Effect of aflatoxin B1-8,9-epoxide-DNA adducts on transcription of a supF gene fragment

CANCER LETTERS

ELSEVIER

Cancer Letters 109 (1996) 77-83

Effect of aflatoxin B1-8,9-epoxide-DNA adducts on transcription of a supF gene fragment Fu-Li Yu’, Jeanne M. Cahill, Leonora J. Lipinski, Anthony Dipplea,* ‘Chemistry of Carcinogenesis Laboratory, ABL-Basic Research Program, NCI-Frederick Frederick, MD 21702, c;SA

Cancer Research and Development Center,

Received 18 July 1996; accepted 7 August 1996

Abstract A linearized template, obtained from the vector pGEM-3Zf(+) containing a supF gene fragment, was treated with aflatoxin B1-8,9-epoxide (AFBI epoxide) and transcription in vitro was then studied. The template functions of both strands of the supF gene were similarly inhibited as shown by transcription with both T7 and SP6 RNA polymerases. This inhibition was dosedependent and affected the elongation step more extensively than the initiation step. Gel electrophoretic analysis of RNA formed by T7 RNA polymerase indicated that template treated with drfferent AFBl epoxide doses yielded the same three major truncated RNA fragments. Sequence analysis showed that these major sites of RNA truncation occurred in the vicinity of adjacent guanine residues in the template. Keywords: Transcription; Aflatoxin; Carcinogen

1. Introduction

AAatoxin B1 (AFB,), a naturally occurring mycotoxin produced by Aspergillus flavus and Aspergillus parasiticus, is a known potent rat liver carcinogen [l] that depends upon metabolic transformation to an electrophile for activity [1,2]. AJ?B,exe-8,9-epoxide (AFB, epoxide) is believed to be the ultimate carcinogen in vivo [3-61 and this compound, which is now available through chemical synthesis in vitro [7], is * Corresponding author. ’ Permanent address: Department of Biomedical Sciences, University of Illhois, College of Medicine at Rockford, 1601 Parkview Avenue, Rockford, IL 61107, USA

Published by Elsevier Science Ireland Ltd. PI2 SO304-3835(96)04423-O

responsiblefor the binding of this carcinogento DNA [3]-[:3]. The major reaction of AFB epoxide with DNA is with guanine residues [1,4]-[6,9] and the resultant adducts have been the focus for studies of the mechanism of action of AFB, for many years [ 1,9]. However, there is evidence that adduct formation with adenine [lO,l l] and cytosine residues [8,12-141 also occurs. This report describesthe effect of AFBl epoxideDNA adduct formation on transcription in vitro. The data indicate that AFB, epoxide treatmentof template DNA inhibits elongation of RNA and that the termination of RNA synthesisis non-random and preferentially occurs at three sites on the supF gene template used in these experiments.

F.-L. Yu et al. I Cancer Letters 109 (1996j 77-83

Begin T7 RNA polymerase

product CGAATTCGAGCAGGCCAGTAAAAGCATTACCTGTGGTGGGGTTCCCGAGCG ~CCGCITAAGCTCGTCCGGTCATTTTCGTMYTGGACACCACCCCAAGGGCTCGC EcoRI

1go 6,O 710 *!J 900 GCCAAkGGAGCAGAtTCTAAATCT&XTCATCGkTTCGAAGG+TCGAATCCT CGG’Il?K!CCTCGTCTGAGATTTAGACGGCAGTAGCTGAAGCTTCCAAGCTTAGGA

130 l?O qo 140 ~CCCC~AC~A~~AT~AC~~GTCC~GATCC AGGGGGTGGTGGTAGTGAAAGTTTTCAGGCCCTAGG BamBI

SP6 Promoter pGem-3Zf (+) I Begin

SP6 RNA

polymerase product

Fig. 1. Region of pA4 usedfor transcription studies.T7 polymerasescopies the lower strandto yield RNA with sequenceanalogousto that of the upper strandwhereasSP6polymerasecopies the upper strand.The sequencehas been numberedbeginning with the tirst nucleotide in the T7 RNA polymerase product. With this numbering the supF structural gene is 39-123.

2. Materials and methods

2.2. Synthesis of AFB, epoxide

2.1. Preparation of plasmid vector pA4

AFBi epoxide was synthesized by reaction of AFBi with dimethyldioxirane in anhydrous acetone following Baertschi et al. [7]. In concert with previous findings [ 181, the epoxide preparation contained the exo8,9-epoxide (79%) and the non-DNA-reactive endo8,9-epoxide (6%) and 8,9-dihydrodiol (10%). This product composition was determined following the approaches of Raney et al. [19] but using /3-mercaptoethanol to trap the epoxide products and assuming the order of elution of the products would be the same as for the AFB, epoxide-glutathione conjugates. The extinction coefficient of 21.8 mM-’ cm-’ at 362 nm [19] was used to establish the exo 8,9-epoxide concentration. AFBl epoxide solutions were stored in acetone at 40°C.

The supF gene of pS189 [15,16] was amplified by PCR using primers complementary to positions 7291 and positions 200- 181, which also contained EcoRl and BarnHI recognition sequences, respectively, at their S-ends. The PCR-amplified fragment and the vector pGEM-3Zf(+) (Pi-omega, Madison Wl) were each digested with both EcoRl and BamHl, purified using a USBioclean@ MP kit (USB, Cleveland, OH), and were then ligated with T4 DNA ligase following established procedures [17]. The ligation mixture was used to transform competent E. coli DHSa cells. Vector DNA from ten of the resultant colonies was isolated and sequenced. One of the several vector clones (designated pA4) that contained the supF sequence insert at the cloning sites (illustrated in Fig. 1) was selected to provide DNA template for transcription studies. Plasmid DNA was prepared using the Wizard Maxiprep kit @omega).

2.3. In vitro transcription of pA4 and analysis of RNA products For transcription with SP6 or T7 RNA polymerases,

19

F.-L. Yu et al. I Cancer Letters 109 (1996) 77-83

pA4 DNA was linearized with either EcoRl or BamHl (Fig. 1) and then purified using the Wizard DNA clean-up system @omega) or phenol/chloroform extraction followed by ethanol precipitation. Linearized DNA (1.5 pg in 3 ~1 of 10 mM Tris/l mM EDTA, pH 7.5) was treated with 1.5 ~1 of the desired concentration of exo-AFB 1-8,9-epoxide in DMSO for 10 min at room temperature. These DNA reaction solutions, together with reagents from the RiboMax Large Scale RNA production system for SP6 or T7 RNA polymerase (Promega) were used in transcription assays. Assays for the elongation step of RNA synthesis were in 20 ~1 reaction volumes containing 1.5 pg DNA, 1 &i [CY-‘2P]UTP (3000 Ci/mmol), 600 U of RNA polymerase (SP6 or ‘l7), 30 U RNasin, 380 U yeast inorganic pyrophosphatase, 5 mM rNTPs, 80 mM HEPES-KOH (pH 7.5), 2 mM spermidine, 40 mM DTT and 32 mM MgC12 (for SP6 RNA polymerase) or 24 mM MgC12 (for ‘I7 RNA polymerase). For T7 RNA polymerase, assays for the initiation step were also undertaken. These were as above, except the GTP concentration was 0.5 mM and l-5 PCi [T-~*P]GTP was used to label the 5’ end of the nascent RNA, in the absence of [~Y-~~P]UTP.Transcription reactions were incubated at room temperature for 2 h (SP6 RNA polymerase) or at 37°C for 45 min (T7 RNA polymerase.). RNA was precipitated with TCA, collected on GF/C filters, and quantified by scintillation spectrometry as previously described [20-231. The RNA products were also analyzed by 12% polyacrylamide sequencing gel electrophoresis followed by autoradiography. 2.4. RNA sequencing End-labeled RNA was prepared following the T7 RNA polymerase initiation protocol above, but 2.5 mM GTP and 10 &i [Y-~*P]GTP were used and incubation was for 2 h at 37°C. Product was precipitated with ethanol in 0.3 M sodium acetate (pH 5.2) and the precipitate was resuspended in 10 mM Tris, 1 mM EDTA buffer (pH 7.5). RNA sequencing was performed by modification of established nuclease and alkaline hydrolysis methods [24]. The RNA transcribed from 1 pg DNA template together with 0.9 pg tRNA was heated to 95°C for 10 min. For guanine-specific cleavage, aliquots containing RNA pro-

Table 1 Effect on RNA synthesis of AFB, epoxide-treatment of DNA templatea RNA polymerase

Treatment

RNA yieldd (nmol UMP incorporated/pg DNA)

T7

Control DMSOb AFB, epoxide” Control DMSO AFB,

3.54 2.74 2.03 0.27 0.64 0.39

SP6

f f f f + f

0.64 0.46 0.21 0.08 0.09 0.06

?ncubations contained 1.5 pg of DNA template. bFina1 DMSO concentration was 7.5%. ‘Template DNA was exposed to 0.05 pg AFB, epoxide per pg DNA. dValues are the means of three determinations f SD.

duced from 1 pg template DNA were incubated with 0.002 U of ribonuclease T, in 23 mM sodium citrate (pH X5), 6.6 M urea, 1 mM EDTA, 0.03% xylene cyan01 at 50°C for 20 min. For alkaline hydrolysis of RNA to generate a nucleotide ladder, aliquots were incubated in 50 mM sodium phosphate (pH 12) at 65°C for 40 min. 3. Results and discussion The effects of AFB, epoxide treatment on transcription of the supF insert are summarized in Table 1. The solvent (DMSO) used to administer the epoxide had different effects on the two polymerases in that it inhibited the T7 RNA polymerase activity by 22% and enhanced SP6 RNA polymerase transcription by more than two-fold. The effect of DMSO on SP6 RNA polymerase was explored further and it was found that reactions supplemented with 5, 7.5, 10, 20 and 30% DMSO gave 150, 220, 250, 140 and 15% of control RNA synthesis. Thus, it was clear that the concentration of DMSO that gave optimal enhancement in the assay was 10%. AFBr epoxide treatment inhibited the DNA-directed RNA synthesis by 26% for the T7 RNA polymerase and by 39% for the SP6 RNA polymerase. Although the inhibition of RNA synthesis seemed greater using SP6 RNA polymerase, T7 polymerase was selected for more extensive study because the

F.-L. Yu et al. I Cancer Letters 109 (1996) 77-83

80

whereas AFB 1 epoxide-treated templates directed the synthesis of both full-length RNA products and truncated molecules that migrated further on the gel (lanes 2-4 and 6-8). The results were similar irrespective of the labeling method or the AFBt epoxide concentration used. It is of interest that the chemical treatment of the template did not yield evenly distributed RNA transcripts but that three distinct truncation products were present, suggesting that particular regions of the template were damaged more substantially than others. To identify the sites at which T7 RNA polymerase preferentially halted, the truncated RNA products v-r-

I 0.05

(-)l

cLgAFB 1..8,9-epoxide/l.S

2

3

4

5

6

7

8

0115

o.;o c1g

DNA

Fig. 2. RNA synthesis by the T7 polymerase after treatment of the template with various doses of epoxide was followed using either [y-“P]GTP (open squares) or [w~~P]UTP (filled squares) to measure initiation or elongation of RNA synthesis, respectively. Values given are means of two independent experiments.

amount of RNA produced was much greater (-13-fold with untreated template) with this enzyme. The effects of epoxide treatment on RNA synthesis could arise from inhibition of either the initiation or the elongation steps of the transcriptional process. To investigate the initiation step, RNA was labeled using [T-~~P]GTP, the initial nucleotide incorporated in RNA made by T7 polymerase (see Fig. 1). These findings were compared with those designed to study the elongation step, in which RNA was intemally labeled using [a-r2P]UTP. Fig. 2 shows that with increasing concentrations of AFB, epoxide, both of the above steps were affected but that initiation was inhibited less substantially than elongation. Since inhibition of initiation might require AFBt adducts to be located in the T7 promoter region, whereas inhibition of elongation could be caused by adducts present anywhere in the transcribed sequence, the differing effects on initiation and elongation may reflect the different target sizes. RNA products from control and AFBr epoxidetreated DNA were also analyzed by polyacrylamide gel electrophoresis (Pig. 3). The untreated template gave rise to full-length high molecular weight products seen near the top of the gel (lanes 1 and 5),

Fig. 3. Electrophoretic analysis of RNA products made by the T7 polymerase m the experiment described in Fig. 2. In lanes l-4, transcripts were labeled internally with [cx-~*P]UTP and the template (1.5 pg DNA) was untreated (lane 1) or exposed to 0.05, 0.1 or 0.15 pg AFB, epoxide (lanes 2, 3 and 4, respectively). In lanes 5-8, transcripts were labeled with [y-42P]GTP at the 5’ end of the RNA chain and the templates were as in lanes 14.

F.-L. Yu et al. I Cancer Letters 109 (1996) 77-83

were compared with sequence ladders derived from alkaline or ribonuclease TI treatment of the full length 5’ y-32P end-labeled RNA (Fig. 4). In this experiment, the resolution of the gel was improved by precipita1234 RNA

DNA temolate

6

G89 -(G83)-(G80)-

G68 _G65 -

R’

G55 _G54 --

3’

81

tion of the RNA products with ethanol prior to loading on the gel, by using a sharks-tooth comb and by increasing the time of electrophoresis. The RNA sequence was identified based on results from the alkaline ladder and T1 cleavage (lanes 1 and 2, Fig. 4; see Fig. 1 for sequence numbering). At this level of resolution, four bands of similar intensity in all lanes were present, indicating that RNA polymerase hesitated at these sites even with undamaged template. However, in the AFB, epoxide-treated lane, additional bands that corresponded to the three major truncation products seen in Fig. 3 were apparent (lane 5, Fig. 4). It was clear that these products consisted of multiple RNA fragments and occurred at RNA positions 48-50,82-83, and 112-l 16, as indicated in Fig. 4. In addition, minor termination bands were discernible at RNA positions 53-56 and 107-108. Since the truncations are presumably due to epoxide treatment that leads to adduct formation in the template, the template sequences in the vicinity of the truncation sites have been listed adjacent to the truncation bands on the gel (Fig. 4). Examination of the template sequence that was resolved in this experiment (from 47 to 118 in the lower strand in Fig. 1) showed that all the multiple guanine sequences in the template were associated with truncation sites. However, there is no discernible pattern in the specific sites of arrest in relation to these guanines. Thus, the location of the adduct responsible for blocking the progress of the polymerase cannot be specified and these adducts could be located on nucleotide bases other than guanine. It is notable that thymine was infrequently represented in the template near these truncations and that guanine and cytosine seem to be relatively abundant. The association of multiple guanines with these truncated RNA products suggests that two or more adducts close to one another may be

Fig. 4. End-labeled control transcript was cleaved with ribonuclease ‘T, to give a ladder of fragments with guanosine 3’-phosphate termin) and with alkali to yield a ladder representing removal of single nucleotides from tb- 3’ end of the RNA. These sequencing reactions were loaded on a 12% polyacrylamide gel adjacent to 5’ end-labeled transcripts from untreated or AFB, epoxide-treated DNA. Lane 1, T, ribonuclease sequencing lane; lane 2, alkali sequencing lane; lane 3, RNA made on a template exposed to AFB, tepoxide at 0.05 &1.5 pg DNA; lane 4, RNA made on an unmodified template.

F.-L. Yu et al. I Cancer Letters 109 (1996) 77-83

82

associated with the prominent RNA truncations seen here. Other investigators [25] have found that polymerase arrest by benzo[a]pyrene DNA adducts is much more frequent for DNA polymerase than for RNA polymerase and this also could suggest that multiple adducts are required to inhibit the progress of RNA polymerases. Also, studies with single adducts or lesions in synthetic templates have shown that T7 RNA polymerase and RNA polymerase II can bypass some adducts with varying efficiency depending on the specific adduct involved, although some single adducts can be essentially complete blocks to elongation [26-281. The present observations are consistent with these earlier findings if a single AFBt adduct is insufficient for complete arrest of T7 RNA polymerase and the truncation seen here occurred at sites of multiple adduct formation in the template.

Acknowledgements We thank Drs. Rajiv Agarwal and Jan Szeliga of this Laboratory for the synthesis and analysis of the aflatoxin epoxide, Dr. Helen L. Ross for PCR amplification of the supF fragment, and Mr. John E. Page for sequencing pA4 DNA. This research was sponsored by the National Cancer Institute, DHHS, under contract No. NOl-CO-46000 with ABL. The contents of this publication do not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government.

References Cl1Busby, W.F. and Wogan, G.N. (1984) Aflatoxins. In: Chemical Carcinogens, 2nd edn., ACS Monograph 182, pp. 9451136. Editor: C.E. Searle. American Chemical Society, Washington, DC. PI Miller, E.C. and Miller, J.A. (1981) Searches for ultimate chemical carcinogens and their reactions with cellular macromolecules, Cancer, 47, 2327-2345. [31 Swenson, D.H., Miller, E.C. and Miller, J.A. (1973) Aflatoxin B,-2,3-oxide: evidence for its formation in rat liver in vivo and by human liver microsomes in vitro, B&hem. Biophys. Res. Commun., 60, 1036-1043. [4] Lin, J.K., Miller, J.A. and Miller, E.C. (1977) 2,3-Dihydro-2(guan-7-yl)-3-hydroxyaflatoxin Bt: a major acid hydrolysis

product of aflatoxin Br-DNA or ribosomal RNA adducts formed in hepatic microsome-mediated reactions and in rat liver in vivo, Cancer Res., 37, 4430-4438. PI Essigmann, J.M., Broy, R.G., Nadzam, A.M., Busby Jr., W.F., Reinhold, V.N., Buchi, G. and Wogan, G.N. (1977) Structure identification of the major DNA adduct formed by aflatoxin Bt in vitro, Proc. Natl. Acad. Sci. USA, 74, 18701874. 161Martin, C.N. and Garner, R.C. (1977) Aflatoxin Bt-oxide generated by chemical or enzymic oxidation of aflatoxin Br causes guanine substitution in nucleic acids, Nature, 267, 863-865. [71 Baertschi, S.W., Raney, K.D., Stone, M.P. and Harris, T.M.

(1988) Preparation of the 8,9-epoxide of the mycotoxin aflatoxin B,: the ultimate carcinogenic species, J. Am. Chem. Sot., 110, 7929-7931. [81 Yu, F.L., Bender, W. and Hutchcroft, A. (1994) Studies on the binding and transcriptional properties of aflatoxin Bt-8,9epoxide, Carcinogenesis, 15, 1737-1741. [91 Groopman, J.D., Cain, L.G. and Kensler, T.W. (1988) Aflatoxin exposure in human populations: measurements and relationship to cancer. CRC Crit. Rev. [lOI D’Andrea, A.D. and Haseltine, W.A. (1978) Modification of DNA by aflatoxin B creates alkali-labile lesions in DNA at positions of guanine and adenine, Proc. Natl. Acad. Sci. USA, 75,4120-4124.

[Ill Iyer, R.S., Vochler, M.W. and Harris, T.M. (1994) Adenine adduct of aflatoxin B epoxide, J. Am. Chem. Sot.. 116, 8863-8869. 1121 Yu, F.L., Bender, W. and Geronimo, I.H. (1990) Base and

sequence specificities of aflatoxin Bt binding to single- and double-stranded DNA& Carcinogenesis, 11, 475-478. 1131 Yu, F.L., Bender, W. and Wu, Z. (1991) Transcriptional effect of aflatoxin B, on cytosine and/or hypoxanthine containing DNAs, Mol. Cell. Biochem., 103, l-8. [14] Yu, F.L., Huang, J.X., Bender, W., Wu, Z. and Change, J.C.S. (1991) Evidence for the covalent binding of aflatoxin Brdichloride to cytosine in DNA, Carcinogenesis, 12, 9971002.

Seidman, M.M., Dixon, K., Razzaque, A., Zagursky, R.J. and Berman, M.L. (1985) A shuttle vector plasmid for studying carcinogen-induced point mutations in mammalian cells, Gene, 38, 233-237. 1161 Kraemer, K.H. and Seidman, M.M. (1989) Use of supF, an Escherichia coEi tyrosine suppressor tRNA gene, as a mutagenic target in shuttle-vector plasmids, Mutat. Res., 220, 61-

[I51

72. 1171 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular

Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [I81 Raney, K.D., Coles, B., Guengerich, F.P. and Harris, T.M. (1992) The endo-8,9-epoxide of aflatoxin B,: a new metabolite, Chem. Res. Toxicol., 5, 333-335. [I91 Raney, K.D., Meyer, D.J., Ketterer, B., Harris, T.M. and Guengerich, F.P. (1992) Glutathione conjugation of aflatoxin B, ego- and endo-epoxides by rat and human glutathione Stransferases, Chem. Res. Toxicol., 5, 470-478.

F.-L. Yu et al. I Cancer Letters 109 (1996) 77-83 [20] Yu, F.L. (1977) Mechanism of allatoxin B, inhibition of rat hepatic nuclear RNA synthesis, J. Biol. Chem., 252, 32513254. [21] Yu, F.L. (1981) Studies on the mechanism of aflatoxin Bi inhibition of rat liver nucleolar RNA synthesis, J. Biol. Chem., 256, 3292-3297. [22] Yu, F.L. (1983) Preferential binding of aflatoxin B, to the transcriptionally active regions of rat liver nucleolar chromatin in vivo and in vitro, Carcinogenesis, 4, 889-893. [23] Yu, F.L., Cass, M. and Rokusek, L. (1982) Tissue, sex and animal species specificity of aflatoxin B, inhibition of nuclear RNA polymerase II activity, Carcinogenesis, 3, 1009-l 105. [24] Doris-Keller, H., Maxam, A.M. and Gilbert, W. (1977) Mapping adenines, guanines, and pyrimidines in RNA, Nucleic Acids Res., 4, 2527-2538.

83

[25] Thrall, B.D., Mann, D.B., Smerdon, M.J. and Springer, D.L. (1992) DNA polymerase, RNA polymerase and exonuclease activities on a DNA sequence modified by benzo[a]pyrene diolepoxide, Carcinogenesis, 13, 1529-1534. [26] Choi, D.-J., Marino-Alessandri, D.J., Geacintov, N.E. and Scicchitano, D.A. (1994) Site-specific benzo[a]pyrene diol epoxide-DNA adducts inhibit transcription elongation by bacteriophage T7 RNA polymerase, Biochemistry, 33,780-787. [27] Chen, Y.-H. and Bogenbagen, D.F. (1993) Effects of DNA lerions on transcription elongation by T7 RNA polymerase, J. Biol. Chem., 268, 5849-5855. [28] Donahue, B.A., Fuchs, R.P.P., Reines, D. and Hanawalt, P.C.(1996) J. Biol. Chem., 271, 10588-10594.