- Email: [email protected]
PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
EETs/PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy
T
Jie Zhanga, Hongmei Qiua, Jiajun Huanga, Shumei Dinga, Bo Huangb, Ping Zhouc, ⁎ Qingsong Jianga, a
Department of Pharmacology, Chongqing Key Laboratory of Biochemistry and Molecular Pharmacology, Chongqing Medical University, Chongqing 400016, Chongqing, PR China b Key Laboratory of Basic Pharmacology of Ministry of Education and Joint International Research Laboratory of Ethnomedicine of Ministry of Education, Zunyi Medical University, Zunyi 563003, Guizhou Province, PR China c Department of Traditional Chinese Medicine, Chongqing Medical University, Chongqing 400016, Chongqing, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Naringenin Diabetes Cardiomyocyte hypertrophy EETs CYP2J3 PPARs
Background: Cardiac hypertrophy is a key pathological process in the context of diabetic cardiomyopathy. Naringenin exhibits multiple pharmacological activities, but the effect of naringenin on cardiomyocyte hypertrophy under diabetic conditions is still far from clear. Methods: Cardiomyocyte hypertrophy was induced by high glucose (HG, glucose at 25.5 mmol/L) in H9c2 cells, which was determined by cell surface area, protein content and atrial natriuretic factor (ANF) mRNA expression. The effect of naringenin on cardiomyocyte hypertrophy was observed and its mechanisms were investigated by administration with various inhibitors on epoxyeicosatrienoic acids (EETs)/peroxisome proliferator-activated receptors (PPARs). The level of 14,15-EET was measured by ELISA. The mRNA and protein expressions were detected by qRT-PCR or Western blot, respectively. Results: Naringenin (0.1, 1, 10 μmol/L) inhibited cardiomyocyte hypertrophy in a concentration-dependent manner (P < 0.05), up-regulated the expressions of PPARα, PPARβ, PPARγ and CYP2J3 (P < 0.05), and increased the level of 14,15-EET (P < 0.05). PPOH, a CYP2J3 inhibitor, blocked the naringenin-mediated improvement of myocardial hypertrophy (P < 0.01), and abolished the up-regulation of PPARs expressions (P < 0.01). Meanwhile, MK886, a PPARα antagonist, GSK0660, a PPARβ antagonist, and GW9662, a PPARγ antagonist, reversed the protection of naringenin on cardiomyocytes (P < 0.05), and abrogated the up-regulation of CYP2J3-EET produced by naringenin (P < 0.05). Conclusions: Activation of EETs and PPARs function together may be contributed to the anti-hypertrophic effect of naringenin in H9c2 cells under high glucose condition.
1. Introduction Diabetic cardiomyopathy (DCM) is one of the most common complications of diabetes, which refers to a unique set of heart-specific pathological variables induced by hyperglycemia and insulin resistance and closely related to the increasing incidence of heart failure in diabetic patients. Cardiomyocyte hypertrophy is a key pathological process in the context of DCM, which is characterized by the increases of cardiac myocyte protein, cell surface area, as well as the mRNA expression of fetal gene, such as atrial natriuretic factor (ANF) [1]. It is however worth noting that specific strategies for preventing or treating diabetic cardiac hypertrophy have not been clarified yet.
Naringenin chemically known as 4′, 5, 7-trihydroxy flavanone (Fig. 1) is the predominant flavanone in citrus plants such as oranges, mandarins and grapefruit with multiple pharmacological activities [2]. Naringenin has potential health benefits for the treatment of obesity, hypertension, cardiovascular diseases (CVD), and metabolic syndrome [3]. Especially, naringenin has shown cardioprotective effect on pressure overload induced cardiac hypertrophy and hyperglycemia-induced cardiomyocytes injury [4,5]. However, the effect and the mechanism of naringenin on cardiomyocyte hypertrophy under diabetic background are still far from clear. Many cellular mechanisms are documented to underlie the development of cardiac hypertrophy in DCM. Inflammation is one of major
⁎ Corresponding author at: Department of Pharmacology, Chongqing Medical University, 1 Yixueyuan Road, Yuzhou District, Chongqing 400016, Chongqing, PR China. E-mail address: [email protected] (Q. Jiang).
https://doi.org/10.1016/j.biopha.2018.10.176 Received 28 August 2018; Received in revised form 17 October 2018; Accepted 30 October 2018 0753-3322/ © 2018 Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Table 2 Effects of naringenin on high glucose (HG)-induced cardiomyocytes hypertrophy in H9c2 cells.
Table 1 Primer sequences for real-time quantitative RT-PCR. Forward primer(5’-3’)
Reverse primer(5’-3’)
PPARα PPARβ PPARγ CYP2J3 ANF β-actin
GTGCCTGTCTGTCGGGATAG CTGGCAGAACCCAGTACCAG TTCTGGCCCACCAACTTC ATGCTTGTCACAGCGGGTTC GAGTGAGCCGAGACAGCAAA GCAGGAGTACGATGAGTCCG
TCTTCAGGTAGGCTTCGTGGAT GTGAGCCGGTGTCATGGTTA CCCACAGACTCGGCACTC GAGGAAATCAGCCAGGAACAGA TTGCTCCAATATGGCCTGGG ACGCAGCTCAGTAACAGTCC
Cell surface area (μm2) (n = 6)
Protein level (g/ L) (n = 6)
ANF mRNA (n = 3)
Control HG
662.67 ± 111.29 1629.67 ± 252.95
0.55 ± 0.09 1.23 ± 0.20
0.13 ± 0.04 1.29 ± 0.25
NAR (0.1 μmol/L) NAR (1 μmol/L) NAR (10 μmol/L)
1166.50 ± 281.54 * 910.17 ± 182.06 ** 760.00 ± 184.05 **
##
##
##
Fig. 1. Chemical structure of naringenin.
Gene
Group
0.87 ± 0.08 0.68 ± 0.09 0.59 ± 0.09
** ** **
0.45 ± 0.10 0.27 ± 0.15 0.18 ± 0.09
** ** **
HG: glucose at 25.5 mmol/L; NAR: naringenin; ANF: atrial natriuretic factor. mean ± S.D.,## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG.
obesity, inflammation, and the metabolic syndrome, which are the prime targets for drugs to prevent or control the above diseases [10]. Additionally, AA is catalyzed by three types of enzymes, namely, the cyclooxygenases, lipoxygenases, and cytochrome P450 (CYP) oxidase. The first two pathways are well-known, while the third is relatively less. AA can be metabolized into 20-hydroxyeicosatetraenoic acid (20HETE) by CYP4A/4F and epoxyeicosatrienoic acids (EETs) by CYP2C/ 2J. Remarkably, CYP2J is highly expressed in cardiovascular system. Among the subtypes of CYP2J, CYP2J2 is in human and CYP2J3 is in mouse [11]. EETs have many beneficial effects in metabolic diseases, including atherosclerosis, hypertension, cardiac hypertrophy, diabetes,
determinants of health complications, such as diabetes, CVD, and central nervous system diseases [6]. Evidences suggest that both peroxisome proliferator-activated receptors (PPARs) and arachidonic acid (AA) play critical roles in the pathogenesis of inflammation [7–9]. PPARs, including α, β, and γ subtypes, have a very significant action in
Fig. 2. Representative photomicrographs of H9c2 cells (scale bar: 100 μm, original magnification: ×400). The green is the actin microfilament dyed by phalloidinFITC, and the blue is the nuclei stained by 4′,6-diamidino-2-phenylindole (DAPI). Cardiomyocytes treated with glucose at 25.5 mmol/L (HG) became swollen and enlarged. Naringenin (0.1, 1, 10 μmol/L) markedly alleviated the morphological changes induced by HG. The addition of PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) (1 μmol/L) could antagonize the effect of naringenin (1 μmol/L) on the hypertrophic myocyte. 1499
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Table 3 Effects of different blockers on the anti-hypertrophy of naringenin in H9c2 cells exposed to high ambient glucose. Group
Cell surface area (μm2) (n = 6)
Protein level (g/L)(n = 6)
ANF mRNA (n = 3)
Control HG HG+NAR HG+NAR HG+NAR HG+NAR HG+NAR
769.25 ± 124.91 1732.50 ± 119.24 ## 919.20 ± 158.87 ** 1337.43 ± 145.41 ^^ 1085.63 ± 177.80 ^ 1139.00 ± 166.99 ^ 1103.63 ± 128.64 ^
0.56 1.24 0.64 1.13 0.89 0.87 0.97
0.12 1.29 0.24 1.04 0.55 0.62 0.48
(1 μmol/L) (1 μmol/L) + PPOH (1 μmol/L) (1 μmol/L) + MK886 (1 μmol/L) (1 μmol/L) + GSK0660 (1 μmol/L) (1 μmol/L) + GW9662 (1 μmol/L)
± ± ± ± ± ± ±
0.11 0.17 0.09 0.09 0.06 0.09 0.18
## ** ^^ ^ ^ ^
± ± ± ± ± ± ±
0.03 0.17 0.07 0.12 0.06 0.05 0.17
## ** ^^ ^^ ^^ ^^
HG: glucose at 25.5 mmol/L; NAR: naringenin; ANF: atrial natriuretic factor. PPOH: CYP2J3 inhibitor; MK886: PPARα antagonist; GSK0660: PPARβ antagonist; GW9662: PPARγ antagonist. mean ± S.D., ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^ P < 0.05, ^^ P < 0.01 vs HG + NAR (1 μmol/L).
Fig. 3. Effect of naringenin (NAR) on the expressions of mRNA and protein of PPARα (A), PPARβ (B), and PPARγ (C) in high glucose (HG, glucose at 25.5 mmol/L)induced hypertrophic cardiomyocytes. The expressions of PPARα, PPARβ and PPARγ mRNA and protein were down-regulated in HG-induced hypertrophic cardiomyocytes, which were up-regulated following treatment with NAR (0.1, 1, 10 μmol/L) in a dose-dependent manner. mean ± S.D., n = 3. ## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG. “+” or “-”: treatment with or without relevant reagent.
naringenin in diabetic cardiomyocyte hypertrophy. Hence, in the current study, the effect of naringenin on cardiomyocyte hypertrophy induced by high glucose in H9c2 cells was investigated; furthermore, a few targeted blockers of PPARs and EETs were used in order to understand better the roles and links of PPARs
non-alcoholic fatty liver disease, and kidney disease [12]. Hitherto, there have been few studies on the relationship between PPARs and EETs in diabetic cardiomyocyte hypertrophy. Many signal transduction pathways are involved in the effects of naringenin [3], however, there is few research about the role of PPARs and EETs on the effect of 1500
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 4. Effect of CYP2J3 inhibitor on the expressions of mRNA and protein of PPARα (A), PPARβ (B), and PPARγ (C) in hypertrophic cardiomyocytes treated with naringenin (NAR). PPOH, a CYP2J3 inhibitor, dramatically reversed the NAR-stimulated up-regulation of mRNA transcript and protein expression of PPARα, PPARβ, and PPARγ in hypertrophic cardiomyocytes induced by glucose at 25.5 mmol/L (HG). mean ± S.D., n = 3. ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^^ P < 0.01 vs HG + NAR (1 μmol/L). “+” or “−”: treatment with or without relevant reagent.
from Sigma Aldrich (Santa Clara, CA, USA), 14,15-EET (ELISA) Kit was purchased from J & L Biological Co. Ltd. (Shanghai, China), phalloidinFITC was purchased from Beyotime Biotechnology Co. Ltd. (Shanghai, China), RIPA lysate and Bicinchoninic Acid (BCA) Protein Quantification Kit were purchased from Beijing Dingguo Changsheng Biotechnology Co. Ltd. (Beijing, China), PPARα, PPARβ, PPARγ and GAPDH antibodies were purchased from Proteintech Group, Inc. (Hubei, China), CYP2J3 antibody was purchased from Bioss Biotechnology Co. Ltd. (Beijing, China), Trizol, Reverse Transcription Kit, SYBR-Green Supermix, and PCR primers were purchased from Biotech Engineering Co. Ltd. (Liaoning, China). The remaining reagents were analytical grade.
and EETs in conjunction with naringenin in cardiac hypertrophy under experimental diabetic condition.
2. Materials and methods 2.1. Chemicals and reagents Naringenin (MW: 272.25; purity ≥ 98%, HPLC-grade) was purchased from Chengdu Derick Biotechnology Co. Ltd. (Sichuan, China), 6-(2-proparglyloxyphenyl) hexanoic acid (PPOH) was purchased from Cayman Chemical Company (AnnArbor, MI, USA), MK886 and GSK0660 were purchased from Abcam (UK), GW9662 was purchased 1501
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 5. Effect of naringenin (NAR) on the expressions of CYP2J3 mRNA and protein (A) and on the level of 14,15-EET (B) in high glucose (HG, glucose at 25.5 mmol/ L)-induced hypertrophic cardiomyocytes. NAR (0.1, 1, 10 μmol/L) treatment dose-dependently upregulated the expressions of CYP2J3 mRNA and protein and increased the 14,15-EET level in hypertrophic cardiomyocytes. mean ± S.D., n = 3-6. ## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG. “+” or “−”: treatment with or without relevant reagent.
2.2. Cell cultures and treatment
2.3. Morphometric analysis
H9c2 cells were obtained from Beijing Dingguo Changsheng Biotechnology Co. Ltd. (Beijing, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA), 10% fetal bovine serum (FBS, Gibco, USA), 100 U/mL penicillin and 100 U/mL streptomycin (Hyclone, USA) in a humidified atmosphere of 95% O2 and 5% CO2 at 37 °C. Naringenin, PPOH, MK886, GSK0660 and GW9662 were dissolved in dimethyl sulfoxide (DMSO, the final concentration being less than 0.1%) and diluted with DMEM. Cells between passages 3 and 5 were used for each experiment. The seeding density was 5 × 104 cells/mL for measuring cell surface area, or 5 × 105 cells/ mL for extracting mRNA, evaluating cellular protein content and determining 14,15-EET level. Cells in the logarithmic growth phase were cultured in normal medium (glucose at 5.5 mmol/L) for 24 h, and synchronized in DMEM containing 0.1% FBS for a further 24 h, then were stimulated with high glucose medium (HG, glucose at 25.5 mmol/ L) with or without naringenin (0.1, 1, 10 μmol/L) for another 48 h. Mannitol was used as an osmotic control (CON). For investigating the relationship of PPARs and/or EETs on the effect of naringenin, PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) at 1 μmol/L, respectively, were administered 4 h prior to HG exposure.
The cell suspension was seeded on a glass slide in a 24-well plate and cultured to make cells slide. Cardiomyocytes were fixed with 4% paraformaldehyde for 20 min, 0.1% TritonX-100 permeabilized for 5 min, 1% bovine serum albumin (BSA) for 1 h, phalloidin-FITC (1:100) for 1 h at room temperature in the dark, and 4′,6-diamidino-2-phenylindole (DAPI) stained for 5 min. Cellular hypertrophy was observed under microscope and NIH Medical Image Analysis System (Nikon, Tokyo, Japan) and calculated with Image-ProPlus 6.0 professional image analysis software. Five random fields (with approximately 5–15 cells per field) from every sample were averaged and expressed as μm2. The results of six independent samples were used for statistical analysis.
2.4. Measurement of cardiomyocyte protein content Cardiomyocytes were washed three times with ice-cold phosphatebuffered solution (PBS), then homogenized with RIPA lysis buffer for 20 min and finally centrifuged at 12,000g for 15 min at 4 °C. The protein concentration in the supernatant was determined with a BCA Protein Quantification Kit and calculated by standard curve.
1502
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 6. Effects of the antagonists of different PPARs subtypes on the naringenin-stimulated increase of CYP2J3-EET in glucose at 25.5 mmol/L (HG)-induced hypertrophic cardiomyocytes. MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) reversed the rescue effects of NAR (1 μmol/L) on the expression of CYP2J3 and the level of 14,15-EET in hypertrophic cardiomyocytes induced by HG. mean ± S.D., n = 3–6. ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^ P < 0.05 vs HG + NAR (1 μmol/L). “+” or “−”: treatment with or without relevant reagent.
each group.
2.5. Analysis of mRNA via real-time quantitative reverse transcription PCR (qRT-PCR)
2.6. Western blotting analysis of proteins
According to the manufacturer’s instructions, Trizol was used to extract total RNA from cardiomyocytes. The PCR procedure (95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 40 cycles) was carried out on a qRTPCR instrument (Bio-Rad CFX96, CA, USA) using specific primer sequences (Table 1); β-actin was used as an internal reference gene. The mRNA relative expression was calculated using the ΔCt (Ct = cycle threshold) method as follows: the relative expression = 2‾ΔCt, ΔCt = Ct (target gene) − Ct (β-actin). The procedure was repeated 3 times for
Protein samples (30 μg) were subjected to SDS-polyacrylamide gel electrophoresis and transferred to the membrane by wet method. Antibodies [β-actin (1:3000), PPARα (1:1000), PPARβ (1:1000), PPARγ (1:1000) and CYP2J3 (1:1000)] were added and incubated over-night after closed with BSA. Then the membrane was incubated with secondary antibody (1:2000) for 2 h at room temperature. Enhanced Chemiluminescence (ECL) method was used for visualization and Bio1503
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
cardiomyocytes (P < 0.01); 14,15-EET level was reduced by 50.0%, compared to the control group (P < 0.01). However, different concentrations of naringenin visibly up-regulated the expressions of both CYP2J3 mRNA and protein, and increased 14, 15-EET level in a dosedependent manner (P < 0.05) (Fig. 5). As shown in Fig. 6, the antagonists of different PPARs subtypes, such as MK886, GSK0660 or GW9662, reversed the naringenin (1 μmol/ L)-stimulated up-regulation of CYP2J3 mRNA and protein expressions and the increase of 14,15-EET level in HG-induced hypertrophic cardiomyocytes (P < 0.05).
Rad gel imaging system was used to analyze images. The procedure was repeated 3 times for each group. 2.7. Measurement of 14,15-EET According to the manufacturer’s instructions, 50 μL of samples or standards were added to the coated wells and incubated at 37 °C for 30 min. Excluding the blank wells, 50 μL of HRP-labelled detection antibody were added to each well and incubated at 37 °C for 30 min. After washing the plate 5 times, 50 μL of substrate A and B were added to each well, incubated at 37 °C in the dark for 15 min, and 50 μL of stop solution were added. The optical density value of each well was measured at a wavelength of 450 nm within 15 min. The 14,15-EET content in each sample was calculated from the standard curve. Each group was tested six times.
4. Discussion Type 2 diabetes mellitus is a chronic metabolic disorder characterized by a persistent increase in blood glucose above normal level. Sustained hyperglycemia is an established risk factor of diabetic complications, such as DCM, including cardiac hypertrophy [13]. The present study found that incubation in the presence of HG (glucose at 25.5 mmol/L) induced cardiomyocyte hypertrophy in H9c2 cells, which manifested as increased cell surface area, protein content and ANF mRNA expression. The results suggested that high ambient glucose could mimic hyperglycemia that occurs in human diabetic patients; hence, HG-induced cardiac hypertrophy could be an in vitro model to simulate diabetic cardiomyocyte hypertrophy in a laboratory setting. Naringenin, as a common dietary flavanone constituent, has received considerable attention for pharmaceutical and nutritional development due to therapeutic applications in various neurological, cardiovascular, gastrointestinal, rheumatological, metabolic and malignant disorders [14]. Epidemiological evidence and clinical and preclinical studies suggest that naringenin positively influences on cardiac and metabolic parameters, preventing CVD and improving diabetes [15]. A supplement for 2 or more weeks with naringenin reduced glycaemia and insulinaemia in diabetic or insulin-resistant animals; moreover, glucose tolerance was improved [16–18]. Naringenin has also shown potential protective effect in diabetic complications, such as diabetic retinopathy [19], diabetic nephropathy [20], endothelial dysfunction [21] and diabetic hepatopathy [22]. However, there is few research about the effect of naringenin on diabetic cardiomyocyte hypertrophy. Recently, our team has reported the ameliorative effect of naringenin in cardiac hypertrophy in diabetic mice [23]. Consistent with the results, in the present investigation, naringenin, in a concentration-dependent manner, effectively inhibited HG-induced cardiomyocyte hypertrophy. Experimental evidence supports the beneficial effects of naringenin resulting from its antioxidant and anti-inflammatory properties [24]. The cardioprotective effect of naringenin has been proven to be by inhibiting phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt), extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) signalling pathways on pressure overload induced cardiac hypertrophy [4], or by upregulating ATP-sensitive K+ (KATP) channels and inhibiting the nuclear factor kappa B (NF-κB) pathway in hyperglycemia-induced injury [5]. Although hyperglycemia regulates multiple pathways in the diabetic heart, non-resolved chronic inflammation is thought to represent a central mechanism underlying associated adverse remodelling. Therefore, the regulation of inflammation-related signal pathway should not be ignored in the effect of naringenin on diabetic cardiac hypertrophy. It is well known that both PPARs and EETs play crucial roles in the regulation of the systemic inflammatory response. The effects of naringenin have been found to be related to the activation of PPARs. By activating PPARα, PPARβ or PPARγ, naringenin was found to regulate human and rat hepatic lipid metabolism at transcriptional level [25], and to ameliorate cognitive deficits in diabetic rats [24]. Meanwhile, EETs ameliorated angiotensin II-induced inflammatory responses via activating PPARα in HUVECs [26]. CYP2J2-EETs reduced liver inflammation and improved metabolic disorders in diabetic mice by
2.8. Statistical analysis Results were expressed as mean ± S.D. and statistical analysis was performed using SPSS 20.0. The mean value among groups was analyzed by one-way analysis of variance (ANOVA) and P < 0.05 was considered statistically significant. Graph Pad Prism 5.01 software was used for drawing. 3. Results 3.1. Effect of naringenin on HG-induced cardiomyocyte hypertrophy in H9c2 cells Light microscopic findings showed that the cardiomyocytes treated with glucose at 25.5 mmol/L (HG) became swollen and enlarged. Naringenin (0.1, 1, 10 μmol/L) markedly alleviated the morphological changes induced by HG. The addition of PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) (1 μmol/L) could antagonize the effect of naringenin (1 μmol/L) on the hypertrophic myocyte (Fig. 2). Table 2 showed that the cell surface area, protein content and ANF mRNA expression treated with HG significantly increased to 2.5-, 2.2-, and 9.9-fold, respectively, compared with that of the control (P < 0.01). Supplementation with naringenin was found to ameliorate HGstimulated cardiomyocyte hypertrophy, as manifested by decreasing the cell surface area, protein level and ANF mRNA expression, in concentration-dependent manner (P < 0.05). Table 3 showed that PPOH, MK886, GSK0660, or GW9662 significantly inhibited the anti-hypertrophic effects of naringenin (P < 0.05). 3.2. Effects of naringenin on the expressions of PPARs mRNA and protein in HG-induced hypertrophic cardiomyocytes The expressions of PPARα, PPARβ, and PPARγ mRNA and protein, were significantly down-regulated in HG-induced hypertrophic cardiomyocytes, the mRNA expression decreased by 75.4%, 82.6%, and 79.0%, respectively (P < 0.01), while the protein expression reduced by 68.8%, 83.3%, and 68.0%, respectively (P < 0.01). Exposure to naringenin (0.1, 1, 10 μmol/L) significantly up-regulated the mRNA transcription and protein expression of PPARs in a dose-dependent manner (P < 0.05) (Fig. 3). However, the rescue effects of naringenin (1 μmol/L) on the mRNA and protein expressions of PPARs in hypertrophic cardiomyocytes were all dramatically reversed by PPOH (1 μmol/L) (P < 0.01) (Fig. 4). 3.3. Effects of naringenin on CYP2J3-EETs in HG-induced hypertrophic cardiomyocytes The expressions of CYP2J3 mRNA and protein were decreased by 66.7% and 80.0%, respectively, in HG-induced hypertrophic 1504
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Guizhou Traditional Chinese Medicine Administration Bureau, Guizhou, China (No. QZYY-2016-004), and National Natural Science Foundation of China, China (No. 81471334 and 81871002).
activating PPARγ. However, few studies have reported the role of EETs on the effects of naringenin. Although our recent study showed that naringenin exhibits protective effect on cardiac hypertrophy in diabetic mice, which may be related to activation of EETs-PPARs, the mechanism of naringenin related to EETs and PPARs still requires further investigation. Therefore, a few blockers were used to elucidate the relationship between EETs and PPARs on the action of naringenin in the heart under diabetic conditions. The present study showed that CYP2J3-EETs was reduced, and the expressions of PPARα, PPARβ and PPARγ were down-regulated in high glucose-induced hypertrophic cardiomyocytes; supplementation with naringenin was accompanied by the up-regulation of CYP2J3 expression, the production of EETs, and the activation of PPARs. These findings suggested that naringenin have a preventive effect on cardiomyocyte hypertrophy induced by HG, both PPARs and EETs are involved in the mechanisms of naringenin, which are consistent with the results obtained previously in vivo [23]. PPOH, a CYP2J3 inhibitor, nullified the naringenin-stimulated activation of PPARs and reversed the positive effects of naringenin in hypertrophic cardiomyocytes. It has been reported that EETs may be endogenous ligands of PPARs [9]. Similarly, the study suggested that the activation of PPARs is required for the anti-cardiac hypertrophic effects of naringenin on CYP2J3-EETs stimulation under diabetic conditions. Afterwards, MK886, a PPARα antagonist or GSK0660, a PPARβ antagonist or GW9662, a PPARγ antagonist were given in turn. Notably, these blockers abrogated the naringenin-stimulated up-regulation of CYP2J3 and increase of 14,15EET, and also attenuated the anti-hypertrophic effects of naringenin in H9c2 cells, suggesting that PPARs can also regulate the activity of CYP2J3-EETs. Consistently, Althurwi et al. found that PPARα agonist fibrates possess CYP450 epoxygenase-inducing properties that lead to increase in endogenous EET production [27]. The results showed that the production of EETs may also be influenced by the activation of PPARs, at least under the present conditions. Collectively, EETs and PPARs function together in a positive feedback loop may be mediated the cardiomyocyte-protective effect of naringenin in H9c2 cells exposed to high ambient glucose. In conclusion, the present study found that naringenin supplementation could prevent cardiomyocyte hypertrophy induced by high glucose concentration in H9c2 cells, which was followed by increasing the activation of CYP2J3-EETs and stimulating the expression of PPARs. Meanwhile, CYP2J3 blocker largely abolished the naringenin-induced up-regulation of PPARs, and PPARs inhibitors also removed the naringenin-stimulated increase of CYP2J3-EETs, which were accompanied by the termination of naringenin-mediated cardiomyocyte protection. These results suggested that naringenin has a role on cardio-protection under diabetic condition, at least in part through the operation of EETs/ PPARs-related signalling pathway. In other words, both the stimulation of EETs and the activation of PPARs were involved in the protective effect of naringenin in hypertrophic cardiomyocytes in the experimental setting of diabetes. The findings will possibly stimulate more interest in naringenin as a potential therapeutic drug against DCM-associated hypertrophy. However, owing to the complexity of the molecular pathological mechanism of diabetic cardiac hypertrophy, the action of naringenin still requires further confirmation by additional researches.
References [1] M. Nayor, D.M. Enserro, V. Xanthakis, M.G. Larson, E.J. Benjamin, J. Aragam, et al., Comorbidities and cardiometabolic disease: relationship with longitudinal changes in diastolic function, JACC Heart Fail. 6 (2018) 317–325. [2] I.A. Mir, A.B. Tiku, Chemopreventive and therapeutic potential of “naringenina flavanone” present in citrus fruits, Nutr. Cancer 67 (2015) 27–42. [3] M.A. Alam, N. Subhan, M.M. Rahman, S.J. Uddin, H.M. Reza, S.D. Sarker, Effect of citrus flavonoids, naringin and naringenin, on metabolic syndrome and their mechanisms of action, Adv. Nutr. 5 (2014) 404–417. [4] N. Zhang, Z. Yang, Y. Yuan, F. Li, Y. Liu, Z. Ma, Q. Tang, Naringenin attenuates pressure overload- induced cardiac hypertrophy, Exp. Ther. Med. 10 (2015) 2206–2212. [5] Q. You, Z. Wu, B. Wu, C. Liu, R. Huang, L. Yang, R. Guo, K. Wu, J. Chen, Naringin protects cardiomyocytes against hyperglycemia-induced injuries in vitro and in vivo, J. Endocrinol. 230 (2016) 197–214. [6] E. Lontchi-Yimagou, E. Sobngwi, T.E. Matsha, A.P. Kengne, Diabetes mellitus and inflammation, Curr. Diab. Rep. 13 (2013) 435–444. [7] W. Wahli, L. Michalik, PPARs at the crossroads of lipid signaling and inflammation, Trends Endocrinol. Metab. 23 (2012) 351–363. [8] L. Xue, K. Wu, H.M. Qiu, B. Huang, R.C. Chen, W. Xie, Q.S. Jiang, Polydatin exhibits the hepatoprotective effects through PPAR-α/-β signaling pathway in Streptozocininduced diabetic mice, J. Funct. Foods 36 (2017) 341–347. [9] X. Xu, X.A. Zhang, D.W. Wang, The roles of CYP450 epoxygenases and metabolites, epoxyeicosatrienoic acids, in cardiovascular and malignant diaeases, Adv. Drug Deliv. Rev. 63 (2011) 597–609. [10] B. Grygiel-Górniak, Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications - a review, Nutr. J. 13 (2014) 17, https://doi. org/10.1186/1475-2891-13-17. [11] R.J. Roman, P-450 metabolites of arachidonic acid in the control of cardiovascular function, Physiol. Rev. 82 (2002) 131–185. [12] J. He, C. Wang, Y. Zhu, D. Ai, Soluble epoxide hydrolase: a potential target for metabolic diseases, J. Diabetes 8 (2016) 305–313. [13] Y. Katsuda, T. Sasase, H. Tadaki, Y. Mera, Y. Motohashi, Y. Kemmochi, et al., Contribution of hyperglycemia on diabetic complications in obese type 2 diabetic SDT fatty rats: effects of SGLT inhibitor phlorizin, Exp. Anim. 64 (2015) 161–169. [14] N. Rani, S. Bharti, B. Krishnamurthy, J. Bhatia, C. Sharma, M.A. Kamal, et al., Pharmacological properties and therapeutic potential of naringenin: a citrus flavonoid of pharmaceutical promise, Curr. Pharm. Des. 22 (2016) 4341–4359. [15] L. Testai, V. Calderone, Nutraceutical value of citrus flavanones and their implications in cardiovascular disease, Nutrients 9 (2017) pii: E502. [16] A.K. Singh, V. Raj, A.K. Keshari, A. Rai, P. Kumar, A. Rawat, et al., Isolated mangiferin and naringenin exert antidiabetic effect via PPAR(γ)/GLUT4 dual agonistic action with strong metabolic regulation, Chem. Biol. Interact. 280 (2018) 33–44. [17] B. Gross, M. Pawlak, P. Lefebvre, B. Staels, PPARs in obesity-induced T2DM, dyslipidaemia and NAFLD, Nat. Rev. Endocrinol. 13 (2017) 36–49. [18] N.A. Nyane, T.B. Tlaila, T.G. Malefane, D.E. Ndwandwe, P.M.O. Owira, Metforminlike antidiabetic, cardio-protective and non-glycemic effects of naringenin: Molecular and pharmacological insights, Eur. J. Pharmacol. 803 (2017) 103–111. [19] D.I. Al-Dosari, M.M. Ahmed, S.S. Al-Rejaie, A.S. Alhomida, M.S. Ola, Flavonoid naringenin attenuates oxidative stress, apoptosis and improves nneurotrophic effects in the diabetic rat retina, Nutrients 9 (2017) pii: E1161. [20] N. Yan, L. Wen, R. Peng, H. Li, H. Liu, H. Peng, et al., Naringenin ameliorated kidney injury through Let-7a/TGFBR1 signaling in diabetic nephropathy, J. Diabetes Res. (2016) 8738760. [21] B. Ren, W. Qin, F. Wu, S. Wang, C. Pan, L. Wang, et al., Apigenin andnaringenin regulate glucose and lipid metabolism, and ameliorate vascular dysfunction in type 2 diabetic rats, Eur. J. Pharmacol. 773 (2016) 13–23. [22] D. Sirovina, N. Oršolić, G. Gregorović, M.Z. Končić, Naringenin ameliorates pathological changes in liver and kidney of diabetic mice: a preliminary study, Arh. Hig. Rada Toksikol. 67 (2016) 19–24. [23] J. Zhang, H. Qiu, J. Huang, S. Ding, B. Huang, Q. Wu, et al., Naringenin exhibits the protective effect on cardiac hypertrophy via EETs-PPARs activation in streptozocininduced diabetic mice, Biochem. Biophys. Res. Commun. 502 (2018) 55–61. [24] Z. Qi, Y. Xu, Z. Liang, S. Li, J. Wang, Y. Wei, B. Dong, Naringin ameliorates cognitive deficits via oxidative stress, proinflammatory factors and the PPARγ signaling pathway in a type 2 diabetic rat model, Mol. Med. Rep. 12 (2015) 7093–7101. [25] J. Goldwasser, P.Y. Cohen, E. Yang, P. Balaguer, M.L. Yarmush, Y. Nahmias, Transcriptional regulation ofhuman and rat hepatic lipid metabolism by the grapefruit flavonoid naringenin: role of PPARalpha, PPARgamma and LXRalpha, PLoS One 5 (2010) e12399, https://doi.org/10.1371/journal.pone.0012399. [26] X. Huang, Y. Wang, Z. Zhang, Y. Wang, X. Chen, Y. Wang, et al., Ophiopogonin D and EETs ameliorate Ang II-induced inflammatory responses via activating PPARα in HUVECs, Biochem. Biophys. Res. Commun. 490 (2017) 123–133. [27] H.N. Althurwi, O.H. Elshenawy, A.O. El-Kadi, Fenofibrate modulates cytochrome P450 and arachidonic acid metabolism in the heart and protects against isoproterenol-induced cardiac hypertrophy, J. Cardiovasc. Pharmacol. 63 (2014) 167–177.
Conflict of interest The authors declare no competing financial interest. Acknowledgments This work was supported by Opening Foundation of Key Laboratory of Basic Pharmacology of Ministry of Education, Zunyi Medical University, Guizhou, China (No. JCYL-K-007), Natural Science Foundation of Chongqing, Chongqing, China (No. cstc2017jcjAX0211), 1505
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
EETs/PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy
T
Jie Zhanga, Hongmei Qiua, Jiajun Huanga, Shumei Dinga, Bo Huangb, Ping Zhouc, ⁎ Qingsong Jianga, a
Department of Pharmacology, Chongqing Key Laboratory of Biochemistry and Molecular Pharmacology, Chongqing Medical University, Chongqing 400016, Chongqing, PR China b Key Laboratory of Basic Pharmacology of Ministry of Education and Joint International Research Laboratory of Ethnomedicine of Ministry of Education, Zunyi Medical University, Zunyi 563003, Guizhou Province, PR China c Department of Traditional Chinese Medicine, Chongqing Medical University, Chongqing 400016, Chongqing, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Naringenin Diabetes Cardiomyocyte hypertrophy EETs CYP2J3 PPARs
Background: Cardiac hypertrophy is a key pathological process in the context of diabetic cardiomyopathy. Naringenin exhibits multiple pharmacological activities, but the effect of naringenin on cardiomyocyte hypertrophy under diabetic conditions is still far from clear. Methods: Cardiomyocyte hypertrophy was induced by high glucose (HG, glucose at 25.5 mmol/L) in H9c2 cells, which was determined by cell surface area, protein content and atrial natriuretic factor (ANF) mRNA expression. The effect of naringenin on cardiomyocyte hypertrophy was observed and its mechanisms were investigated by administration with various inhibitors on epoxyeicosatrienoic acids (EETs)/peroxisome proliferator-activated receptors (PPARs). The level of 14,15-EET was measured by ELISA. The mRNA and protein expressions were detected by qRT-PCR or Western blot, respectively. Results: Naringenin (0.1, 1, 10 μmol/L) inhibited cardiomyocyte hypertrophy in a concentration-dependent manner (P < 0.05), up-regulated the expressions of PPARα, PPARβ, PPARγ and CYP2J3 (P < 0.05), and increased the level of 14,15-EET (P < 0.05). PPOH, a CYP2J3 inhibitor, blocked the naringenin-mediated improvement of myocardial hypertrophy (P < 0.01), and abolished the up-regulation of PPARs expressions (P < 0.01). Meanwhile, MK886, a PPARα antagonist, GSK0660, a PPARβ antagonist, and GW9662, a PPARγ antagonist, reversed the protection of naringenin on cardiomyocytes (P < 0.05), and abrogated the up-regulation of CYP2J3-EET produced by naringenin (P < 0.05). Conclusions: Activation of EETs and PPARs function together may be contributed to the anti-hypertrophic effect of naringenin in H9c2 cells under high glucose condition.
1. Introduction Diabetic cardiomyopathy (DCM) is one of the most common complications of diabetes, which refers to a unique set of heart-specific pathological variables induced by hyperglycemia and insulin resistance and closely related to the increasing incidence of heart failure in diabetic patients. Cardiomyocyte hypertrophy is a key pathological process in the context of DCM, which is characterized by the increases of cardiac myocyte protein, cell surface area, as well as the mRNA expression of fetal gene, such as atrial natriuretic factor (ANF) [1]. It is however worth noting that specific strategies for preventing or treating diabetic cardiac hypertrophy have not been clarified yet.
Naringenin chemically known as 4′, 5, 7-trihydroxy flavanone (Fig. 1) is the predominant flavanone in citrus plants such as oranges, mandarins and grapefruit with multiple pharmacological activities [2]. Naringenin has potential health benefits for the treatment of obesity, hypertension, cardiovascular diseases (CVD), and metabolic syndrome [3]. Especially, naringenin has shown cardioprotective effect on pressure overload induced cardiac hypertrophy and hyperglycemia-induced cardiomyocytes injury [4,5]. However, the effect and the mechanism of naringenin on cardiomyocyte hypertrophy under diabetic background are still far from clear. Many cellular mechanisms are documented to underlie the development of cardiac hypertrophy in DCM. Inflammation is one of major
⁎ Corresponding author at: Department of Pharmacology, Chongqing Medical University, 1 Yixueyuan Road, Yuzhou District, Chongqing 400016, Chongqing, PR China. E-mail address: [email protected] (Q. Jiang).
https://doi.org/10.1016/j.biopha.2018.10.176 Received 28 August 2018; Received in revised form 17 October 2018; Accepted 30 October 2018 0753-3322/ © 2018 Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Table 2 Effects of naringenin on high glucose (HG)-induced cardiomyocytes hypertrophy in H9c2 cells.
Table 1 Primer sequences for real-time quantitative RT-PCR. Forward primer(5’-3’)
Reverse primer(5’-3’)
PPARα PPARβ PPARγ CYP2J3 ANF β-actin
GTGCCTGTCTGTCGGGATAG CTGGCAGAACCCAGTACCAG TTCTGGCCCACCAACTTC ATGCTTGTCACAGCGGGTTC GAGTGAGCCGAGACAGCAAA GCAGGAGTACGATGAGTCCG
TCTTCAGGTAGGCTTCGTGGAT GTGAGCCGGTGTCATGGTTA CCCACAGACTCGGCACTC GAGGAAATCAGCCAGGAACAGA TTGCTCCAATATGGCCTGGG ACGCAGCTCAGTAACAGTCC
Cell surface area (μm2) (n = 6)
Protein level (g/ L) (n = 6)
ANF mRNA (n = 3)
Control HG
662.67 ± 111.29 1629.67 ± 252.95
0.55 ± 0.09 1.23 ± 0.20
0.13 ± 0.04 1.29 ± 0.25
NAR (0.1 μmol/L) NAR (1 μmol/L) NAR (10 μmol/L)
1166.50 ± 281.54 * 910.17 ± 182.06 ** 760.00 ± 184.05 **
##
##
##
Fig. 1. Chemical structure of naringenin.
Gene
Group
0.87 ± 0.08 0.68 ± 0.09 0.59 ± 0.09
** ** **
0.45 ± 0.10 0.27 ± 0.15 0.18 ± 0.09
** ** **
HG: glucose at 25.5 mmol/L; NAR: naringenin; ANF: atrial natriuretic factor. mean ± S.D.,## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG.
obesity, inflammation, and the metabolic syndrome, which are the prime targets for drugs to prevent or control the above diseases [10]. Additionally, AA is catalyzed by three types of enzymes, namely, the cyclooxygenases, lipoxygenases, and cytochrome P450 (CYP) oxidase. The first two pathways are well-known, while the third is relatively less. AA can be metabolized into 20-hydroxyeicosatetraenoic acid (20HETE) by CYP4A/4F and epoxyeicosatrienoic acids (EETs) by CYP2C/ 2J. Remarkably, CYP2J is highly expressed in cardiovascular system. Among the subtypes of CYP2J, CYP2J2 is in human and CYP2J3 is in mouse [11]. EETs have many beneficial effects in metabolic diseases, including atherosclerosis, hypertension, cardiac hypertrophy, diabetes,
determinants of health complications, such as diabetes, CVD, and central nervous system diseases [6]. Evidences suggest that both peroxisome proliferator-activated receptors (PPARs) and arachidonic acid (AA) play critical roles in the pathogenesis of inflammation [7–9]. PPARs, including α, β, and γ subtypes, have a very significant action in
Fig. 2. Representative photomicrographs of H9c2 cells (scale bar: 100 μm, original magnification: ×400). The green is the actin microfilament dyed by phalloidinFITC, and the blue is the nuclei stained by 4′,6-diamidino-2-phenylindole (DAPI). Cardiomyocytes treated with glucose at 25.5 mmol/L (HG) became swollen and enlarged. Naringenin (0.1, 1, 10 μmol/L) markedly alleviated the morphological changes induced by HG. The addition of PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) (1 μmol/L) could antagonize the effect of naringenin (1 μmol/L) on the hypertrophic myocyte. 1499
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Table 3 Effects of different blockers on the anti-hypertrophy of naringenin in H9c2 cells exposed to high ambient glucose. Group
Cell surface area (μm2) (n = 6)
Protein level (g/L)(n = 6)
ANF mRNA (n = 3)
Control HG HG+NAR HG+NAR HG+NAR HG+NAR HG+NAR
769.25 ± 124.91 1732.50 ± 119.24 ## 919.20 ± 158.87 ** 1337.43 ± 145.41 ^^ 1085.63 ± 177.80 ^ 1139.00 ± 166.99 ^ 1103.63 ± 128.64 ^
0.56 1.24 0.64 1.13 0.89 0.87 0.97
0.12 1.29 0.24 1.04 0.55 0.62 0.48
(1 μmol/L) (1 μmol/L) + PPOH (1 μmol/L) (1 μmol/L) + MK886 (1 μmol/L) (1 μmol/L) + GSK0660 (1 μmol/L) (1 μmol/L) + GW9662 (1 μmol/L)
± ± ± ± ± ± ±
0.11 0.17 0.09 0.09 0.06 0.09 0.18
## ** ^^ ^ ^ ^
± ± ± ± ± ± ±
0.03 0.17 0.07 0.12 0.06 0.05 0.17
## ** ^^ ^^ ^^ ^^
HG: glucose at 25.5 mmol/L; NAR: naringenin; ANF: atrial natriuretic factor. PPOH: CYP2J3 inhibitor; MK886: PPARα antagonist; GSK0660: PPARβ antagonist; GW9662: PPARγ antagonist. mean ± S.D., ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^ P < 0.05, ^^ P < 0.01 vs HG + NAR (1 μmol/L).
Fig. 3. Effect of naringenin (NAR) on the expressions of mRNA and protein of PPARα (A), PPARβ (B), and PPARγ (C) in high glucose (HG, glucose at 25.5 mmol/L)induced hypertrophic cardiomyocytes. The expressions of PPARα, PPARβ and PPARγ mRNA and protein were down-regulated in HG-induced hypertrophic cardiomyocytes, which were up-regulated following treatment with NAR (0.1, 1, 10 μmol/L) in a dose-dependent manner. mean ± S.D., n = 3. ## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG. “+” or “-”: treatment with or without relevant reagent.
naringenin in diabetic cardiomyocyte hypertrophy. Hence, in the current study, the effect of naringenin on cardiomyocyte hypertrophy induced by high glucose in H9c2 cells was investigated; furthermore, a few targeted blockers of PPARs and EETs were used in order to understand better the roles and links of PPARs
non-alcoholic fatty liver disease, and kidney disease [12]. Hitherto, there have been few studies on the relationship between PPARs and EETs in diabetic cardiomyocyte hypertrophy. Many signal transduction pathways are involved in the effects of naringenin [3], however, there is few research about the role of PPARs and EETs on the effect of 1500
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 4. Effect of CYP2J3 inhibitor on the expressions of mRNA and protein of PPARα (A), PPARβ (B), and PPARγ (C) in hypertrophic cardiomyocytes treated with naringenin (NAR). PPOH, a CYP2J3 inhibitor, dramatically reversed the NAR-stimulated up-regulation of mRNA transcript and protein expression of PPARα, PPARβ, and PPARγ in hypertrophic cardiomyocytes induced by glucose at 25.5 mmol/L (HG). mean ± S.D., n = 3. ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^^ P < 0.01 vs HG + NAR (1 μmol/L). “+” or “−”: treatment with or without relevant reagent.
from Sigma Aldrich (Santa Clara, CA, USA), 14,15-EET (ELISA) Kit was purchased from J & L Biological Co. Ltd. (Shanghai, China), phalloidinFITC was purchased from Beyotime Biotechnology Co. Ltd. (Shanghai, China), RIPA lysate and Bicinchoninic Acid (BCA) Protein Quantification Kit were purchased from Beijing Dingguo Changsheng Biotechnology Co. Ltd. (Beijing, China), PPARα, PPARβ, PPARγ and GAPDH antibodies were purchased from Proteintech Group, Inc. (Hubei, China), CYP2J3 antibody was purchased from Bioss Biotechnology Co. Ltd. (Beijing, China), Trizol, Reverse Transcription Kit, SYBR-Green Supermix, and PCR primers were purchased from Biotech Engineering Co. Ltd. (Liaoning, China). The remaining reagents were analytical grade.
and EETs in conjunction with naringenin in cardiac hypertrophy under experimental diabetic condition.
2. Materials and methods 2.1. Chemicals and reagents Naringenin (MW: 272.25; purity ≥ 98%, HPLC-grade) was purchased from Chengdu Derick Biotechnology Co. Ltd. (Sichuan, China), 6-(2-proparglyloxyphenyl) hexanoic acid (PPOH) was purchased from Cayman Chemical Company (AnnArbor, MI, USA), MK886 and GSK0660 were purchased from Abcam (UK), GW9662 was purchased 1501
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 5. Effect of naringenin (NAR) on the expressions of CYP2J3 mRNA and protein (A) and on the level of 14,15-EET (B) in high glucose (HG, glucose at 25.5 mmol/ L)-induced hypertrophic cardiomyocytes. NAR (0.1, 1, 10 μmol/L) treatment dose-dependently upregulated the expressions of CYP2J3 mRNA and protein and increased the 14,15-EET level in hypertrophic cardiomyocytes. mean ± S.D., n = 3-6. ## P < 0.01 vs Control; * P < 0.05, ** P < 0.01 vs HG. “+” or “−”: treatment with or without relevant reagent.
2.2. Cell cultures and treatment
2.3. Morphometric analysis
H9c2 cells were obtained from Beijing Dingguo Changsheng Biotechnology Co. Ltd. (Beijing, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA), 10% fetal bovine serum (FBS, Gibco, USA), 100 U/mL penicillin and 100 U/mL streptomycin (Hyclone, USA) in a humidified atmosphere of 95% O2 and 5% CO2 at 37 °C. Naringenin, PPOH, MK886, GSK0660 and GW9662 were dissolved in dimethyl sulfoxide (DMSO, the final concentration being less than 0.1%) and diluted with DMEM. Cells between passages 3 and 5 were used for each experiment. The seeding density was 5 × 104 cells/mL for measuring cell surface area, or 5 × 105 cells/ mL for extracting mRNA, evaluating cellular protein content and determining 14,15-EET level. Cells in the logarithmic growth phase were cultured in normal medium (glucose at 5.5 mmol/L) for 24 h, and synchronized in DMEM containing 0.1% FBS for a further 24 h, then were stimulated with high glucose medium (HG, glucose at 25.5 mmol/ L) with or without naringenin (0.1, 1, 10 μmol/L) for another 48 h. Mannitol was used as an osmotic control (CON). For investigating the relationship of PPARs and/or EETs on the effect of naringenin, PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) at 1 μmol/L, respectively, were administered 4 h prior to HG exposure.
The cell suspension was seeded on a glass slide in a 24-well plate and cultured to make cells slide. Cardiomyocytes were fixed with 4% paraformaldehyde for 20 min, 0.1% TritonX-100 permeabilized for 5 min, 1% bovine serum albumin (BSA) for 1 h, phalloidin-FITC (1:100) for 1 h at room temperature in the dark, and 4′,6-diamidino-2-phenylindole (DAPI) stained for 5 min. Cellular hypertrophy was observed under microscope and NIH Medical Image Analysis System (Nikon, Tokyo, Japan) and calculated with Image-ProPlus 6.0 professional image analysis software. Five random fields (with approximately 5–15 cells per field) from every sample were averaged and expressed as μm2. The results of six independent samples were used for statistical analysis.
2.4. Measurement of cardiomyocyte protein content Cardiomyocytes were washed three times with ice-cold phosphatebuffered solution (PBS), then homogenized with RIPA lysis buffer for 20 min and finally centrifuged at 12,000g for 15 min at 4 °C. The protein concentration in the supernatant was determined with a BCA Protein Quantification Kit and calculated by standard curve.
1502
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Fig. 6. Effects of the antagonists of different PPARs subtypes on the naringenin-stimulated increase of CYP2J3-EET in glucose at 25.5 mmol/L (HG)-induced hypertrophic cardiomyocytes. MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) reversed the rescue effects of NAR (1 μmol/L) on the expression of CYP2J3 and the level of 14,15-EET in hypertrophic cardiomyocytes induced by HG. mean ± S.D., n = 3–6. ## P < 0.01 vs Control; ** P < 0.01 vs HG; ^ P < 0.05 vs HG + NAR (1 μmol/L). “+” or “−”: treatment with or without relevant reagent.
each group.
2.5. Analysis of mRNA via real-time quantitative reverse transcription PCR (qRT-PCR)
2.6. Western blotting analysis of proteins
According to the manufacturer’s instructions, Trizol was used to extract total RNA from cardiomyocytes. The PCR procedure (95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 40 cycles) was carried out on a qRTPCR instrument (Bio-Rad CFX96, CA, USA) using specific primer sequences (Table 1); β-actin was used as an internal reference gene. The mRNA relative expression was calculated using the ΔCt (Ct = cycle threshold) method as follows: the relative expression = 2‾ΔCt, ΔCt = Ct (target gene) − Ct (β-actin). The procedure was repeated 3 times for
Protein samples (30 μg) were subjected to SDS-polyacrylamide gel electrophoresis and transferred to the membrane by wet method. Antibodies [β-actin (1:3000), PPARα (1:1000), PPARβ (1:1000), PPARγ (1:1000) and CYP2J3 (1:1000)] were added and incubated over-night after closed with BSA. Then the membrane was incubated with secondary antibody (1:2000) for 2 h at room temperature. Enhanced Chemiluminescence (ECL) method was used for visualization and Bio1503
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
cardiomyocytes (P < 0.01); 14,15-EET level was reduced by 50.0%, compared to the control group (P < 0.01). However, different concentrations of naringenin visibly up-regulated the expressions of both CYP2J3 mRNA and protein, and increased 14, 15-EET level in a dosedependent manner (P < 0.05) (Fig. 5). As shown in Fig. 6, the antagonists of different PPARs subtypes, such as MK886, GSK0660 or GW9662, reversed the naringenin (1 μmol/ L)-stimulated up-regulation of CYP2J3 mRNA and protein expressions and the increase of 14,15-EET level in HG-induced hypertrophic cardiomyocytes (P < 0.05).
Rad gel imaging system was used to analyze images. The procedure was repeated 3 times for each group. 2.7. Measurement of 14,15-EET According to the manufacturer’s instructions, 50 μL of samples or standards were added to the coated wells and incubated at 37 °C for 30 min. Excluding the blank wells, 50 μL of HRP-labelled detection antibody were added to each well and incubated at 37 °C for 30 min. After washing the plate 5 times, 50 μL of substrate A and B were added to each well, incubated at 37 °C in the dark for 15 min, and 50 μL of stop solution were added. The optical density value of each well was measured at a wavelength of 450 nm within 15 min. The 14,15-EET content in each sample was calculated from the standard curve. Each group was tested six times.
4. Discussion Type 2 diabetes mellitus is a chronic metabolic disorder characterized by a persistent increase in blood glucose above normal level. Sustained hyperglycemia is an established risk factor of diabetic complications, such as DCM, including cardiac hypertrophy [13]. The present study found that incubation in the presence of HG (glucose at 25.5 mmol/L) induced cardiomyocyte hypertrophy in H9c2 cells, which manifested as increased cell surface area, protein content and ANF mRNA expression. The results suggested that high ambient glucose could mimic hyperglycemia that occurs in human diabetic patients; hence, HG-induced cardiac hypertrophy could be an in vitro model to simulate diabetic cardiomyocyte hypertrophy in a laboratory setting. Naringenin, as a common dietary flavanone constituent, has received considerable attention for pharmaceutical and nutritional development due to therapeutic applications in various neurological, cardiovascular, gastrointestinal, rheumatological, metabolic and malignant disorders [14]. Epidemiological evidence and clinical and preclinical studies suggest that naringenin positively influences on cardiac and metabolic parameters, preventing CVD and improving diabetes [15]. A supplement for 2 or more weeks with naringenin reduced glycaemia and insulinaemia in diabetic or insulin-resistant animals; moreover, glucose tolerance was improved [16–18]. Naringenin has also shown potential protective effect in diabetic complications, such as diabetic retinopathy [19], diabetic nephropathy [20], endothelial dysfunction [21] and diabetic hepatopathy [22]. However, there is few research about the effect of naringenin on diabetic cardiomyocyte hypertrophy. Recently, our team has reported the ameliorative effect of naringenin in cardiac hypertrophy in diabetic mice [23]. Consistent with the results, in the present investigation, naringenin, in a concentration-dependent manner, effectively inhibited HG-induced cardiomyocyte hypertrophy. Experimental evidence supports the beneficial effects of naringenin resulting from its antioxidant and anti-inflammatory properties [24]. The cardioprotective effect of naringenin has been proven to be by inhibiting phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt), extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) signalling pathways on pressure overload induced cardiac hypertrophy [4], or by upregulating ATP-sensitive K+ (KATP) channels and inhibiting the nuclear factor kappa B (NF-κB) pathway in hyperglycemia-induced injury [5]. Although hyperglycemia regulates multiple pathways in the diabetic heart, non-resolved chronic inflammation is thought to represent a central mechanism underlying associated adverse remodelling. Therefore, the regulation of inflammation-related signal pathway should not be ignored in the effect of naringenin on diabetic cardiac hypertrophy. It is well known that both PPARs and EETs play crucial roles in the regulation of the systemic inflammatory response. The effects of naringenin have been found to be related to the activation of PPARs. By activating PPARα, PPARβ or PPARγ, naringenin was found to regulate human and rat hepatic lipid metabolism at transcriptional level [25], and to ameliorate cognitive deficits in diabetic rats [24]. Meanwhile, EETs ameliorated angiotensin II-induced inflammatory responses via activating PPARα in HUVECs [26]. CYP2J2-EETs reduced liver inflammation and improved metabolic disorders in diabetic mice by
2.8. Statistical analysis Results were expressed as mean ± S.D. and statistical analysis was performed using SPSS 20.0. The mean value among groups was analyzed by one-way analysis of variance (ANOVA) and P < 0.05 was considered statistically significant. Graph Pad Prism 5.01 software was used for drawing. 3. Results 3.1. Effect of naringenin on HG-induced cardiomyocyte hypertrophy in H9c2 cells Light microscopic findings showed that the cardiomyocytes treated with glucose at 25.5 mmol/L (HG) became swollen and enlarged. Naringenin (0.1, 1, 10 μmol/L) markedly alleviated the morphological changes induced by HG. The addition of PPOH (CYP2J3 inhibitor), MK886 (PPARα antagonist), GSK0660 (PPARβ antagonist), or GW9662 (PPARγ antagonist) (1 μmol/L) could antagonize the effect of naringenin (1 μmol/L) on the hypertrophic myocyte (Fig. 2). Table 2 showed that the cell surface area, protein content and ANF mRNA expression treated with HG significantly increased to 2.5-, 2.2-, and 9.9-fold, respectively, compared with that of the control (P < 0.01). Supplementation with naringenin was found to ameliorate HGstimulated cardiomyocyte hypertrophy, as manifested by decreasing the cell surface area, protein level and ANF mRNA expression, in concentration-dependent manner (P < 0.05). Table 3 showed that PPOH, MK886, GSK0660, or GW9662 significantly inhibited the anti-hypertrophic effects of naringenin (P < 0.05). 3.2. Effects of naringenin on the expressions of PPARs mRNA and protein in HG-induced hypertrophic cardiomyocytes The expressions of PPARα, PPARβ, and PPARγ mRNA and protein, were significantly down-regulated in HG-induced hypertrophic cardiomyocytes, the mRNA expression decreased by 75.4%, 82.6%, and 79.0%, respectively (P < 0.01), while the protein expression reduced by 68.8%, 83.3%, and 68.0%, respectively (P < 0.01). Exposure to naringenin (0.1, 1, 10 μmol/L) significantly up-regulated the mRNA transcription and protein expression of PPARs in a dose-dependent manner (P < 0.05) (Fig. 3). However, the rescue effects of naringenin (1 μmol/L) on the mRNA and protein expressions of PPARs in hypertrophic cardiomyocytes were all dramatically reversed by PPOH (1 μmol/L) (P < 0.01) (Fig. 4). 3.3. Effects of naringenin on CYP2J3-EETs in HG-induced hypertrophic cardiomyocytes The expressions of CYP2J3 mRNA and protein were decreased by 66.7% and 80.0%, respectively, in HG-induced hypertrophic 1504
Biomedicine & Pharmacotherapy 109 (2019) 1498–1505
J. Zhang et al.
Guizhou Traditional Chinese Medicine Administration Bureau, Guizhou, China (No. QZYY-2016-004), and National Natural Science Foundation of China, China (No. 81471334 and 81871002).
activating PPARγ. However, few studies have reported the role of EETs on the effects of naringenin. Although our recent study showed that naringenin exhibits protective effect on cardiac hypertrophy in diabetic mice, which may be related to activation of EETs-PPARs, the mechanism of naringenin related to EETs and PPARs still requires further investigation. Therefore, a few blockers were used to elucidate the relationship between EETs and PPARs on the action of naringenin in the heart under diabetic conditions. The present study showed that CYP2J3-EETs was reduced, and the expressions of PPARα, PPARβ and PPARγ were down-regulated in high glucose-induced hypertrophic cardiomyocytes; supplementation with naringenin was accompanied by the up-regulation of CYP2J3 expression, the production of EETs, and the activation of PPARs. These findings suggested that naringenin have a preventive effect on cardiomyocyte hypertrophy induced by HG, both PPARs and EETs are involved in the mechanisms of naringenin, which are consistent with the results obtained previously in vivo [23]. PPOH, a CYP2J3 inhibitor, nullified the naringenin-stimulated activation of PPARs and reversed the positive effects of naringenin in hypertrophic cardiomyocytes. It has been reported that EETs may be endogenous ligands of PPARs [9]. Similarly, the study suggested that the activation of PPARs is required for the anti-cardiac hypertrophic effects of naringenin on CYP2J3-EETs stimulation under diabetic conditions. Afterwards, MK886, a PPARα antagonist or GSK0660, a PPARβ antagonist or GW9662, a PPARγ antagonist were given in turn. Notably, these blockers abrogated the naringenin-stimulated up-regulation of CYP2J3 and increase of 14,15EET, and also attenuated the anti-hypertrophic effects of naringenin in H9c2 cells, suggesting that PPARs can also regulate the activity of CYP2J3-EETs. Consistently, Althurwi et al. found that PPARα agonist fibrates possess CYP450 epoxygenase-inducing properties that lead to increase in endogenous EET production [27]. The results showed that the production of EETs may also be influenced by the activation of PPARs, at least under the present conditions. Collectively, EETs and PPARs function together in a positive feedback loop may be mediated the cardiomyocyte-protective effect of naringenin in H9c2 cells exposed to high ambient glucose. In conclusion, the present study found that naringenin supplementation could prevent cardiomyocyte hypertrophy induced by high glucose concentration in H9c2 cells, which was followed by increasing the activation of CYP2J3-EETs and stimulating the expression of PPARs. Meanwhile, CYP2J3 blocker largely abolished the naringenin-induced up-regulation of PPARs, and PPARs inhibitors also removed the naringenin-stimulated increase of CYP2J3-EETs, which were accompanied by the termination of naringenin-mediated cardiomyocyte protection. These results suggested that naringenin has a role on cardio-protection under diabetic condition, at least in part through the operation of EETs/ PPARs-related signalling pathway. In other words, both the stimulation of EETs and the activation of PPARs were involved in the protective effect of naringenin in hypertrophic cardiomyocytes in the experimental setting of diabetes. The findings will possibly stimulate more interest in naringenin as a potential therapeutic drug against DCM-associated hypertrophy. However, owing to the complexity of the molecular pathological mechanism of diabetic cardiac hypertrophy, the action of naringenin still requires further confirmation by additional researches.
References [1] M. Nayor, D.M. Enserro, V. Xanthakis, M.G. Larson, E.J. Benjamin, J. Aragam, et al., Comorbidities and cardiometabolic disease: relationship with longitudinal changes in diastolic function, JACC Heart Fail. 6 (2018) 317–325. [2] I.A. Mir, A.B. Tiku, Chemopreventive and therapeutic potential of “naringenina flavanone” present in citrus fruits, Nutr. Cancer 67 (2015) 27–42. [3] M.A. Alam, N. Subhan, M.M. Rahman, S.J. Uddin, H.M. Reza, S.D. Sarker, Effect of citrus flavonoids, naringin and naringenin, on metabolic syndrome and their mechanisms of action, Adv. Nutr. 5 (2014) 404–417. [4] N. Zhang, Z. Yang, Y. Yuan, F. Li, Y. Liu, Z. Ma, Q. Tang, Naringenin attenuates pressure overload- induced cardiac hypertrophy, Exp. Ther. Med. 10 (2015) 2206–2212. [5] Q. You, Z. Wu, B. Wu, C. Liu, R. Huang, L. Yang, R. Guo, K. Wu, J. Chen, Naringin protects cardiomyocytes against hyperglycemia-induced injuries in vitro and in vivo, J. Endocrinol. 230 (2016) 197–214. [6] E. Lontchi-Yimagou, E. Sobngwi, T.E. Matsha, A.P. Kengne, Diabetes mellitus and inflammation, Curr. Diab. Rep. 13 (2013) 435–444. [7] W. Wahli, L. Michalik, PPARs at the crossroads of lipid signaling and inflammation, Trends Endocrinol. Metab. 23 (2012) 351–363. [8] L. Xue, K. Wu, H.M. Qiu, B. Huang, R.C. Chen, W. Xie, Q.S. Jiang, Polydatin exhibits the hepatoprotective effects through PPAR-α/-β signaling pathway in Streptozocininduced diabetic mice, J. Funct. Foods 36 (2017) 341–347. [9] X. Xu, X.A. Zhang, D.W. Wang, The roles of CYP450 epoxygenases and metabolites, epoxyeicosatrienoic acids, in cardiovascular and malignant diaeases, Adv. Drug Deliv. Rev. 63 (2011) 597–609. [10] B. Grygiel-Górniak, Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications - a review, Nutr. J. 13 (2014) 17, https://doi. org/10.1186/1475-2891-13-17. [11] R.J. Roman, P-450 metabolites of arachidonic acid in the control of cardiovascular function, Physiol. Rev. 82 (2002) 131–185. [12] J. He, C. Wang, Y. Zhu, D. Ai, Soluble epoxide hydrolase: a potential target for metabolic diseases, J. Diabetes 8 (2016) 305–313. [13] Y. Katsuda, T. Sasase, H. Tadaki, Y. Mera, Y. Motohashi, Y. Kemmochi, et al., Contribution of hyperglycemia on diabetic complications in obese type 2 diabetic SDT fatty rats: effects of SGLT inhibitor phlorizin, Exp. Anim. 64 (2015) 161–169. [14] N. Rani, S. Bharti, B. Krishnamurthy, J. Bhatia, C. Sharma, M.A. Kamal, et al., Pharmacological properties and therapeutic potential of naringenin: a citrus flavonoid of pharmaceutical promise, Curr. Pharm. Des. 22 (2016) 4341–4359. [15] L. Testai, V. Calderone, Nutraceutical value of citrus flavanones and their implications in cardiovascular disease, Nutrients 9 (2017) pii: E502. [16] A.K. Singh, V. Raj, A.K. Keshari, A. Rai, P. Kumar, A. Rawat, et al., Isolated mangiferin and naringenin exert antidiabetic effect via PPAR(γ)/GLUT4 dual agonistic action with strong metabolic regulation, Chem. Biol. Interact. 280 (2018) 33–44. [17] B. Gross, M. Pawlak, P. Lefebvre, B. Staels, PPARs in obesity-induced T2DM, dyslipidaemia and NAFLD, Nat. Rev. Endocrinol. 13 (2017) 36–49. [18] N.A. Nyane, T.B. Tlaila, T.G. Malefane, D.E. Ndwandwe, P.M.O. Owira, Metforminlike antidiabetic, cardio-protective and non-glycemic effects of naringenin: Molecular and pharmacological insights, Eur. J. Pharmacol. 803 (2017) 103–111. [19] D.I. Al-Dosari, M.M. Ahmed, S.S. Al-Rejaie, A.S. Alhomida, M.S. Ola, Flavonoid naringenin attenuates oxidative stress, apoptosis and improves nneurotrophic effects in the diabetic rat retina, Nutrients 9 (2017) pii: E1161. [20] N. Yan, L. Wen, R. Peng, H. Li, H. Liu, H. Peng, et al., Naringenin ameliorated kidney injury through Let-7a/TGFBR1 signaling in diabetic nephropathy, J. Diabetes Res. (2016) 8738760. [21] B. Ren, W. Qin, F. Wu, S. Wang, C. Pan, L. Wang, et al., Apigenin andnaringenin regulate glucose and lipid metabolism, and ameliorate vascular dysfunction in type 2 diabetic rats, Eur. J. Pharmacol. 773 (2016) 13–23. [22] D. Sirovina, N. Oršolić, G. Gregorović, M.Z. Končić, Naringenin ameliorates pathological changes in liver and kidney of diabetic mice: a preliminary study, Arh. Hig. Rada Toksikol. 67 (2016) 19–24. [23] J. Zhang, H. Qiu, J. Huang, S. Ding, B. Huang, Q. Wu, et al., Naringenin exhibits the protective effect on cardiac hypertrophy via EETs-PPARs activation in streptozocininduced diabetic mice, Biochem. Biophys. Res. Commun. 502 (2018) 55–61. [24] Z. Qi, Y. Xu, Z. Liang, S. Li, J. Wang, Y. Wei, B. Dong, Naringin ameliorates cognitive deficits via oxidative stress, proinflammatory factors and the PPARγ signaling pathway in a type 2 diabetic rat model, Mol. Med. Rep. 12 (2015) 7093–7101. [25] J. Goldwasser, P.Y. Cohen, E. Yang, P. Balaguer, M.L. Yarmush, Y. Nahmias, Transcriptional regulation ofhuman and rat hepatic lipid metabolism by the grapefruit flavonoid naringenin: role of PPARalpha, PPARgamma and LXRalpha, PLoS One 5 (2010) e12399, https://doi.org/10.1371/journal.pone.0012399. [26] X. Huang, Y. Wang, Z. Zhang, Y. Wang, X. Chen, Y. Wang, et al., Ophiopogonin D and EETs ameliorate Ang II-induced inflammatory responses via activating PPARα in HUVECs, Biochem. Biophys. Res. Commun. 490 (2017) 123–133. [27] H.N. Althurwi, O.H. Elshenawy, A.O. El-Kadi, Fenofibrate modulates cytochrome P450 and arachidonic acid metabolism in the heart and protects against isoproterenol-induced cardiac hypertrophy, J. Cardiovasc. Pharmacol. 63 (2014) 167–177.
Conflict of interest The authors declare no competing financial interest. Acknowledgments This work was supported by Opening Foundation of Key Laboratory of Basic Pharmacology of Ministry of Education, Zunyi Medical University, Guizhou, China (No. JCYL-K-007), Natural Science Foundation of Chongqing, Chongqing, China (No. cstc2017jcjAX0211), 1505