 to 5% MeOH in DCM. Pure fractions were evaporated to dryness to afford tert-butyl (5-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl) pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-5-oxopentyl)carbamate (8, 2.50 g, 85 %) as a yellow solid. 1H NMR (300 MHz, DMSO-d6) d 8.99 (s, 1H), 8.57 (t, J = 6.0 Hz, 1H), 7.84 (d, J = 9.3 Hz, 1H), 7.48 – 7.33 (m, 4H), 6.78 (s, 1H), 5.13 (d, J = 3.5 Hz, 1H), 4.54 (d, J = 9.4 Hz, 1H), 4.50 – 4.32 (m, 3H), 4.22 (dd, J = 15.9, 5.4 Hz, 1H), 3.66 (d, J = 4.8 Hz, 2H), 2.89 (q, J = 6.3 Hz, 2H), 2.45 (s, 3H), 2.31 – 1.82 (m, 5H), 1.52 – 1.41 (m, 2H), 1.37 (s, 9H), 1.33 (d, J = 7.0 Hz, 1H), 0.94 (s, 9H). m/z: ES+ [M+H]+ = 630. (2S,4R)-1-[(2S)-2-(5-aminopentanoylamino)-3,3-dimethyl-butanoyl]-4-hydroxy-N-[[4-(4-methylthiazol-5-yl)phenyl]methyl]pyrrolidine-2-carboxamide (9).

HCl (4.0 M in dioxane) (28.6 mL, 114.32 mmol) was added to tert-butyl (5-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl) benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-5-oxopentyl)carbamate (8, 2.40 g, 3.81 mmol) and the mixture was stirred at 25 C for 2 h. Solvent was removed under reduced pressure. The crude product was purified by reverse phase HPLC using a gradient of MeCN and water (containing 0.05% TFA w/w). Pure fractions were evaporated to dryness to afford (2S,4R)1-((S)-2-(5-aminopentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (9, 0.500 g, 23 %) as a white solid. 1H NMR (300 MHz, DMSO-d6) d 9.00 (s, 1H), 8.58 (t, J = 6.1 Hz, 1H), 7.92 (d, J = 9.3 Hz, 1H), 7.75 (s, 3H), 7.42 (p, J = 8.6, 8.2 Hz, 4H), 4.56 (d, J = 9.3 Hz, 1H), 4.43 (td, J = 15.0, 13.7, 9.6 Hz, 3H), 4.22 (dd, J = 16.0, 5.4 Hz, 1H), 3.85 - 3.39 (m, 2H), 2.79 (q, J = 6.2 Hz, 2H), 2.52 (s, 1H), 2.45 (s, 3H), 2.37 - 2.24 (m, 1H), 2.17 (dt, J = 12.5, 6.1 Hz, 1H), 2.11 1.99 (m, 1H), 1.91 (ddd, J = 13.0, 8.7, 4.6 Hz, 1H), 1.52 (dd, J = 8.6, 4.2 Hz, 4H), 0.95 (s, 9H). m/z (ES+), [M+H]+ = 530. (2S,4R)-1-((S)-2-(5-(3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanamido)pentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (PROTAC 1).

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e7

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

(2S,4R)-1-((S)-2-(5-aminopentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (9, 262 mg, 0.50 mmol) was dissolved in DMF (0.8 mL). HATU (7.91 mg, 0.02 mmol) was added, followed by DIPEA (0.236 mL, 1.35 mmol), then 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6methylpyridin-2-yl)propanoic acid (10, 202 mg, 0.45 mmol) was added and the reaction stirred for 16 h at 25 C. Solvents were removed in vacuo and the residue was purified by preparative HPLC (Waters XSelect CSH C18 ODB column, 5m silica, 30 mm diameter, 100 mm length), using decreasingly polar mixtures of water (containing by volume 1% NH4OH (28-30% in H2O)) and MeCN as eluents. Fractions containing the desired compound were evaporated to dryness to afford 3-((5-amino-2-(1H-pyrazol-5-yl)pyrazolo [1,5-a]pyrimidin-7-yl)amino)propan-1-ol (PROTAC 1, 367 mg, 76%) as a white solid. 1H NMR (300 MHz, MeOD-d4) d 9.64 (s, 1H), 9.26 (s, 1H), 8.73 (t, J = 7.5 Hz, 1H), 8.10 (dd, J = 15.5, 7.5 Hz, 2H), 7.66 – 7.73 (m, 4H), 7.06 – 7.16 (m, 1H), 6.92 (dd, J = 8.6, 3.8 Hz, 1H), 4.7 – 4.9 (m, 7H), 4.62 (d, J = 15.5 Hz, 1H), 4.14 (d, J = 11.0 Hz, 1H), 4.05 (dd, J = 11.0, 3.8 Hz, 1H), 3.64 (m, 5H), 3.46 (d, J = 6.6 Hz, 2H), 3.09 (t, J = 6.6 Hz, 2H), 2.94 (d, J = 10.2 Hz, 3H), 2.73 (s, 3H), 2.56 (h, J = 7.0 Hz, 2H), 2.43 – 2.49 (m, 1H), 2.33 (ddd, J = 13.2, 9.2, 4.5 Hz, 1H), 1.82 (m, 4H), 1.28 (s, 9H). 5 exchangeable protons not observed. 13C NMR (126 MHz, MeOD-d4) d 175.6, 174.5, 173.5, 172.3, 160.5, 160.3, 158.4, 157.6, 157.1, 156.5, 154.4, 153.3, 148.8, 146.4, 146.3, 140.5, 132.4, 131.2, 130.5, 130.5, 130.4, 130.4, 129.4, 129.0, 125.5, 122.2, 122.0, 115.2, 115.1, 110.0, 109.9, 107.4, 73.0, 71.1, 61.1, 60.8, 59.1, 58.0, 49.9, 49.7, 49.7, 43.7, 40.1, 39.1, 39.0, 39.0, 37.5, 36.6, 36.0, 34.6, 30.0, 29.8, 29.8, 29.7, 27.0, 24.1, 19.1, 15.6. HRMS (ESI+): m/z found [M+ H]+ 960.4323, C50H58N11O6SF requires 960.4355. Scheme 3. Synthesis of Intermediate 10.

Reagents and conditions: (a) (3-ethoxy-3-oxopropyl)zinc(II) bromide, Pd(PPh3)4, THF, 85 C, 16 h, 60%; (b) Bis(pinacolato)diboron, Pd(dppf)Cl2.CH2Cl2, , dioxane, 85 C, 8 h; (c) Pd(dppf)Cl2, Cs2CO3, dioxane/H2O, 90 C, 4 h; (d) LiOH, THF/MeOH/H2O, 30% over 3 steps.

e8 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

ethyl 3-(5-bromo-6-methylpyridin-2-yl)propanoate (11).

A mixture of Pd(PPh3)4 (0.593 g, 0.51 mmol) and 3,6-dibromo-2-methylpyridine (1.95 g, 7.77 mmol) under N2 was treated with (3-ethoxy-3-oxopropyl)zinc(II) bromide 0.5 M in THF (23.3 mL, 11.66 mmol) at rt. The reaction was heated to 85 C overnight. Solvents were removed in vacuo and the residue was purified by flash silica chromatography, elution gradient 0 to 25% EtOAc in heptane. Pure fractions were evaporated to dryness to afford ethyl 3-(5-bromo-6-methylpyridin-2-yl)propanoate (11, 1.27 g, 60%) as a colourless oil. 1H NMR (400 MHz, CDCl3) d 7.70 (1H, d), 6.92 (1H, d), 4.14 (2H, q), 3.05 (2H, t), 2.78 (2H, t), 2.64 (3H, s), 1.25 (3H, t). m/z: ES+ [M+H]+ = 272. ethyl 3-(6-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-yl)propanoate (12).

Ethyl 3-(5-bromo-6-methylpyridin-2-yl)propanoate (11, 1.3 g, 4.78 mmol) was dissolved in degassed dioxane (23.88 mL) to which potassium acetate (1.172 g, 11.94 mmol), Pd(dppf)Cl2.CH2Cl2 (0.390 g, 0.48 mmol) and 4,4,4’,4’,5,5,5’,5’-octamethyl-2,2’-bis(1,3,2dioxaborolane) (1.820 g, 7.17 mmol) were added. The reaction was heated to 100 C for 5 h, then additional Pd(dppf)Cl2.CH2Cl2 (0.390 g, 0.48 mmol) was added and the reaction heated for an additional 3 h and cooled to rt. The mixture was diluted with EtOAc (50 mL) and filtered through a plug of celite. Solvents were stripped in vacuo to afford the crude product 12 as a black tar which was used immediately without further analysis or isolation. 3-[5-[5-[(5-fluoro-2,3-dihydrobenzofuran-4-yl)methylamino]-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl]-6-methyl-2-pyridyl]propanoic acid (10).

A mixture of crude ethyl 3-(6-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridin-2-yl)propanoate (12, 1.543 g, 4.83 mmol), 8-bromo-N-((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)-[1,2,4]triazolo[4,3-c]pyrimidin-5-amine (13, 1.10 g, 3.02 mmol), cesium carbonate (1.968 g, 6.04 mmol) and Pd(dppf)Cl2 (0.247 g, 0.30 mmol) in dioxane (12.59 mL) and water (2.52 mL) was degassed with N2 for 5 min, then heated to 90 C under N2 for 4 h. The reaction was cooled to rt, diluted with EtOAc (100 mL) and filtered through celite. Solvents were removed in vacuo and the residue was purified by flash silica chromatography, elution gradient 0 to 7% MeOH in DCM. Pure fractions were evaporated to dryness to afford the intermediate ester as a black gum. This was redissolved in 5 mL THF to which 2.5 mL H2O and 2.5 mL MeOH were added followed by lithium hydroxide hydrate (0.127 g, 3.02 mmol) and the reaction was stirred at rt for 1.5 h. Solvents were stripped in vacuo and the residue was transferred to a seperating funnel with 100 mL EtOAc and 50 mL 1M NaOH. The organic phase was discarded and the aqueous phase brought to pH 7.0 with dropwise HCl. The organic phase was extracted with 10% MeOH in DCM (4 x 100 mL) and solvents removed Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e9

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

in vacuo to afford 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin2-yl)propanoic acid (10, 0.400 g, 29.5 %) as an off-white solid. 1H NMR (500 MHz, MeOD-d4) d 9.35 (1H, s), 7.90 (1H, s), 7.72 (1H, s), 7.43 (1H, s), 6.75 – 6.94 (1H, m), 6.65 (1H, dd), 4.58 (2H, t), 3.40 (2H, t), 3.15 – 3.22 (2H, m), 2.82 (2H, t), 2.50 (3H, s). 2Hs obscured by solvent peak. m/z: ES+ [M+H]+ = 449. Scheme 4. Synthesis of cpd 3, PROTAC 2.

Reagents and conditions: (a) methyl 2-bromoacetate, K2CO3, DMF, rt, 4 h, 85%; (b) Pd/C, H2, 50 C, MeOH, 97%; (c) Cs2CO3, DMF, rt, 2 days, 79%; (d) NaOH aq., MeOH, rt, 16 h, 94%; (e) HATU, Et3N, DMF, 2 h, 96%; (f) 4M HCl/dioxane, DCM, rt, 1 h, 86%; (g) HATU, Et3N, DMF, rt, 16 h, 67%. Methyl 2-(4-(benzyloxy)phenoxy)acetate (14).

e10 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

K2CO3 (4.14 g, 29.96 mmol) was added to a mixture of 4-(benzyloxy)phenol (2.0 g, 9.99 mmol) and methyl 2-bromoacetate (1.681 g, 10.99 mmol) in DMF (30 mL). The resulting mixture was stirred at 25 C for 4 h. The reaction mixture was diluted with EtOAc (50 mL), and washed sequentially with water (50 mL) then saturated brine (20 mL). The organic layer was dried over Na2SO4, filtered and evaporated to afford the crude product which was purified by flash silica chromatography, elution gradient 0 to 10% EtOAc in petroleum ether. Pure fractions were evaporated to dryness to afford methyl 2-(4-(benzyloxy)phenoxy)acetate (14, 2.300 g, 85 %) as a white solid. 1H NMR (300 MHz, MeOD-d4) d 7.72 – 7.09 (m, 5H), 7.02 – 6.64 (m, 4H), 5.02 (s, 2H), 4.64 (s, 2H), 3.77 (s, 3H). m/z: ES+ [M+H]+ = 295. ethyl 2-(4-hydroxyphenoxy)acetate (15).

10% Pd/C (0.907 g, 8.52 mmol) was added to a solution of methyl 2-(4-(benzyloxy)phenoxy)acetate (14, 4.64 g, 17.04 mmol) in MeOH (3 mL).The resulting mixture was stirred at 50 C for 16 h under a hydrogen atmosphere. The reaction mixture was filtered through silica gel and solvents evaporated to dryness to afford methyl 2-(4-hydroxyphenoxy)acetate (15, 3.00 g, 97 %) as a white solid. 1H NMR (300 MHz, MeOD-d4) d 6.88 – 6.50 (m, 4H), 4.59 (s, 2H), 3.76 (s, 3H). m/z (ES+), [M+Na]+ = 205. ethyl 2-[4-[2-(tert-butoxycarbonylamino)ethoxy]phenoxy]acetate (16).

To a solution of ethyl 2-(4-hydroxyphenoxy)acetate (15, 240 mg, 1.22 mmol) in DMF (3 mL) was added cesium carbonate (399 mg, 1.22 mmol). The mixture was stirred at rt for 30 min, then tert-butyl (2-bromoethyl)carbamate (356 mg, 1.59 mmol) was added neat and the reaction was stirred at rt for 2 days. The reaction mixture was diluted with EtOAc and washed with 1M HCl then sat aq. NaHCO3. The organic phase was dried over Na2SO4, filtered and concentrated to afford ethyl 2-(4-(2-((tert-butoxycarbonyl) amino)ethoxy)phenoxy)acetate (16, 329 mg, 79 %) as a yellow oil. 1H NMR (500 MHz, CD2Cl2-d2) d 6.83 (m, 2H), 6.77 (d, 2H), 4.90 - 5.08 (s, 1H), 4.55 (s, 2H), 4.22 (q, 2H), 3.95 (t, 2H), 3.41 - 3.53 (m, 2H) 1.40 - 1.50 (m, 9H), 1.27 (t, 3H). m/z (ES+), [M+Na]+ = 348. 2-[4-[2-(tert-butoxycarbonylamino)ethoxy]phenoxy]acetic acid (17).

To a solution of ethyl 2-(4-(2-((tert-butoxycarbonyl)amino)ethoxy)phenoxy)acetate (16, 320 mg, 0.94 mmol) in MeOH (5 mL) was added 1M aq. NaOH (3 mL, 3.00 mmol) and the reaction was stirred overnight at rt. The reaction mixture was diluted with EtOAc and washed with 1M HCl, then brine. The organic phase was dried over Na2SO4, filtered and concentrated to afford 2-(4-(2-((tertbutoxycarbonyl)amino)ethoxy)phenoxy)acetic acid (17, 275 mg, 94 %) which was used without further purification. m/z: ES- [MH]- = 310. tert-butyl N-[2-[4-[2-[[(1S)-1-[(2S,4R)-4-hydroxy-2-[[4-(4-methylthiazol-5-yl)phenyl]methylcarbamoyl]pyrrolidine-1-carbonyl]2,2-dimethyl-propyl]amino]-2-oxo-ethoxy]phenoxy]ethyl]carbamate (18).

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e11

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Et3N (1.209 mL, 8.67 mmol) was added to a mixture of (2S,4R)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (7, 1369 mg, 3.18 mmol), 2-(4-(2-((tert-butoxycarbonyl)amino)ethoxy)phenoxy)acetic acid (17, 900 mg, 2.89 mmol) and HATU (1649 mg, 4.34 mmol) in DMF (20 mL). The resulting mixture was stirred at rt for 2 h. The crude product was purified by flash silica chromatography, elution gradient 0 to 10% MeOH in DCM. Pure fractions were evaporated to dryness to afford tert-butyl (2-(4-(2-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)phenoxy)ethyl)carbamate (18, 2000 mg, 96 %) as a yellow solid. 1H NMR (400 MHz, MeOD-d4) d 8.90 (s, 1H), 7.56 – 7.34 (m, 4H), 7.03 – 6.77 (m, 4H), 4.67 – 4.31 (m, 5H), 4.06 – 3.75 (m, 4H), 3.41 (t, J = 5.7 Hz, 2H), 3.01 (s, 2H), 2.49 (s, 3H), 2.33 – 2.05 (m, 2H), 1.46 (s, 9H), 1.37 – 0.92 (m, 9H). m/z: ES+ [M+H]+ = 724. (2S,4R)-1-((S)-2-(2-(4-(2-aminoethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidine-2-carboxamide (19).

4N HCl in dioxane (15 g, 4.84 mmol) was added to tert-butyl (2-(4-(2-(((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl) carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)phenoxy)ethyl)carbamate (18, 3.5 g, 4.84 mmol) in DCM (30 mL). The resulting solution was stirred at rt for 1 h. Solvents were evaporated to afford crude product, which purified by C18-flash chromatography, elution gradient 0 to 40% MeCN in water. Pure fractions were evaporated to dryness to afford (2S,4R)-1-((S)-2-(2-(4-(2-aminoethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidine-2-carboxamide (19, 2.60 g, 86 %) as a white solid. 1H NMR (300 MHz, MeOD-d4) d 9.34 (d, J = 2.0 Hz, 1H), 7.78 – 7.21 (m, 4H), 6.97 (s, 4H), 4.73 (s, 1H), 4.56 (ddd, J = 12.4, 6.3, 2.3 Hz, 5H), 4.38 (d, J = 15.7 Hz, 1H), 4.17 (dd, J = 5.5, 4.4 Hz, 2H), 3.91 (d, J = 11.2 Hz, 1H), 3.81 (dd, J = 11.2, 3.7 Hz, 1H), 3.35 (d, J = 5.0 Hz, 2H), 2.52 (s, 3H), 2.18 (dd, J = 36.4, 6.1 Hz, 1H), 2.06 (d, J = 14.6 Hz, 1H), 0.99 (s, 9H). m/z (ES+), [M+H]+ = 624. (2S,4R)-1-[(2S)-2-[[2-[4-[2-[3-[5-[5-[(5-fluoro-2,3-dihydrobenzofuran-4-yl)methylamino]-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl]-6methyl-2-pyridyl]propanoylamino]ethoxy]phenoxy]acetyl]amino]-3,3-dimethyl-butanoyl]-4-hydroxy-N-[[4-(4-methylthiazol-5-yl) phenyl]methyl]pyrrolidine-2-carboxamide (PROTAC 2).

(2S,4R)-1-((S)-2-(2-(4-(2-aminoethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidine-2-carboxamide (19, 27.8 mg, 0.04 mmol) was dissolved in DMF (0.8 mL). HATU (7.91 mg, 0.02 mmol) was added, followed by Et3N (0.019 mL, 0.13 mmol), then 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8yl)-6-methylpyridin-2-yl)propanoic acid (10, 20 mg, 0.04 mmol) and the reaction stirred for 16 h at rt. Solvents were removed in vacuo and the mixture was purified by C18-flash chromatography, elution gradient 20 to 80 % MeCN in water (0.1 % formic acid). The purified fractions were combined and evaporated to afford the desired product (2S,4R)-1-[(2S)-2-[[2-[4-[2-[3-[5-[5-[(5-fluoro-2,3-dihydrobenzofuran-4-yl)methylamino]-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl]-6-methyl-2-pyridyl]propanoylamino]ethoxy]phenoxy]acetyl] amino]-3,3-dimethyl-butanoyl]-4-hydroxy-N-[[4-(4-methylthiazol-5-yl)phenyl]methyl]pyrrolidine-2-carboxamide (PROTAC 2, 35 mg, 67%) as an off-white solid. 1H NMR (500 MHz, MeOD-d4) d 9.37 (s, 1H), 8.97 (s, 1H), 8.28 (d, J = 8.2 Hz, 1H), 7.79 (t, J = 4.3 Hz, 2H), 7.4 – 7.49 (m, 4H), 6.8 – 6.87 (m, 5H), 6.65 (dd, J = 8.7, 3.8 Hz, 1H), 4.71 (s, 1H), 4.41 – 4.61 (m, 8H), 4.35 (d, J = 15.4 Hz, 1H), 3.94 (t, J = 5.2 Hz, 2H), 3.87 (s, 1H), 3.80 (dd, J = 11.0, 3.6 Hz, 1H), 3.55 (t, J = 5.1 Hz, 2H), 3.39 (m, 5H), 2.76 – 2.87 (m, 2H), 2.67 (s, 3H), 2.47 (s,

e12 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

3H), 2.17 – 2.27 (m, 1H), 2.01 - 2.10 (m, 1H), 0.98 (s, 9H). 5 exchangeable protons not observed. 13C NMR (125 MHz, MeOD-d4) d 216.5, 216.3, 216.0, 215.8, 174.3, 173.6, 171.8, 170.6, 160.8, 160.5, 158.4, 157.6, 156.9, 156.5, 155.2, 154.4, 153.2,153.2, 150.0, 148.7, 148.4, 146.4, 146.3, 140.5, 134.4, 133.8, 132.4, 131.2, 130.5, 130.5, 130.4, 129.5, 129.0, 125.4, 116.9, 116.6, 115.3, 115.1, 110.0, 109.9, 107.3, 73.0, 71.1, 68.7, 68.0, 60.9, 58.3, 58.2, 49.7, 48.3, 43.7, 40.4, 39.1, 39.1, 39.0, 37.1, 34.6, 30.1, 29.8, 26.9, 19.1, 15.5. HRMS (ESI+): m/z found [M+ H]+ 1054.4393, C55H60N11O8FS requires 1054.4409. Scheme 5. Synthesis of cpd 4, Capped EED Ligand.

Reagents and conditions: (a) Methylamine, HATU, DIPEA, DMF, rt, 86%. 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)-N-methylpropanamide (Capped EED Ligand).

To a solution of 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin2-yl)propanoic acid (10, 30 mg, 0.07 mmol), N-ethyl-N-isopropylpropan-2-amine (35.5 ml, 0.20 mmol) and methanamine 33% in ethanol (9.99 ml, 0.08 mmol) in DMF (289 ml) was added HATU (33.1 mg, 0.09 mmol) in 3 portions over 5 min and the reaction was stirred at rt overnight. The reaction mixture was diluted with 1 mL DMSO and purified by preparative HPLC using decreasingly polar mixtures of water (containing 1% NH3) and MeCN as eluents. Fractions containing the desired compound were evaporated to dryness to afford 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2yl)-N-methylpropanamide (Capped EED ligand, 26.5 mg, 86 %) as a white solid. 1H NMR (500 MHz, DMSO-d6) d 9.47 (s, 1H), 8.68 (s, 1H), 7.83 (d, J = 4.4 Hz, 1H), 7.54 – 7.69 (m, 2H), 7.17 (d, J = 7.8 Hz, 1H), 6.91 – 7.02 (m, 1H), 6.73 (dd, J = 8.6, 3.9 Hz, 1H), 4.72 (d, J = 3.1 Hz, 2H), 4.56 (t, J = 8.7 Hz, 2H), 3.33 – 3.36 (m, 2H), 2.94 – 3.01 (m, 2H), 2.59 (d, J = 4.6 Hz, 3H), 2.53 (s, 2H), 2.37 (s, 3H). 13C NMR (125 MHz, DMSO-d6) d 172.24, 159.95, 156.71, 156.42, 156.24, 154.83, 149.18, 144.11, 142.43, 139.01, 133.37, 129.81, 129.78, 126.64, 121.91, 121.77, 120.22, 114.52, 114.33, 110.93, 108.96, 108.89, 72.06, 40.91, 37.78, 37.75, 35.28, 33.55, 29.01, 25.96, 23.74. HRMS (ESI+): m/z found [M+ H]+ 462.2066, C24H24N7O2F requires 462.2054.

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e13

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Scheme 6. Synthesis of cpd 5, Inactive PROTAC 1.

Reagents and conditions: (a) HATU, DIPEA, DMF, rt; (b) HCl, dioxane, rt, 43% over 2 steps; (c) HATU, Et3N, DMF, 92%. (2R,4S)-1-((S)-2-(5-aminopentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (21).

5-((tert-butoxycarbonyl)amino)pentanoic acid (30 mg, 0.14 mmol) was dissolved in DMF (0.8 ml). HATU (7.91 mg, 0.02 mmol) was added, followed by DIPEA (0.049 mL, 0.28 mmol), then (2R,4S)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (20, 60 mg, 0.14 mmol) and the reaction stirred for 16 h at rt. The reaction was partitioned between EtOAc and water. The organic layer was extracted twice with EtOAc, washed with brine, dried over Na2SO4 and solvents removed in vacuo. The boc-protected intermediate was purified by flash chromatography over silica gel using a gradient of 0 - 10% MeOH in DCM. This material was dissolved in DCM (1 mL) to which 4N HCl in dioxane was added (0.5 mL). The reaction was stirred for 2 h, evolving a white precipitate. The reaction was evaporated to dryness and purified by SCX ion-exchange chromatography to afford the desired product (2R,4S)-1-((S)-2-(5-aminopentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl) benzyl)pyrrolidine-2-carboxamide (21, 32 mg, 43%) as an off-white solid. 1H NMR (500 MHz, MeOD-d4) d 9.31 (s, 1H), 8.83 (s, 1H), 7.63 (s, 2H), 7.38 – 7.42 (m, 2H), 7.36 (d, J = 8.5 Hz, 2H), 7.18 (d, J = 7.8 Hz, 1H), 6.76 – 6.93 (m, 1H), 6.65 (dd, J = 8.7, 3.9 Hz, 1H), 4.81 (s, 2H), 4.57 (q, J = 8.5 Hz, 3H), 4.43 – 4.51 (m, 3H), 4.34 (d, J = 15.6 Hz, 1H), 3.98 (dd, J = 10.8, 4.9 Hz, 1H), 3.70 (dd, J = 10.6, 3.0 Hz, 1H), 3.39 (t, J = 8.7 Hz, 2H), 3.07 (q, J = 6.9 Hz, 4H), 2.58 (t, J = 7.6 Hz, 2H), 2.45 (s, 3H), 2.40 (s, 3H), 2.17 – 2.31 (m, 2H), 2.09 – 2.18 (m, 1H), 2.01 – 2.1 (m, 1H), 1.34 – 1.49 (m, 4H), 1.06 (s, 9H). m/z (ES+), [M+H]+ = 530. (2R,4S)-1-((S)-2-(5-(3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanamido)pentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (Inactive PROTAC 1).

e14 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

(2R,4S)-1-((S)-2-(5-aminopentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (21, 5.9 mg, 0.01 mmol) was dissolved in DMF (0.8 mL). HATU (7.91 mg, 0.02 mmol) was added, followed by Et3N (4.7 ml, 0.03 mmol) and then 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanoic acid (10, 5 mg, 0.01 mmol) was added and the reaction was stirred for 16 h at rt. Solvents were removed in vacuo and the mixture was purified by C18-flash chromatography, elution gradient 20 to 80 % MeCN in water (0.1 % formic acid). The purified fractions were combined and evaporated to afford the desired product (2R,4S)-1-((S)-2-(5-(3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanamido)pentanamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (Inactive PROTAC 1, 11 mg, 92%) as a white powder. 1 H NMR (300 MHz, MeOD-d4) d 9.31 (s, 1H), 8.83 (s, 1H), 7.63 (s, 2H), 7.34 – 7.44 (m, 4H), 7.18 (d, J = 7.8 Hz, 1H), 6.8 – 6.92 (m, 1H), 6.65 (dd, J = 8.6, 3.9 Hz, 1H), 4.81 (s, 2H), 4.57 (q, J = 8.6 Hz, 3H), 4.42 – 4.49 (m, 3H), 4.34 (d, J = 15.6 Hz, 1H), 3.98 (dd, J = 10.8, 4.9 Hz, 1H), 3.70 (dd, J = 10.6, 3.0 Hz, 1H), 3.39 (t, J = 8.7 Hz, 2H), 3.07 (t, J = 7.5 Hz, 4H), 2.58 (t, J = 7.5 Hz, 2H), 2.45 (s, 3H), 2.40 (s, 3H), 2.18 – 2.31 (m, 2H), 2.09 – 2.18 (m, 1H), 1.96 – 2.09 (m, 1H), 1.34 – 1.48 (m, 4H), 1.06 (s, 9H). 5 exchangeable protons not observed. 13C NMR (125 MHz, DMSO-d6) 13C NMR (126 MHz, DMSO, 27 C) 173.37, 172.12, 171.63, 170.23, 159.93, 156.71, 156.39, 156.23, 154.83, 151.91, 149.17, 148.23, 144.13, 142.44, 139.81, 138.97, 133.38, 131.59, 129.27, 127.84, 126.62, 121.95, 121.80, 120.17, 114.51, 114.32, 108.94, 108.87, 72.05, 68.93, 59.27, 57.49, 55.76, 42.04, 38.72, 38.36, 37.80, 35.40, 34.84, 34.73, 33.63, 29.20, 29.01, 26.95, 23.71, 23.31, 16.43. HRMS (ESI+): m/z found [M+ H]+ 960.4323, C50H58N11O6SF requires 960.4355. Scheme 7. Synthesis of cpd 6, Inactive PROTAC 2.

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e15

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

Reagents and conditions: (a) HATU, DIPEA, DMF, rt, 2 h, 22%; (b) 4M HCl/dioxane, DCM, rt, 2 h, 95%; (c) HATU, DIPEA, DMF, rt, 16 h, 32%. tert-butyl (2-(4-(2-(((S)-1-((2R,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan2-yl)amino)-2-oxoethoxy)phenoxy)ethyl)carbamate (22).

To 2-(4-(2-((tert-butoxycarbonyl)amino)ethoxy)phenoxy) acetic acid (17, 31.8 mg, 0.10 mmol) in DMF (415 ml) was added HATU (42.4 mg, 0.11 mmol) and DIPEA (49.4 ml, 0.28 mmol) and the reaction was stirred for 30 min. To the solution was added (2R,4S)-1-((S)-2-amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (20, 40 mg, 0.09 mmol) and the reaction was stirred overnight at rt. The reaction mixture was diluted with 1 mL DMSO and purified by preparative HPLC using decreasingly polar mixtures of water (containing 1% NH3) and MeCN as eluents. Fractions containing the desired compound were evaporated to dryness to afford tert-butyl (2-(4-(2-(((S)-1-((2R,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)phenoxy)ethyl)carbamate (22, 15.0 mg, 22%) as a dry film. 1H NMR (500 MHz, CD2Cl2-d2) d 8.91 (s, 1 H), 7.37 - 7.42 (m, 1 H), 7.31 - 7.35 (m, 4 H) 7.11 - 7.15 (m, 1 H), 6.61 - 6.82 (m, 4 H), 4.54 - 4.83 (m, 2 H), 4.32 - 4.42 (m, 1 H), 4.17 - 4.27 (m, 2 H), 4.09 - 4.15 (m, 1 H), 3.92 - 3.99 (m, 2 H), 3.64 - 3.84 (m, 2 H), 3.46 (t, J=5.3 Hz, 2 H), 2.46 (s, 3H), 2.37 - 2.42 (m, 1 H), 2.15 - 2.30 (m, 1 H), 1.46 (s, 9 H), 1.05 (s, 9 H). 3 exchangable protons not observed. m/z: ES+ [M+H]+ = 724. (2R,4S)-1-((S)-2-(2-(4-(2-aminoethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidine-2-carboxamide (23).

To tert-butyl (2-(4-(2-(((S)-1-((2R,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)phenoxy)ethyl)carbamate (22, 15 mg, 0.02 mmol) was added HCl (4N in Dioxane) (3 mL, 12.00 mmol) and the reaction was stirred for 2 at rt. Solvents were removed in vacuo to afford the crude product. This was purified by SCX ion-exchange chromatography, eluting with 1N Ammonia in MeOH to afford (2R,4S)-1-((S)-2-(2-(4-(2-aminoethoxy)phenoxy) acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (23, 12.30 mg, 95 %) as a dry film. ES+ [M+H]+ = 624. (2R,4S)-1-((S)-2-(2-(4-(2-(3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6methylpyridin-2-yl)propanamido)ethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidine-2-carboxamide (Inactive PROTAC 2).

e16 Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020

Please cite this article in press as: Hsu et al., EED-Targeted PROTACs Degrade EED, EZH2, and SUZ12 in the PRC2 Complex, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.11.004

To 3-(5-(5-(((5-fluoro-2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanoic acid (10, 10.4 mg, 0.02 mmol) in DMF (1.1 mL) was added O-(7-Azabenzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (10.58 mg, 0.03 mmol) and DIPEA (0.021 mL, 0.12 mmol). The reaction was stirred at rt for 40 min, then(2R,4S)-1-((S)-2(2-(4-(2-aminoethoxy)phenoxy)acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (23, 14.90 mg, 0.02 mmol) was added and the reaction was stirred at rt for 2 days. Solvents were removed in vacuo and the crude product was purified by preparative HPLC using decreasingly polar mixtures of water (containing 1% NH3) and MeCN as eluents. Fractions containing the desired compound were evaporated to dryness to afford (2R,4S)-1-((S)-2-(2-(4-(2-(3-(5-(5-(((5-fluoro2,3-dihydrobenzofuran-4-yl)methyl)amino)-[1,2,4]triazolo[4,3-c]pyrimidin-8-yl)-6-methylpyridin-2-yl)propanamido)ethoxy)phenoxy) acetamido)-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (Inactive PROTAC 2, 7.7 mg, 31.5%) as a white solid. 1H NMR (500 MHz, DMSO-d6) d 9.47 (s, 1H), 8.97 (s, 1H), 8.68 (t, J = 5.5 Hz, 1H), 8.33 (t, J = 5.5 Hz, 1H), 8.16 (t, J = 5.5 Hz, 1H), 7.81 (d, J = 9.0 Hz, 1H), 7.60 (m, 2H), 7.42 (d, J = 8.0 Hz, 2H), 7.34 (d, J = 8.0 Hz, 2H), 7.16 (d, J = 8.0 Hz, 1H), 6.97 (t, J = 9.0 Hz, 1H), 6.83 (m, 4H), 6.72 (dd, J = 8.6, 3.8 Hz, 1H), 5.13 (d, J = 3.8 Hz, 1H), 4.72 (d, J = 4.8 Hz, 2H), 4.51 – 4.59 (m, 3H), 4.48 (d, J = 2.6 Hz, 2H), 4.28 – 4.42 (m, 3H), 4.23 (dd, J = 15.8, 5.7 Hz, 1H), 3.89 (t, J = 5.7 Hz, 2H), 3.75 (dd, J = 10.4, 4.8 Hz, 1H), 3.57 (dd, J = 10.4, 2.6 Hz, 1H), 3.41 (q, J = 5.3 Hz, 2H), 3.34 (d, J = 8.7 Hz, 2H), 2.99 (t, J = 7.7 Hz, 2H), 2.57 (t, J = 7.8 Hz, 2H), 2.42 (s, 3H), 2.36 (s, 3H), 2.07 (ddd, J = 12.8, 8.2, 4.5 Hz, 1H), 1.94 (dt, J = 12.3, 5.7 Hz, 1H), 0.94 (s, 9H). 13 C NMR (125 MHz, DMSO-d6) d 203.54, 187.06, 171.7, 171.51, 168.99, 167.69, 159.36, 155.88, 155.72, 155.2, 154.32, 152.87, 151.74, 151.38, 148.65, 147.72, 143.59, 141.89, 139.33, 138.46, 131.05, 129.74, 128.74, 127.39, 126.11, 121.39, 121.25, 119.69, 115.47, 115.43, 115.37, 114.00, 113.8, 113.32, 111.20, 110.41, 108.44, 108.37, 71.53, 68.48, 66.99, 66.79, 58.77, 56.12, 55.38, 41.49, 38.24, 37.85, 37.26, 37.24, 34.97, 34.73, 32.99, 28.49, 26.31, 26.24, 23.2, 15.89, 1.06. HRMS (ESI+): m/z found [M+ H]+ 1054.4393, C55H60N11O8FS requires 1054.4409. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical analysis was performed using Prism 8 (Graphpad) or Genedata Screener software (Genedata AG). Values are expressed as mean ± standard deviation from the mean or SEM of the replicates, as indicated in the figure legends. DATA AND CODE AVAILABILITY The accession number for the proteomic dataset generated for Figure 5 is ProteomeXchange PRIDE: PXD016107 (http:// proteomecentral.proteomexchange.org/cgi/GetDataset).

Cell Chemical Biology 27, 1–6.e1–e17, January 16, 2020 e17