- Email: [email protected]
Effect of breviscapine against hepatic ischemia reperfusion injury
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
Effect of breviscapine against hepatic ischemia reperfusion injury Yan-zhu Lin, BD,a,c,1 Zhi-yuan Lu, MD,b,1 Xiao-hui Liang, MD,c Kang Li, MD,d Bo Peng, MD,c and Jin Gong, MD,PhDc,* a
Clinical Medicine, International School, Jinan University, Guangzhou, China Department of Stomatology, Medical College, Jinan University, Guangzhou, China c Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou, China d Department of Gastrointestinal Surgery, YueBei People’Hospital, Shaoguan, China b
article info
abstract
Article history:
Background: Breviscapine is an active ingredient extracted from traditional Chinese medi-
Received 11 December 2015
cine Erigeron breviscapus. The purpose of this study was to investigate the effect of
Received in revised form
breviscapine injection on hepatic ischemia and/or reperfusion injury.
29 January 2016
Methods: Forty rats were randomly divided into five groups (n ¼ 8): Sham group, Ischemia
Accepted 11 February 2016
reperfusion 1 (I/R1) þ normal saline (NS) group, I/R1 þ breviscapine (Bre), I/R2 þ NS group, and
Available online 19 February 2016
I/R2 þ Bre group. Group1 and group2 represent ischemia time for 10 min and 30 min, respectively. Breviscapine or normal saline was administered to rats (single dose of 10 mg/Kg,
Keywords:
intravenously) 30 min before hepatic ischemia. Serum transaminases, histopathologic
Erigeron breviscapus
changes, malondialdehyde (MDA), and superoxide dismutase (SOD) in liver tissues were
Breviscapine
evaluated. The expression level of mitochondrial fusion 2 (Mfn2) was also investigated.
Ischemia reperfusion
Results: After 24-h reperfusion, based on the histopathologic analysis, compared with NS
Liver
control group, the liver function was improved in breviscapine group. Liver enzymes aspartate
Mitofusin 2
and alanine aminotransferase levels were significantly lower in the I/R þ Bre group, when compared with the I/R þ NS group. Pretreatment with breviscapine reduced MDA level (P < 0.05) and increased SOD activity significantly in I/R þ Bre compared with I/R þ NS group. Western blot and RT-q polymerase chain reaction showed that Mfn2 was significantly downregulated in breviscapine preconditioning group as compared to normal saline control group. Conclusions: Breviscapine preconditioning attenuates liver ischemia reperfusion injury via inhibiting liver oxidative stress reaction. The protective mechanism probably inhibits Mfn2 protein and mRNA expression. ª 2016 Elsevier Inc. All rights reserved.
Introduction Hepatic ischemia/reperfusion (I/R) injury is the common pathophysiological process associated with several clinical conditions, including liver transplantation, hepatectomy,
trauma, and hypovolemic shock.1 The exact pathogenesis of I/R injury is complex and is currently believed to be connected with energy metabolic disorder, generation of oxygen radicals, intracellular calcium overload, and activation of Kupffer cells and neutrophil granulocytes.2,3 These events may lead to liver
* Corresponding author. Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou 510632, China. Tel.: þ86 020 38688613; fax: þ86 020 38688888. E-mail address: [email protected] (J. Gong). 1 Y.-z.L. and Z.-y.L. contributed equally to this work. 0022-4804/$ e see front matter ª 2016 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2016.02.013
lin et al breviscapine against hepatic i/r injury
damage and increase postoperative morbidity and mortality rates.4 Therefore, it is very important to find an effective hepatic protection to minimize hepatic ischemia reperfusion injury. Traditional Chinese medicine is one of the research hotspots in therapeutic intervention of hepatic ischemia reperfusion injury because of less side effect and more target spots.5 Breviscapine is a flavonoid extracted from the natural plant Erigeron breviscapus. Scutellarin is the main active ingredient, and its structural formula is 4, 5, 6trihydroxyflavone-7-glucuronide.6 Clinical trials and animal studies have shown that breviscapine has medical effects including anticoagulation, improving microcirculation, as well as activating blood supply to the heart and brain.7,8 It has been prepared into some Chinese patent medicines including injection and used to treat cardiovascular and cerebrovascular diseases in clinical practices for a long time in China.9,10 Currently, its protective effect against myocardial and cerebral ischemia reperfusion injury is widely studied and applied. However, studies about its effect on hepatic ischemia/reperfusion injury, especially about its protective mechanism, are still limited. Currently, the role of change of mitochondrial structure in hepatic I/R has received increasing attention of domestic and foreign scholars.11,12 Under the ischemic condition, disturbance in the cellular energy metabolism and enzyme function suggests that protection of mitochondria may play an important role in the maintenance of cellular integrity during I/R injury.11 Mitofusion 2 (Mfn2) is embedded in the outer membrane of the mitochondria.13 It regulates mitochondrial metabolism through regulating mitochondrial membrane potential and substrate oxidation and oxidative phosphorylation. It plays an important role in the regulation of mitochondrial morphology and function and is essential for mitochondrial fusion.14 Disorder of mitochondrial fusion plays a role in I/R disease but the underlying mechanism is still unclear.15 Therefore, studying Mfn2 is essential for identification of the role of mitochondria in hepatic I/R injury. In the present study, a rat model of hepatic ischemia reperfusion was developed to investigate the effect of breviscapine on hepatic ischemia reperfusion injury after different durations of ischemia, as well as its potential mechanism. This study provides a research foundation and theoretical basis for the clinical application of hepatic surgery.
Materials and methods Development of animal model A total of 40 specific pathogen-free male SpragueeDawley rats, with body weights ranging from 250 to 280 g, were provided by the Experimental Animal Center of Southern Medical University. They were housed in cages and maintained at room temperature and 12/12 h light-dark cycle and free access of water and food. The experimental protocol was approved by the local ethics committee for animal experimentation. Before the operation, the rats were fasted (food but not water) for 12 hours and then were weighed and anesthetized
269
with an intraperitoneal injection of 10% chloral hydrate at a dose of 3.0 mL/kg of body weight. Then, the rats were placed in a supine position, and a midline abdominal incision was made on each of them. Noninvasive vascular clamps were used to occlude the portal veins and hepatic artery branches to the median and left hepatic lobes, leading to an ischemia of almost 70% of the liver. The clamps were removed at corresponding time according to the durations of ischemia to recover the blood supply to the liver, and the rat model of hepatic ischemia reperfusion injury was developed. Narcotic injection was performed at 24 hours after reperfusion, and blood samples from the inferior vena cava, and the left lobe of the liver were collected.
Experimental grouping The rats were randomized into five groups using a random number table. Each group contained eight rats. These groups were (1) Sham surgery group (Sham group), which underwent abdominal surgery without occlusion to produce an ischemia; (2) 10-min ischemia and normal saline group (I/R1þNS), in which equivalent normal saline was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (3) 10-min ischemia and breviscapine preconditioning group (I/R1þBre), in which 10 mg/Kg of breviscapine injection was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (4) 30-min ischemia and normal saline group (I/R2þNS), in which equivalent normal saline was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (5) 30-min ischemia and breviscapine preconditioning group (I/R2þBre), in which 10 mg/Kg of breviscapine injection was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 min of ischemia and reperfusion.
The histopathology observation Immediately after the 24 h reperfusion, the liver tissue samples were removed and placed in 10% neutral-buffered formalin. For histopathology, liver samples were routinely processed and embedded in paraffin, and 3-mm sections were stained with hematoxylin and eosin. The microscopy examination of stained sections was done with an Olympus PROVIS AX-70 microscope (Olympus Corporation, Japan). Results were interpreted by a pathologist who was blinded to the treatment groups. The lesion was graded as follows: grade 0: no injury; grade 1: mild injury in the form of cytoplasmic vacuolation to focal nuclear pyknosis; grade 2: moderate to severe injury in the form of extensive nuclear pyknosis, cytoplasmic hypereosinophilia, and loss of intercellular borders; and grade 3: severe necrosis with disintegration of hepatic cords, hemorrhage, and neutrophil infiltration.16
270
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
Serum biochemical analysis The blood samples obtained were kept at room temperature for 2 h. Serum was then collected after centrifugation at 1000 g for 5 min. Aspartate and alanine aminotransferase (AST and ALT) serum levels were measured on Selectra-E auto analyzer.
Oxidative stress markers in hepatic tissue Hepatic superoxide dismutase (SOD) activity and malondialdehyde (MDA) content were estimated using assay kits (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China) according to kit instructions. The absorbance of the supernatant was measured by spectrometer at 532 nm for MDA and 550 nm for SOD.
Western blotting The liver protein concentration was determined using the BCA assay kit (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China). An equal amount of protein for each sample was loaded and separated by a homogeneous 10% SDSepolyacrylamide gels and transferred onto PVDF membrane. Blocking was performed in 5% fat-free milk for 1 h at room temperature. After blocking, blots were washed in Trisbuffered saline with Tween-20 (TBST) buffer, and the membranes were incubated overnight at 4 C with anti-Mfn2 antibody (diluted 1:1000 in 5% fat-free milk in TBST; Cell Signaling Technology, Beverly, MA). The membranes were subsequently incubated with secondary anti-rabbit antibody for 1 h at room temperature. After washing, the bands were visualized using enhanced chemiluminescence regents (ECL; BIO-RAD, Hercules, CA) and using the FluorChem 5500 imaging system (Alpha Innotech Corp., San Leandro, CA). The band intensities were evaluated by densitometric analysis using the ImageJ software (National Institutes of Health).
Quantitative real-time polymerase chain reaction Total RNA from liver tissues was extracted with Trizol reagent (Invitrogen, USA). The RNA concentration and purity were determined spectrophotometrically using the NanoDrop ND-1000 (NanoDrop Technologies, DE). One hundredenanograms RNA was reverse transcribed into cDNA with PrimeScript RT Master Mix (Takara Co., Ltd, Dalian, China) in a 20-mL final reaction volume according to
the manufacturer protocol. The primer sequences (50 to 30 ) were as follows: b-actin (forward) TGCTATGTTGCCCTAGACTTCG, (reverse) GTTGGCATAGAGGTCTTTACGG; Mfn2 (forward) GATGACAGAGGAAGTGGAAAGGC, (reverse) ACAGACACAGGAAGAAGGGGCT. All the RT-polymerase chain reaction (PCR) samples were performed using SYBR Green PCR Master Mix SYBR Premix Ex TaqTM II (Takara Co., Ltd, Dalian, China) to evaluate Mfn2 expression on a Mastercycler ep realplex4 (Eppendorf, Hamburg, Germany). Mfn2 gene expression profiles were normalized to the bactin level and calculated using the DDCt (2DDCt) levels.
Statistical analysis The results are expressed as the mean standard deviation (SD) of each experiment. All statistical analyses were performed using the SPSS statistical package (13; Chicago, IL, USA). P < 0.05 was considered to be statistically significant.
Results The effect of breviscapine injection on pathomorphologic changes in rat liver In the histopathologic examination, hematoxylin and eosin staining revealed that: In the sham group, the structure of hepatic tissue was basically normal with neatly arranged hepatic sinusoids, and no neutrophil infiltration was observed (As shown in Fig. 1A). In comparison with sham group, hepatocyte swelling with significantly more vacuolar degeneration, unclear boundary, narrower hepatic sinusoids, several necrotic spots, different degrees of congestion of the sinusoids, and central veins, as well as structural disorder of the hepatic plates were all observed in normal saline control groups (I/R1þNS and I/R2þNS; as shown in Fig. 1B and D); these pathologic changes in breviscapine preconditioning groups (I/R1 þ Bre and I/R2 þ Bre) were smaller than that in control groups: the structure of the hepatic lobule was almost normal, the structures of the central veins, hepatic cords, and hepatic sinusoids were clear, and there was no obvious cellular degeneration (as shown in Fig. 1C and E). Histopathologic scores (Fig. 2) showed the mean injury grade in the I/R1 þ NS group (1.5 0.46), and the I/R2 þ NS (2.63 0.44) were significantly higher than Sham group (0.13 0.35; P ¼ 0.001), and the mean injury grade was reduced by the administration
Fig. 1 e The manifestation of liver tissues by histopathologic observation (original magnification: 3200). (A) Normal liver tissue of the sham group. (B) Ischemia 10 min D NS. (C) 10-min ischemia and breviscapine preconditioning group. (D) 30-min ischemia and normal saline group. (E) 30-min ischemia and breviscapine preconditioning group. (Color version of figure is available online.)
271
lin et al breviscapine against hepatic i/r injury
MDA is an end product of lipid peroxidation and considered as a biomarker of oxidative stress, whereas SOD is an important antioxidative enzyme. As shown in Table 2, compared with sham group, SOD contents in I/R1þNS and I/R2þNS groups were significantly reduced, whereas MDA contents were significantly increased (P < 0.05); compared with normal saline groups, SOD contents in I/R1 þ Bre and I/R2 þ Bre groups which were intervened with scutellarin injection were significantly increased, whereas MDA contents were significantly decreased (P < 0.05). There was no significant difference between I/R2 þ Bre and I/R1 þ NS groups (P > 0.05).
Expression of mitochondrial fusion protein 2 (Mfn2) in the liver Fig. 2 e Histopathology scoring after ischemia reperfusion injury in rats. Data are expressed as mean ± SD (n [ 8). *P < 0.05, ***P < 0.001 versus sham group; DP < 0.05, DD P < 0.01 versus NS group.
of breviscapine (I/R1 þ Bre: 0.75 0.53, I/R2 þ Bre: 1.75 0.53; P < 0.05, P < 0.01).
Serum liver function tests The serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in each group were showed in Table 1. The ALT and AST levels of rats in the Sham group were 88.0 12.8 U/L and 305.1 22.1 U/L, respectively. After 10 min and 30 min of ischemia and 24 h of reperfusion, the serum levels of ALT and AST in all the other groups were significantly higher than that in sham group (P < 0.05); the serum level of AST in I/R1 þ Bre group was significantly lower than that in I/R1 þ NS group (374.4 64.5 versus 530.0 127.5 U/L, P < 0.01); the serum levels of ALT and AST were significantly decreased in I/R2 þ Bre group compared to I/R2 þ NS group (P < 0.05). All the differences were statistically significant.
The integrity of mitochondrial structure is essential for maintain its function. Therefore, we next detected mitochondrial fusion changes after I/R and effect of breviscapine treatment. The expression level of Mfn2 in rat liver was determined by western blot (Fig. 3A and B). The gray values of the target protein (Mfn2) and the internal reference protein (b-actin) were compared. The results showed that the expression level of Mfn2 in I/R þ NS group was significantly higher than that in the sham group (P < 0.05). For both treatments of 10-min and 30-min ischemia, the expression levels of Mfn2 in I/R þ Bre group were significantly lower than that in I/R þ NS group (P < 0.05). The changes in mRNA concentration of Mfn2 in the liver were detected through real-time quantitative PCR (Fig. 3C). The results indicated that mRNA concentrations of Mfn2 in the livers of normal saline groups (I/R1þNS and I/R2þNS) were significantly increased in comparison with that of the sham group (P < 0.05). Messenger RNA concentrations of Mfn2 in breviscapine preconditioning groups (I/R1 þ Bre and I/R2 þ Bre) were significantly lower than that in normal saline groups (P < 0.05).
Discussion SOD and MDA contents in liver homogenates We next evaluated the effect of breviscapine on SOD and MDA in liver tissues using the SOD Assay Kit and MDA Assay Kit.
Table 1 e Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in serum. Groups
ALT (u/L)
Sham
88.0 12.8
AST (u/L) 305.1 22.1
152.6 17.6*
530.0 127.5*
I/R1þBre
135.1 22.5*,y
374.4 64.5*,z *
I/R2þNS
331.2 26.0
789.8 103.3
I/R2þBre
250.1 20.6*,y
519.6 118.8*,z
Data are expressed as mean SD. * P < 0.05 vs sham group; y P < 0.01, compared to NS group; z P < 0.01 compared to NS group.
Table 2 e SOD activity and MDA content. Group
SOD (U/mg)
MDA (nmol/mg)
Sham
32.98 5.36
8.27 0.96
I/R1þNS
I/R1þNS
*
In the present study, we demonstrated that breviscapine injection markedly ameliorated hepatic ischemia reperfusion (I/R) injury, reduced serum levels of ALT and AST and reduced
I/R1þBre
*
11.86 1.52*
y
9.43 0.99y
*
22.01 2.87 26.88 4.46
I/R2þNS
15.72 2.09
14.87 1.76*
I/R2þBre
20.24 2.67y
11.08 1.26y,z
The levels of SOD and MDA were measured after 24 h of reperfusion. Data represent mean standard deviation. * P < 0.05 compared to sham group; y P < 0.01 compared to NS group; z P > 0.05 compared to I/R1þNS group.
272
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
Fig. 3 e Effect of breviscapine on the expression of Mfn2. (A) Western blot analysis of Mfn2 protein level in liver tissues. (B) The bar chart demonstrated the ratio of Mfn2 protein to b-actin for the above by ImageJ. (C) Mfn2 mRNA expression was examined using RT-qPCR. Mfn2 mRNA expression was normalized to b-actin mRNA expression. Data are expressed as mean ± SD. *P < 0.05, **P < 0.01 versus sham group; DP < 0.05, DDP < 0.01 versus NS group.
the liver oxidative stress. A histologic injury in liver was also reduced by breviscapine administration. We suspect that mitochondrial protection mechanism may be involved in this study. Breviscapine is an active ingredient extracted from traditional Chinese medicine Erigeron breviscapus with pharmacologic activities such as improving microcirculation, vascular relaxing, reducing vascular resistance, and inhibiting platelet aggregation and thus is commonly used in therapy for cerebral ischemic stroke.17,18 Therefore, breviscapine injection was used for preconditioning in the rat model of hepatic I/R to investigate the effect of breviscapine on hepatic I/R injury. Pathomorphologic changes in rat liver showed vacuolar degeneration and swelling of hepatocytes, necrosis and karyopyknosis of some hepatocytes, and neutrophil infiltration in normal saline groups; in contrast, a milder injury caused by I/R, basically normal hepatic lobules, less changes of space, and no visible hepatic necrosis were observed in breviscapine preconditioning groups. It suggests a significant protective effect of breviscapine against hepatic ischemia reperfusion injury. There are complex mechanisms that cause liver damage during hepatic ischemia and reperfusion. Among the proposed mechanisms, oxidative stress generated by reactive oxygen species (ROS) is considered to cause major disturbances in cellular functions during I/R.19 MDA is a biomarker of oxidative stress, whereas SOD is one of the major antioxidative enzymes by catalyzing the dismutation of superoxide into oxygen and hydrogen peroxide.20 This study showed that in 10-min and 30-min ischemia normal saline groups, SOD activity in the liver was reduced, whereas MDA level was elevated, and the degree of injury was related to ischemia duration. This indicates that decreased SOD activity
during I/R weakens oxygen radical scavenging activity and leads to a lipid peroxidation. However, SOD activities in breviscapine preconditioning groups were significantly higher than that in normal saline groups, whereas MDA levels were significantly lower. Moreover, no significant differences in SOD and MDA levels were found between I/R2 þ Bre and I/R1 þ NS groups. It suggests that breviscapine has potent antioxidant activity and reduces cell membrane damage caused by oxidative stress, which agrees with the results of Hong et al.21 Meanwhile, the serum levels of ALT and AST increased synchronously during hepatic ischemia reperfusion, reflecting the degree of liver damage. ALT and AST levels in breviscapine preconditioning groups increased but with significantly smaller degrees than normal saline groups (P < 0.05). It means that breviscapine suppresses hepatic injury caused by ischemia reperfusion. This finding has also been proved by pathomorphologic observations which demonstrate that breviscapine contributes to maintain normal hepatocytes and hepatic structure and reduces I/R injury. Mitochondria are the main source of ROS in the cell. Mitochondria damage results in increased production of ROS, which can lead to oxidative stress.22 Research have shown that mitochondria are dynamic organs constantly undergoing fission and fusion, and this dynamic balance plays a vital role in regulating normal function of mitochondria.23 Mitofusin 2 (Mfn2) located on the outer membrane of mitochondria, which has more biological functions to control mitochondrial metabolism and fusion.13 Studies have showed that Mfn2 over-expression can induce apoptosis of rat vascular smooth muscle cells through blocking Ras-PI3K-Akt signaling pathway.24 Zhou et al.25 reported that intervention with rosuvastatin remarkably downregulated the expression of Mfn2 and inhibited apoptosis after myocardial infarction in
lin et al breviscapine against hepatic i/r injury
rats. It has also been demonstrated that Mfn2 expression is upregulated when oxidative stress induces myocardial apoptosis, and its expression level is correlated to apoptotic rate of myocardial cells.26 These findings indicate that Mfn2 induces apoptosis through inhibiting Ras-PI3K-Akt pathway. Studies on the correlation between Mfn2 gene and hepatic ischemia reperfusion injury are still limited now. In the present study, we discussed the mechanism of Erigeron breviscapus protecting the liver from ischemia reperfusion injury from a mitochondrial viewpoint. Through detecting the contents of Mfn2 mRNA and expressed protein, we found that Mfn2 mRNA and its protein expression in the rat livers of normal saline groups were significantly more than that of sham group, suggesting that ischemia reperfusion injury might activate the expression of Mfn2 to inhibit Ras-PI3K-Akt pathway and thus accelerate apoptosis and aggravate liver injury. However, Mfn2 expression in breviscapine preconditioning groups was significantly reduced after 24 hours of hepatic ischemia reperfusion as compared to the control groups. Breviscapine may exert a liver protective effect through down-regulating Mfn2 expression during hepatic ischemia reperfusion. This preliminary study on the liver protective effect of Erigeron breviscapus confirms the protective effect of breviscapine against hepatic ischemia reperfusion injury in rats, which may be realized by reducing lipid peroxidation and down-regulating Mfn2 expression. Mfn2 gene could be a key target for Erigeron breviscapus to exert its liver protective effect.
Acknowledgment This work was supported by the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry (2014-1685) and the National Undergraduate Innovative Research Projects of China (CX14112). Author’s contribution: Y.-z.L. and Z.-y.L. performed experiment and wrote the article. Y.-z.L., Z.-y.L., and X.-h.L. collected the data. X.-h.L., K.L., and B.P. analyzed and interpreted the data. J.G. contributed in conceiving and designing the study, approving the final version of the article, critical revision of the article, and obtaining funding for the article.
Disclosure No potential conflicts of interest were disclosed.
references
1. Abu-Amara M, Yang SY, Tapuria N, Fuller B, Davidson B, Seifalian A. Liver ischemia/reperfusion injury: processes in inflammatory networksea review. Liver Transpl. 2010;16:1016e1032. 2. Shin T, Kuboki S, Huber N, et al. Activation of peroxisome proliferator-activated receptor-gamma during hepatic ischemia is age-dependent. J Surg Res. 2008;147:200e205.
273
3. Nastos C, Kalimeris K, Papoutsidakis N, et al. Global consequences of liver ischemia/reperfusion injury. Oxid Med Cell Longev. 2014;2014:906965. 4. Yoshimura Y, Kubo S, Shirata K, et al. Risk factors for postoperative delirium after liver resection for hepatocellular carcinoma. World J Surg. 2004;28:982e986. 5. Liu X, Hu Z, Zhou B, Li X, Tao R. Chinese herbal preparation xuebijing potently inhibits inflammasome activation in hepatocytes and ameliorates mouse liver ischemiareperfusion injury. PLoS One. 2015;10:e0131436. 6. Lou XY, Cheng JL, Zhang B. Therapeutic effect and mechanism of breviscapine on cisplatin-induced nephrotoxicity in mice. Asian Pac J Trop Med. 2015;8:873e877. 7. Wang C, Li Y, Gao S, Cheng D, Zhao S, Liu E. Breviscapine injection improves the therapeutic effect of western medicine on angina pectoris patients. PLoS One. 2015;10:e0129969. 8. Zhang MY, Fan SJ, Li LP, Wu BY, Wang Y. The anti-injury effect of breviscapine injection on the hypoxic ischemic brain damage of neonatal rats and the expression of bcl-2 and bax. Zhongguo Ying Yong Sheng Li Xue Za Zhi. 2011;27:196e200. 9. Ding RF, Li ZX. The clinical application of breviscapine preparations. Tianjin Pharm. 2009;21:60e63. 10. Gao SR, Wan P. Progress in clinical application of breviscapine. Yunnan J Traditional Chin Med Materia Med. 2009;30:67e68. 11. Novgorodov SA, Gudz TI. Ceramide and mitochondria in ischemia/reperfusion. J Cardiovasc Pharmacol. 2009;53:198e208. 12. Jassem W, Heaton ND. The role of mitochondria in ischemia/ reperfusion injury in organ transplantation. Kidney Int. 2004;66:514e517. 13. Papanicolaou KN, Khairallah RJ, Ngoh GA, et al. Mitofusin-2 maintains mitochondrial structure and contributes to stressinduced permeability transition in cardiac myocytes. Mol Cell Biol. 2011;31:1309e1328. 14. Chen H, Detmer SA, Ewald AJ, Griffin EE, Fraser SE, Chan DC. Mitofusins mfn1 and mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol. 2003;160:189e200. 15. Dong G, Chen T, Ren X, et al. Rg1 prevents myocardial hypoxia/reoxygenation injury by regulating mitochondrial dynamics imbalance via modulation of glutamate dehydrogenase and mitofusin 2. Mitochondrion. 2015;26:7e18. 16. Wei Y, Chen P, de Bruyn M, Zhang W, Bremer E, Helfrich W. Carbon monoxide-releasing molecule-2 (corm-2) attenuates acute hepatic ischemia reperfusion injury in rats. BMC Gastroenterol. 2010;10:42. 17. Xiong Z, Liu C, Wang F, et al. Protective effects of breviscapine on ischemic vascular dementia in rats. Biol Pharm Bull. 2006;29:1880e1885. 18. Jaeschke H, Smith CV, Mitchell JR. Reactive oxygen species during ischemia-reflow injury in isolated perfused rat liver. J Clin Invest. 1988;81:1240e1246. 19. Jaeschke H. Role of reactive oxygen species in hepatic ischemia-reperfusion injury and preconditioning. J Invest Surg. 2003;16:127e140. 20. Vali L, Taba G, Szentmihalyi K, et al. Reduced antioxidant level and increased oxidative damage in intact liver lobes during ischaemia-reperfusion. World J Gastroenterol. 2006;12:1086e1091. 21. Hong H, Liu GQ. Scutellarin protects pc12 cells from oxidative stress-induced apoptosis. J Asian Nat Prod Res. 2007;9:135e143. 22. Kennedy MA, Moffat TC, Gable K, et al. A signaling lipid associated with Alzheimer’s disease promotes mitochondrial dysfunction. Scientific Rep. 2016;6:19332. 23. Ong SB, Subrayan S, Lim SY, Yellon DM, Davidson SM, Hausenloy DJ. Inhibiting mitochondrial fission protects the heart against ischemia/reperfusion injury. Circulation. 2010;121:2012e2022.
274
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
24. Li L, Wang JM, Chen GH, Guo XM. Overexpression of mfn2 gene triggers apoptosis of rvsmcs and mechanism. Acta Med Univ Sci Technol Huazhong. 2007;36:57e59. 25. Zhou W, Chen L, Zhou Y, Chen MH. The effect of rosuvastatin on myocardial infarction after cell apoptosis and the
expression of mitochondrial fusion 2 in rats. Chin J Gerontol. 2015;35:2169e2171. 26. Shen T, Zheng M, Cao C, et al. Mitofusin-2 is a major determinant of oxidative stress-mediated heart muscle cell apoptosis. J Biol Chem. 2007;282:23354e23361.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
Effect of breviscapine against hepatic ischemia reperfusion injury Yan-zhu Lin, BD,a,c,1 Zhi-yuan Lu, MD,b,1 Xiao-hui Liang, MD,c Kang Li, MD,d Bo Peng, MD,c and Jin Gong, MD,PhDc,* a
Clinical Medicine, International School, Jinan University, Guangzhou, China Department of Stomatology, Medical College, Jinan University, Guangzhou, China c Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou, China d Department of Gastrointestinal Surgery, YueBei People’Hospital, Shaoguan, China b
article info
abstract
Article history:
Background: Breviscapine is an active ingredient extracted from traditional Chinese medi-
Received 11 December 2015
cine Erigeron breviscapus. The purpose of this study was to investigate the effect of
Received in revised form
breviscapine injection on hepatic ischemia and/or reperfusion injury.
29 January 2016
Methods: Forty rats were randomly divided into five groups (n ¼ 8): Sham group, Ischemia
Accepted 11 February 2016
reperfusion 1 (I/R1) þ normal saline (NS) group, I/R1 þ breviscapine (Bre), I/R2 þ NS group, and
Available online 19 February 2016
I/R2 þ Bre group. Group1 and group2 represent ischemia time for 10 min and 30 min, respectively. Breviscapine or normal saline was administered to rats (single dose of 10 mg/Kg,
Keywords:
intravenously) 30 min before hepatic ischemia. Serum transaminases, histopathologic
Erigeron breviscapus
changes, malondialdehyde (MDA), and superoxide dismutase (SOD) in liver tissues were
Breviscapine
evaluated. The expression level of mitochondrial fusion 2 (Mfn2) was also investigated.
Ischemia reperfusion
Results: After 24-h reperfusion, based on the histopathologic analysis, compared with NS
Liver
control group, the liver function was improved in breviscapine group. Liver enzymes aspartate
Mitofusin 2
and alanine aminotransferase levels were significantly lower in the I/R þ Bre group, when compared with the I/R þ NS group. Pretreatment with breviscapine reduced MDA level (P < 0.05) and increased SOD activity significantly in I/R þ Bre compared with I/R þ NS group. Western blot and RT-q polymerase chain reaction showed that Mfn2 was significantly downregulated in breviscapine preconditioning group as compared to normal saline control group. Conclusions: Breviscapine preconditioning attenuates liver ischemia reperfusion injury via inhibiting liver oxidative stress reaction. The protective mechanism probably inhibits Mfn2 protein and mRNA expression. ª 2016 Elsevier Inc. All rights reserved.
Introduction Hepatic ischemia/reperfusion (I/R) injury is the common pathophysiological process associated with several clinical conditions, including liver transplantation, hepatectomy,
trauma, and hypovolemic shock.1 The exact pathogenesis of I/R injury is complex and is currently believed to be connected with energy metabolic disorder, generation of oxygen radicals, intracellular calcium overload, and activation of Kupffer cells and neutrophil granulocytes.2,3 These events may lead to liver
* Corresponding author. Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou 510632, China. Tel.: þ86 020 38688613; fax: þ86 020 38688888. E-mail address: [email protected] (J. Gong). 1 Y.-z.L. and Z.-y.L. contributed equally to this work. 0022-4804/$ e see front matter ª 2016 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2016.02.013
lin et al breviscapine against hepatic i/r injury
damage and increase postoperative morbidity and mortality rates.4 Therefore, it is very important to find an effective hepatic protection to minimize hepatic ischemia reperfusion injury. Traditional Chinese medicine is one of the research hotspots in therapeutic intervention of hepatic ischemia reperfusion injury because of less side effect and more target spots.5 Breviscapine is a flavonoid extracted from the natural plant Erigeron breviscapus. Scutellarin is the main active ingredient, and its structural formula is 4, 5, 6trihydroxyflavone-7-glucuronide.6 Clinical trials and animal studies have shown that breviscapine has medical effects including anticoagulation, improving microcirculation, as well as activating blood supply to the heart and brain.7,8 It has been prepared into some Chinese patent medicines including injection and used to treat cardiovascular and cerebrovascular diseases in clinical practices for a long time in China.9,10 Currently, its protective effect against myocardial and cerebral ischemia reperfusion injury is widely studied and applied. However, studies about its effect on hepatic ischemia/reperfusion injury, especially about its protective mechanism, are still limited. Currently, the role of change of mitochondrial structure in hepatic I/R has received increasing attention of domestic and foreign scholars.11,12 Under the ischemic condition, disturbance in the cellular energy metabolism and enzyme function suggests that protection of mitochondria may play an important role in the maintenance of cellular integrity during I/R injury.11 Mitofusion 2 (Mfn2) is embedded in the outer membrane of the mitochondria.13 It regulates mitochondrial metabolism through regulating mitochondrial membrane potential and substrate oxidation and oxidative phosphorylation. It plays an important role in the regulation of mitochondrial morphology and function and is essential for mitochondrial fusion.14 Disorder of mitochondrial fusion plays a role in I/R disease but the underlying mechanism is still unclear.15 Therefore, studying Mfn2 is essential for identification of the role of mitochondria in hepatic I/R injury. In the present study, a rat model of hepatic ischemia reperfusion was developed to investigate the effect of breviscapine on hepatic ischemia reperfusion injury after different durations of ischemia, as well as its potential mechanism. This study provides a research foundation and theoretical basis for the clinical application of hepatic surgery.
Materials and methods Development of animal model A total of 40 specific pathogen-free male SpragueeDawley rats, with body weights ranging from 250 to 280 g, were provided by the Experimental Animal Center of Southern Medical University. They were housed in cages and maintained at room temperature and 12/12 h light-dark cycle and free access of water and food. The experimental protocol was approved by the local ethics committee for animal experimentation. Before the operation, the rats were fasted (food but not water) for 12 hours and then were weighed and anesthetized
269
with an intraperitoneal injection of 10% chloral hydrate at a dose of 3.0 mL/kg of body weight. Then, the rats were placed in a supine position, and a midline abdominal incision was made on each of them. Noninvasive vascular clamps were used to occlude the portal veins and hepatic artery branches to the median and left hepatic lobes, leading to an ischemia of almost 70% of the liver. The clamps were removed at corresponding time according to the durations of ischemia to recover the blood supply to the liver, and the rat model of hepatic ischemia reperfusion injury was developed. Narcotic injection was performed at 24 hours after reperfusion, and blood samples from the inferior vena cava, and the left lobe of the liver were collected.
Experimental grouping The rats were randomized into five groups using a random number table. Each group contained eight rats. These groups were (1) Sham surgery group (Sham group), which underwent abdominal surgery without occlusion to produce an ischemia; (2) 10-min ischemia and normal saline group (I/R1þNS), in which equivalent normal saline was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (3) 10-min ischemia and breviscapine preconditioning group (I/R1þBre), in which 10 mg/Kg of breviscapine injection was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (4) 30-min ischemia and normal saline group (I/R2þNS), in which equivalent normal saline was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 minutes of ischemia and reperfusion; (5) 30-min ischemia and breviscapine preconditioning group (I/R2þBre), in which 10 mg/Kg of breviscapine injection was intravenously injected via the tail 30 min before the surgery, and the abdomen was closed after 10 min of ischemia and reperfusion.
The histopathology observation Immediately after the 24 h reperfusion, the liver tissue samples were removed and placed in 10% neutral-buffered formalin. For histopathology, liver samples were routinely processed and embedded in paraffin, and 3-mm sections were stained with hematoxylin and eosin. The microscopy examination of stained sections was done with an Olympus PROVIS AX-70 microscope (Olympus Corporation, Japan). Results were interpreted by a pathologist who was blinded to the treatment groups. The lesion was graded as follows: grade 0: no injury; grade 1: mild injury in the form of cytoplasmic vacuolation to focal nuclear pyknosis; grade 2: moderate to severe injury in the form of extensive nuclear pyknosis, cytoplasmic hypereosinophilia, and loss of intercellular borders; and grade 3: severe necrosis with disintegration of hepatic cords, hemorrhage, and neutrophil infiltration.16
270
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
Serum biochemical analysis The blood samples obtained were kept at room temperature for 2 h. Serum was then collected after centrifugation at 1000 g for 5 min. Aspartate and alanine aminotransferase (AST and ALT) serum levels were measured on Selectra-E auto analyzer.
Oxidative stress markers in hepatic tissue Hepatic superoxide dismutase (SOD) activity and malondialdehyde (MDA) content were estimated using assay kits (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China) according to kit instructions. The absorbance of the supernatant was measured by spectrometer at 532 nm for MDA and 550 nm for SOD.
Western blotting The liver protein concentration was determined using the BCA assay kit (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China). An equal amount of protein for each sample was loaded and separated by a homogeneous 10% SDSepolyacrylamide gels and transferred onto PVDF membrane. Blocking was performed in 5% fat-free milk for 1 h at room temperature. After blocking, blots were washed in Trisbuffered saline with Tween-20 (TBST) buffer, and the membranes were incubated overnight at 4 C with anti-Mfn2 antibody (diluted 1:1000 in 5% fat-free milk in TBST; Cell Signaling Technology, Beverly, MA). The membranes were subsequently incubated with secondary anti-rabbit antibody for 1 h at room temperature. After washing, the bands were visualized using enhanced chemiluminescence regents (ECL; BIO-RAD, Hercules, CA) and using the FluorChem 5500 imaging system (Alpha Innotech Corp., San Leandro, CA). The band intensities were evaluated by densitometric analysis using the ImageJ software (National Institutes of Health).
Quantitative real-time polymerase chain reaction Total RNA from liver tissues was extracted with Trizol reagent (Invitrogen, USA). The RNA concentration and purity were determined spectrophotometrically using the NanoDrop ND-1000 (NanoDrop Technologies, DE). One hundredenanograms RNA was reverse transcribed into cDNA with PrimeScript RT Master Mix (Takara Co., Ltd, Dalian, China) in a 20-mL final reaction volume according to
the manufacturer protocol. The primer sequences (50 to 30 ) were as follows: b-actin (forward) TGCTATGTTGCCCTAGACTTCG, (reverse) GTTGGCATAGAGGTCTTTACGG; Mfn2 (forward) GATGACAGAGGAAGTGGAAAGGC, (reverse) ACAGACACAGGAAGAAGGGGCT. All the RT-polymerase chain reaction (PCR) samples were performed using SYBR Green PCR Master Mix SYBR Premix Ex TaqTM II (Takara Co., Ltd, Dalian, China) to evaluate Mfn2 expression on a Mastercycler ep realplex4 (Eppendorf, Hamburg, Germany). Mfn2 gene expression profiles were normalized to the bactin level and calculated using the DDCt (2DDCt) levels.
Statistical analysis The results are expressed as the mean standard deviation (SD) of each experiment. All statistical analyses were performed using the SPSS statistical package (13; Chicago, IL, USA). P < 0.05 was considered to be statistically significant.
Results The effect of breviscapine injection on pathomorphologic changes in rat liver In the histopathologic examination, hematoxylin and eosin staining revealed that: In the sham group, the structure of hepatic tissue was basically normal with neatly arranged hepatic sinusoids, and no neutrophil infiltration was observed (As shown in Fig. 1A). In comparison with sham group, hepatocyte swelling with significantly more vacuolar degeneration, unclear boundary, narrower hepatic sinusoids, several necrotic spots, different degrees of congestion of the sinusoids, and central veins, as well as structural disorder of the hepatic plates were all observed in normal saline control groups (I/R1þNS and I/R2þNS; as shown in Fig. 1B and D); these pathologic changes in breviscapine preconditioning groups (I/R1 þ Bre and I/R2 þ Bre) were smaller than that in control groups: the structure of the hepatic lobule was almost normal, the structures of the central veins, hepatic cords, and hepatic sinusoids were clear, and there was no obvious cellular degeneration (as shown in Fig. 1C and E). Histopathologic scores (Fig. 2) showed the mean injury grade in the I/R1 þ NS group (1.5 0.46), and the I/R2 þ NS (2.63 0.44) were significantly higher than Sham group (0.13 0.35; P ¼ 0.001), and the mean injury grade was reduced by the administration
Fig. 1 e The manifestation of liver tissues by histopathologic observation (original magnification: 3200). (A) Normal liver tissue of the sham group. (B) Ischemia 10 min D NS. (C) 10-min ischemia and breviscapine preconditioning group. (D) 30-min ischemia and normal saline group. (E) 30-min ischemia and breviscapine preconditioning group. (Color version of figure is available online.)
271
lin et al breviscapine against hepatic i/r injury
MDA is an end product of lipid peroxidation and considered as a biomarker of oxidative stress, whereas SOD is an important antioxidative enzyme. As shown in Table 2, compared with sham group, SOD contents in I/R1þNS and I/R2þNS groups were significantly reduced, whereas MDA contents were significantly increased (P < 0.05); compared with normal saline groups, SOD contents in I/R1 þ Bre and I/R2 þ Bre groups which were intervened with scutellarin injection were significantly increased, whereas MDA contents were significantly decreased (P < 0.05). There was no significant difference between I/R2 þ Bre and I/R1 þ NS groups (P > 0.05).
Expression of mitochondrial fusion protein 2 (Mfn2) in the liver Fig. 2 e Histopathology scoring after ischemia reperfusion injury in rats. Data are expressed as mean ± SD (n [ 8). *P < 0.05, ***P < 0.001 versus sham group; DP < 0.05, DD P < 0.01 versus NS group.
of breviscapine (I/R1 þ Bre: 0.75 0.53, I/R2 þ Bre: 1.75 0.53; P < 0.05, P < 0.01).
Serum liver function tests The serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in each group were showed in Table 1. The ALT and AST levels of rats in the Sham group were 88.0 12.8 U/L and 305.1 22.1 U/L, respectively. After 10 min and 30 min of ischemia and 24 h of reperfusion, the serum levels of ALT and AST in all the other groups were significantly higher than that in sham group (P < 0.05); the serum level of AST in I/R1 þ Bre group was significantly lower than that in I/R1 þ NS group (374.4 64.5 versus 530.0 127.5 U/L, P < 0.01); the serum levels of ALT and AST were significantly decreased in I/R2 þ Bre group compared to I/R2 þ NS group (P < 0.05). All the differences were statistically significant.
The integrity of mitochondrial structure is essential for maintain its function. Therefore, we next detected mitochondrial fusion changes after I/R and effect of breviscapine treatment. The expression level of Mfn2 in rat liver was determined by western blot (Fig. 3A and B). The gray values of the target protein (Mfn2) and the internal reference protein (b-actin) were compared. The results showed that the expression level of Mfn2 in I/R þ NS group was significantly higher than that in the sham group (P < 0.05). For both treatments of 10-min and 30-min ischemia, the expression levels of Mfn2 in I/R þ Bre group were significantly lower than that in I/R þ NS group (P < 0.05). The changes in mRNA concentration of Mfn2 in the liver were detected through real-time quantitative PCR (Fig. 3C). The results indicated that mRNA concentrations of Mfn2 in the livers of normal saline groups (I/R1þNS and I/R2þNS) were significantly increased in comparison with that of the sham group (P < 0.05). Messenger RNA concentrations of Mfn2 in breviscapine preconditioning groups (I/R1 þ Bre and I/R2 þ Bre) were significantly lower than that in normal saline groups (P < 0.05).
Discussion SOD and MDA contents in liver homogenates We next evaluated the effect of breviscapine on SOD and MDA in liver tissues using the SOD Assay Kit and MDA Assay Kit.
Table 1 e Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in serum. Groups
ALT (u/L)
Sham
88.0 12.8
AST (u/L) 305.1 22.1
152.6 17.6*
530.0 127.5*
I/R1þBre
135.1 22.5*,y
374.4 64.5*,z *
I/R2þNS
331.2 26.0
789.8 103.3
I/R2þBre
250.1 20.6*,y
519.6 118.8*,z
Data are expressed as mean SD. * P < 0.05 vs sham group; y P < 0.01, compared to NS group; z P < 0.01 compared to NS group.
Table 2 e SOD activity and MDA content. Group
SOD (U/mg)
MDA (nmol/mg)
Sham
32.98 5.36
8.27 0.96
I/R1þNS
I/R1þNS
*
In the present study, we demonstrated that breviscapine injection markedly ameliorated hepatic ischemia reperfusion (I/R) injury, reduced serum levels of ALT and AST and reduced
I/R1þBre
*
11.86 1.52*
y
9.43 0.99y
*
22.01 2.87 26.88 4.46
I/R2þNS
15.72 2.09
14.87 1.76*
I/R2þBre
20.24 2.67y
11.08 1.26y,z
The levels of SOD and MDA were measured after 24 h of reperfusion. Data represent mean standard deviation. * P < 0.05 compared to sham group; y P < 0.01 compared to NS group; z P > 0.05 compared to I/R1þNS group.
272
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
Fig. 3 e Effect of breviscapine on the expression of Mfn2. (A) Western blot analysis of Mfn2 protein level in liver tissues. (B) The bar chart demonstrated the ratio of Mfn2 protein to b-actin for the above by ImageJ. (C) Mfn2 mRNA expression was examined using RT-qPCR. Mfn2 mRNA expression was normalized to b-actin mRNA expression. Data are expressed as mean ± SD. *P < 0.05, **P < 0.01 versus sham group; DP < 0.05, DDP < 0.01 versus NS group.
the liver oxidative stress. A histologic injury in liver was also reduced by breviscapine administration. We suspect that mitochondrial protection mechanism may be involved in this study. Breviscapine is an active ingredient extracted from traditional Chinese medicine Erigeron breviscapus with pharmacologic activities such as improving microcirculation, vascular relaxing, reducing vascular resistance, and inhibiting platelet aggregation and thus is commonly used in therapy for cerebral ischemic stroke.17,18 Therefore, breviscapine injection was used for preconditioning in the rat model of hepatic I/R to investigate the effect of breviscapine on hepatic I/R injury. Pathomorphologic changes in rat liver showed vacuolar degeneration and swelling of hepatocytes, necrosis and karyopyknosis of some hepatocytes, and neutrophil infiltration in normal saline groups; in contrast, a milder injury caused by I/R, basically normal hepatic lobules, less changes of space, and no visible hepatic necrosis were observed in breviscapine preconditioning groups. It suggests a significant protective effect of breviscapine against hepatic ischemia reperfusion injury. There are complex mechanisms that cause liver damage during hepatic ischemia and reperfusion. Among the proposed mechanisms, oxidative stress generated by reactive oxygen species (ROS) is considered to cause major disturbances in cellular functions during I/R.19 MDA is a biomarker of oxidative stress, whereas SOD is one of the major antioxidative enzymes by catalyzing the dismutation of superoxide into oxygen and hydrogen peroxide.20 This study showed that in 10-min and 30-min ischemia normal saline groups, SOD activity in the liver was reduced, whereas MDA level was elevated, and the degree of injury was related to ischemia duration. This indicates that decreased SOD activity
during I/R weakens oxygen radical scavenging activity and leads to a lipid peroxidation. However, SOD activities in breviscapine preconditioning groups were significantly higher than that in normal saline groups, whereas MDA levels were significantly lower. Moreover, no significant differences in SOD and MDA levels were found between I/R2 þ Bre and I/R1 þ NS groups. It suggests that breviscapine has potent antioxidant activity and reduces cell membrane damage caused by oxidative stress, which agrees with the results of Hong et al.21 Meanwhile, the serum levels of ALT and AST increased synchronously during hepatic ischemia reperfusion, reflecting the degree of liver damage. ALT and AST levels in breviscapine preconditioning groups increased but with significantly smaller degrees than normal saline groups (P < 0.05). It means that breviscapine suppresses hepatic injury caused by ischemia reperfusion. This finding has also been proved by pathomorphologic observations which demonstrate that breviscapine contributes to maintain normal hepatocytes and hepatic structure and reduces I/R injury. Mitochondria are the main source of ROS in the cell. Mitochondria damage results in increased production of ROS, which can lead to oxidative stress.22 Research have shown that mitochondria are dynamic organs constantly undergoing fission and fusion, and this dynamic balance plays a vital role in regulating normal function of mitochondria.23 Mitofusin 2 (Mfn2) located on the outer membrane of mitochondria, which has more biological functions to control mitochondrial metabolism and fusion.13 Studies have showed that Mfn2 over-expression can induce apoptosis of rat vascular smooth muscle cells through blocking Ras-PI3K-Akt signaling pathway.24 Zhou et al.25 reported that intervention with rosuvastatin remarkably downregulated the expression of Mfn2 and inhibited apoptosis after myocardial infarction in
lin et al breviscapine against hepatic i/r injury
rats. It has also been demonstrated that Mfn2 expression is upregulated when oxidative stress induces myocardial apoptosis, and its expression level is correlated to apoptotic rate of myocardial cells.26 These findings indicate that Mfn2 induces apoptosis through inhibiting Ras-PI3K-Akt pathway. Studies on the correlation between Mfn2 gene and hepatic ischemia reperfusion injury are still limited now. In the present study, we discussed the mechanism of Erigeron breviscapus protecting the liver from ischemia reperfusion injury from a mitochondrial viewpoint. Through detecting the contents of Mfn2 mRNA and expressed protein, we found that Mfn2 mRNA and its protein expression in the rat livers of normal saline groups were significantly more than that of sham group, suggesting that ischemia reperfusion injury might activate the expression of Mfn2 to inhibit Ras-PI3K-Akt pathway and thus accelerate apoptosis and aggravate liver injury. However, Mfn2 expression in breviscapine preconditioning groups was significantly reduced after 24 hours of hepatic ischemia reperfusion as compared to the control groups. Breviscapine may exert a liver protective effect through down-regulating Mfn2 expression during hepatic ischemia reperfusion. This preliminary study on the liver protective effect of Erigeron breviscapus confirms the protective effect of breviscapine against hepatic ischemia reperfusion injury in rats, which may be realized by reducing lipid peroxidation and down-regulating Mfn2 expression. Mfn2 gene could be a key target for Erigeron breviscapus to exert its liver protective effect.
Acknowledgment This work was supported by the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry (2014-1685) and the National Undergraduate Innovative Research Projects of China (CX14112). Author’s contribution: Y.-z.L. and Z.-y.L. performed experiment and wrote the article. Y.-z.L., Z.-y.L., and X.-h.L. collected the data. X.-h.L., K.L., and B.P. analyzed and interpreted the data. J.G. contributed in conceiving and designing the study, approving the final version of the article, critical revision of the article, and obtaining funding for the article.
Disclosure No potential conflicts of interest were disclosed.
references
1. Abu-Amara M, Yang SY, Tapuria N, Fuller B, Davidson B, Seifalian A. Liver ischemia/reperfusion injury: processes in inflammatory networksea review. Liver Transpl. 2010;16:1016e1032. 2. Shin T, Kuboki S, Huber N, et al. Activation of peroxisome proliferator-activated receptor-gamma during hepatic ischemia is age-dependent. J Surg Res. 2008;147:200e205.
273
3. Nastos C, Kalimeris K, Papoutsidakis N, et al. Global consequences of liver ischemia/reperfusion injury. Oxid Med Cell Longev. 2014;2014:906965. 4. Yoshimura Y, Kubo S, Shirata K, et al. Risk factors for postoperative delirium after liver resection for hepatocellular carcinoma. World J Surg. 2004;28:982e986. 5. Liu X, Hu Z, Zhou B, Li X, Tao R. Chinese herbal preparation xuebijing potently inhibits inflammasome activation in hepatocytes and ameliorates mouse liver ischemiareperfusion injury. PLoS One. 2015;10:e0131436. 6. Lou XY, Cheng JL, Zhang B. Therapeutic effect and mechanism of breviscapine on cisplatin-induced nephrotoxicity in mice. Asian Pac J Trop Med. 2015;8:873e877. 7. Wang C, Li Y, Gao S, Cheng D, Zhao S, Liu E. Breviscapine injection improves the therapeutic effect of western medicine on angina pectoris patients. PLoS One. 2015;10:e0129969. 8. Zhang MY, Fan SJ, Li LP, Wu BY, Wang Y. The anti-injury effect of breviscapine injection on the hypoxic ischemic brain damage of neonatal rats and the expression of bcl-2 and bax. Zhongguo Ying Yong Sheng Li Xue Za Zhi. 2011;27:196e200. 9. Ding RF, Li ZX. The clinical application of breviscapine preparations. Tianjin Pharm. 2009;21:60e63. 10. Gao SR, Wan P. Progress in clinical application of breviscapine. Yunnan J Traditional Chin Med Materia Med. 2009;30:67e68. 11. Novgorodov SA, Gudz TI. Ceramide and mitochondria in ischemia/reperfusion. J Cardiovasc Pharmacol. 2009;53:198e208. 12. Jassem W, Heaton ND. The role of mitochondria in ischemia/ reperfusion injury in organ transplantation. Kidney Int. 2004;66:514e517. 13. Papanicolaou KN, Khairallah RJ, Ngoh GA, et al. Mitofusin-2 maintains mitochondrial structure and contributes to stressinduced permeability transition in cardiac myocytes. Mol Cell Biol. 2011;31:1309e1328. 14. Chen H, Detmer SA, Ewald AJ, Griffin EE, Fraser SE, Chan DC. Mitofusins mfn1 and mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol. 2003;160:189e200. 15. Dong G, Chen T, Ren X, et al. Rg1 prevents myocardial hypoxia/reoxygenation injury by regulating mitochondrial dynamics imbalance via modulation of glutamate dehydrogenase and mitofusin 2. Mitochondrion. 2015;26:7e18. 16. Wei Y, Chen P, de Bruyn M, Zhang W, Bremer E, Helfrich W. Carbon monoxide-releasing molecule-2 (corm-2) attenuates acute hepatic ischemia reperfusion injury in rats. BMC Gastroenterol. 2010;10:42. 17. Xiong Z, Liu C, Wang F, et al. Protective effects of breviscapine on ischemic vascular dementia in rats. Biol Pharm Bull. 2006;29:1880e1885. 18. Jaeschke H, Smith CV, Mitchell JR. Reactive oxygen species during ischemia-reflow injury in isolated perfused rat liver. J Clin Invest. 1988;81:1240e1246. 19. Jaeschke H. Role of reactive oxygen species in hepatic ischemia-reperfusion injury and preconditioning. J Invest Surg. 2003;16:127e140. 20. Vali L, Taba G, Szentmihalyi K, et al. Reduced antioxidant level and increased oxidative damage in intact liver lobes during ischaemia-reperfusion. World J Gastroenterol. 2006;12:1086e1091. 21. Hong H, Liu GQ. Scutellarin protects pc12 cells from oxidative stress-induced apoptosis. J Asian Nat Prod Res. 2007;9:135e143. 22. Kennedy MA, Moffat TC, Gable K, et al. A signaling lipid associated with Alzheimer’s disease promotes mitochondrial dysfunction. Scientific Rep. 2016;6:19332. 23. Ong SB, Subrayan S, Lim SY, Yellon DM, Davidson SM, Hausenloy DJ. Inhibiting mitochondrial fission protects the heart against ischemia/reperfusion injury. Circulation. 2010;121:2012e2022.
274
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 6 ( 2 0 3 ) 2 6 8 e2 7 4
24. Li L, Wang JM, Chen GH, Guo XM. Overexpression of mfn2 gene triggers apoptosis of rvsmcs and mechanism. Acta Med Univ Sci Technol Huazhong. 2007;36:57e59. 25. Zhou W, Chen L, Zhou Y, Chen MH. The effect of rosuvastatin on myocardial infarction after cell apoptosis and the
expression of mitochondrial fusion 2 in rats. Chin J Gerontol. 2015;35:2169e2171. 26. Shen T, Zheng M, Cao C, et al. Mitofusin-2 is a major determinant of oxidative stress-mediated heart muscle cell apoptosis. J Biol Chem. 2007;282:23354e23361.