Effect of caffeine on the expression of cytochrome P450 1A2, adenosine A2A receptor and dopamine transporter in control and 1-methyl 4-phenyl 1, 2, 3, 6-tetrahydropyridine treated mouse striatum

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Effect of caffeine on the expression of cytochrome P450 1A2, adenosine A2A receptor and dopamine transporter in control and 1-methyl 4-phenyl 1, 2, 3, 6-tetrahydropyridine treated mouse striatum Seema Singh a,1 , Kavita Singh a,1 , Satya Prakash Gupta a , Devendra Kumar Patel a , Vinod Kumar Singh b , Raj Kumar Singh b , Mahendra Pratap Singh a,⁎ a

Indian Institute of Toxicology Research, (Council of Scientific and Industrial Research), Mahatma Gandhi Marg, Post Box-80, Lucknow-226 001, India b Chhatrapati Shahuji Maharaj Medical University, Lucknow-226 003, India

A R T I C LE I N FO

AB S T R A C T

Article history:

Parkinson's disease (PD) is a progressive neurodegenerative disorder, characterized by the

Accepted 2 June 2009

selective loss of dopaminergic neurons of the nigrostriatal pathway. Epidemiological studies

Available online 9 June 2009

have shown an inverse relationship between coffee consumption and susceptibility to PD. Cytochrome P450 1A2 (CYP1A2) is involved in caffeine metabolism and its clearance.

Keywords:

Caffeine, on the other hand, antagonizes adenosine A2A receptor and regulates dopamine

Parkinson's disease

signaling through dopamine transporter (DAT). The present study was undertaken to

1-Methyl 4-phenyl 1, 2, 3, 6-

investigate the expression of CYP1A2, adenosine A2A receptor and DAT in mouse striatum

tetrahydropyridine

and to assess their levels in 1-methyl 4-phenyl 1, 2, 3, 6-tetrahydropryridine (MPTP) treated

Cytochrome P450 1A2

mouse striatum with and without caffeine treatment. The animals were treated

Caffeine

intraperitoneally daily with caffeine (20 mg/kg) for 8 weeks, followed by MPTP (20 mg/kg)

Adenosine A2A receptor

+ caffeine (20 mg/kg) for 4 weeks or vice versa, along with respective controls. Tyrosine

Dopamine transporter

hydroxylase immunoreactivity, levels of dopamine and 1-methyl 4-phenylpyridinium ion (MPP+), expressions of CYP1A2, adenosine A2A receptor and DAT and CYP1A2 catalytic activity were measured in control and treated mouse brain. Caffeine partially protected MPTP-induced neurodegenerative changes and modulated MPTP-mediated alterations in the expression and catalytic activity of CYP1A2, expression of adenosine A2A receptor and DAT. The results demonstrate that caffeine alters the striatal CYP1A2, adenosine A2A receptor and DAT expressions in mice exposed to MPTP. © 2009 Elsevier B.V. All rights reserved.

1.

Introduction

The neurodegeneration in Parkinson's disease (PD) targets dopaminergic neurons of the nigrostriatal pathway. Dopami-

nergic neurodegeneration causes dopamine depletion in the striatum leading to motor disturbances and onset of resting tremor, rigidity, postural instability and bradykinesia, the major hallmarks of PD. Aging, genetic factors and environ-

⁎ Corresponding author. Fax: +91 522 2628227. E-mail address: [email protected] (M.P. Singh). 1 Equal contribution. 0006-8993/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2009.06.002

116

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

mental exposure to pesticides and heavy metals are the major contributors to PD (Tanner et al., 1999; Vieregge et al., 1999; Wirdefeldt et al., 2004). 1-methyl 4-phenyl 1, 2, 3, 6 tetrahydropyridine (MPTP) causes selective degeneration of dopaminergic neurons and is regarded as one of the best rodent models to understand the biochemical and molecular events leading to PD and also to assess the efficacy of anti-PD drugs. MPTP produces several biochemical, molecular and phenotypic symptoms that mimic the sporadic PD (Przedborski et al., 2000; Gerlach and Riederer, 1996). Current therapies alleviate the symptoms of PD and offer only symptomatic relief to the patients. Despite delaying neurodegeneration, the available therapies exert several adverse effects and therefore attempts are consistently being made to develop better therapies with minimal side effects. Caffeine is one of the most widely consumed psychostimulants and dietary components, with an average consumption of about 200–250 mg/day/person, as a standard cup of coffee contains 100 mg of caffeine (Fredholm, 2004). Both retrospective and prospective epidemiological studies have linked caffeine consumption to reduced PD risk and postulated that the neuroprotective effect of caffeine could be due to its ability to antagonize adenosine A2A receptor (Ascherio et al., 2001). Caffeine (5–30 mg/kg) exposure to animals corresponding to the typical human exposure also resists MPTPinduced dopamine depletion in a dose dependent manner (Chen et al., 2001). Although caffeine non-selectively antagonizes adenosine A1, A2A, A2B and A3 receptors, only A2A receptor is abundant in the striatum (Svenningsson and Fredholm, 2003). Adenosine A2A receptor modulates γ-amino butyric acid, acetylcholine and glutamate-mediated neurotransmissions (Kurokawa et al., 1996; Mori et al., 1996; Richardson et al., 1997; Ochi et al., 2000; Fuxe et al., 1998; Canals et al., 2003; Ciruela et al., 2004). Caffeine-mediated neuroprotection could be partially contributed by its ability to inhibit the blood brain barrier dysfunction in MPTP-treated mouse (Chen et al., 2008). Caffeine also prevents apoptotic cell death by the activation of phosphoinositide 3-kinase or serine-threonine protein kinase and Akt pathways (Nakaso et al., 2008). As caffeine alters dopamine signaling and receptor affinity in the striatum by stimulating dopaminergic responses, therefore, blockade of adenosine A2A receptors probably direct anti-PD effects (Ferre et al., 1992). Caffeine stimulates potassium channel opening, which prevents neurons from depolarization and neurotransmitter release and inhibits excitotoxicity by altering neuronal metabolism (Mao et al., 2007; Avshalumov et al., 2005; Jones, 2008). Caffeine is metabolized mainly by CYP1A2 in the liver and increased CYP1A2 activity is associated with habitual caffeine consumption (Carrillo and Benitez, 1996). Dopamine transporter (DAT) is expressed in the dopaminergic neurons and clears the dopamine released into the extra-cellular spaces, thereby regulating the dopamine signaling (Kurosaki et al., 2003). Although CYP1A2, adenosine A2A receptor and dopamine transporter are critical in PD, their roles in MPTP-mediated dopaminergic neurodegeneration and caffeine-mediated neuroprotection are not established. The present study was performed to investigate the expression of CYP1A2, adenosine A2A receptor and dopamine transporter in mouse striatum and to assess their roles therein.

2.

Results

2.1.

Dopamine content

MPTP treatment for 2–4 weeks produced a significant reduction in the striatal dopamine content (Fig. 1a). The decrease in dopamine level was significantly less both in caffeine pre-and post-treated animals. Treatment with ciprofloxacin, an inhibitor of CYP1A2, enhanced MPTP-mediated depletion of dopamine contents in the pre-treatment group (Fig. 1b).

2.2.

Dopaminergic neurodegeneration

Caffeine treatment did not produce any change in tyrosine hydroxylase (TH) immunoreactivity; however, MPTP

Fig. 1 – Dopamine content in the striatum (ng/mg of tissue) of caffeine treated animals (a) and effect of CYP1A2 inhibitor ciprofloxacin on dopamine content in the pre-treatment group (b). The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes **(P < 0.01), ***(P < 0.001) are expressed in comparison with control, #(P < 0.05), ###(P < 0.001) with caffeine, $$(P < 0.01), $$$(P < 0.001) with MPTP and τ(P < 0.05) with caffeine + MPTP.

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

treatment reduced the TH immunoreactivity. MPTPmediated reduction was significantly restored in the animals pre- or post-treated with caffeine (Fig. 2). Ciprofloxacin treatment enhanced MPTP-mediated loss of TH immunoreactivity.

2.3.

117

MPP+ level

Caffeine pre-treatment decreased MPP+ level in the striatum, whereas the level of MPP+ in the post-treatment group was below the detectable limit. Caffeine pre-treated animals that

Fig. 2 – The representative photomicrographs showing TH immunoreactivity of the dopaminergic neurons at 10× magnification (a) and the number of TH+ positive neurons in the substantia nigra pars compacta (b). A, F, K and O represent controls, B, G, L and P are caffeine, C, H, M and Q are MPTP, D, I, N and R are caffeine + MPTP, E and J are caffeine + MPTP + ciprofloxacin respectively after 2 and 4 weeks of pre- and post-caffeine treatment. The control values were considered 100% in each replicate and experimental values were calculated accordingly for each experiment, therefore, there is no error bar in controls in (b). Significant changes are expressed as **(P < 0.01), ***(P < 0.001) in comparison with control; ###(P < 0.001) in comparison with MPTP, τ(P < 0.05) in comparison with caffeine + MPTP and $$(P < 0.01), $$$(P < 0.001) in comparison with caffeine.

118

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

treated animals (Figs. 7c and d). The pattern of CYP1A2 catalytic activity was similar as observed with protein expression under both the conditions (Figs. 6e and 7e).

3.

Fig. 3 – MPP+ level in the striatum of MPTP, caffeine + MPTP and caffeine + MPTP + ciprofloxacin treated animals in the pre-treatment groups. The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes *(P < 0.05), ***(P < 0.001) are expressed in comparison with MPTP.

were also treated with ciprofloxacin did not produce any change in MPP+ level (Fig. 3).

2.4.

DAT expression

MPTP treatment reduced DAT mRNA expression as compared with control. Caffeine treatment in MPTP-treated animals significantly restored DAT mRNA level (Figs. 4a and b). A similar pattern was observed with DAT protein expression (Figs. 4c and d).

2.5.

Adenosine A2A receptor expression

Caffeine treatment significantly attenuated adenosine A2A receptor mRNA expression. MPTP augmented adenosine A2A receptor mRNA expression as compared with control (Figs. 5a and b). The adenosine A2A receptor protein expression pattern exhibited similar trend as observed with its mRNA expression under various treatment conditions (Figs. 5c and d). Both preand post-caffeine treatments produced such changes, however, changes were slightly higher in the pre-treated animals.

2.6. CYP1A2 mRNA and protein expression and its catalytic activity Caffeine augmented CYP1A2 mRNA expression but it was not statistically significant, whereas MPTP attenuated its mRNA level as compared with control significantly. Both pre- and post-treatment with caffeine showed restoration in CYP1A2 expression in MPTP-treated animals, however, pre-treatment with caffeine produced slightly more pronounced effect (Figs. 6a and b). In caffeine pre-treated animals, CYP1A2 inhibitor, ciprofloxacin, decreased mRNA expression (Figs. 7a and b). A similar pattern was observed at the level of CYP1A2 protein expression (Figs. 6c and d). CYP1A2 inhibitor, ciprofloxacin, also decreased CYP1A2 protein expression in caffeine pre-

Discussion

Caffeine is a well-established neuroprotective agent and reduces the MPTP-induced dopaminergic neurodegeneration (Singh et al., 2008). Although caffeine is mainly metabolized in the liver, it is expected to partially metabolize in the brain since it readily crosses the blood brain barrier due to its high degree of lipid solubility and enters into the brain (McCall et al., 1982). Therefore, it was worthwhile to investigate CYP1A2 expression in MPTP-treated mouse brain with and without caffeine exposure. Similarly, adenosine A2A receptor and DAT are associated with PD pathogenesis, as they participate either in caffeine antagonism or neurotransmitter transport. Therefore, their roles in MPTP-induced toxicity and caffeinemediated neuroprotection were also looked into. Caffeine reduces the incidence of PD in males rather than in females (El Yacoubi et al., 2000; Lindskog et al., 2002; Svenningsson and Fredholm, 2003), the study was therefore conducted in male mice. Since the current treatment paradigms were optimized in Swiss albino mice (Singh et al., 2008), this strain was used for the study. Secondly, Swiss albino mice have been found to be very sensitive to MPTP as observed by biochemical and electron microscopic analyses of dopaminergic neurons of MPTP-treated mice (Rajeswari and Sabesan, 2008). MPTP reduced TH-positive neurons, however, there was no significant change in the level of dopaminergic neurons in control/caffeine alone treated animals. MPTP-induced loss of TH-positive neurons in caffeine treated groups was also less. A significant change in TH immunoreactivity in the substantia nigra suggested the possible degeneration of dopaminergic nerve terminals in the striatum. An altered level of dopamine in the striatum also confirmed this observation. This is in accordance with the previous findings, which have shown that caffeine treatment produces a dose dependent attenuation of MPTP-induced dopamine loss in mouse striatum (Xu et al., 2006). Caffeine at doses comparable with the typical human exposure, also produced a dose dependent attenuation in the reduction of the striatal dopamine, triggered by MPTP (Chen et al., 2001). MPTP converts into MPP+, a highly toxic metabolite and enter into the dopaminergic neurons through DAT (Gainetdinov et al., 1997). Caffeine-mediated reduction in the MPP+ level in the pre-treated animals is also in accordance with previous observations (Singh et al., 2008 Ulanowska et al., 2005). In the post-treated group, no MPP+ was detected, which could be either due to its complete removal from the brain, due to its less stability or due to an outcome of an altered CYP1A2 level, as CYP1A2 is involved in caffeine metabolism. In the posttreatment group, level of MPP+ was analyzed 8 weeks after the last MPTP treatment. Since the half-life of MPP+ is very short in rodents (Johannessen et al., 1985; Riachi et al., 1988), therefore, the level of MPP+ could not be detected in the MPTP posttreated animals. CYP1A2-mediated demethylation is responsible for about 80% of the systemic caffeine clearance (Kalow and Tang, 1993; Gu et al., 1992). Caffeine treatment increased

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

119

Fig. 4 – Effect of MPTP and caffeine on DAT mRNA and protein expressions in the pre- and post-treatment groups. DAT mRNA expression is shown in panel (a), band density ratios (DAT /GAPDH mRNA) in (b), Western blot in (c) and relative protein expression in (d). Lanes 1, 5, 9, and 13—controls, lanes 2, 6, 10, and 14—caffeine, lanes 3, 7, 11, and 15—MPTP, lanes 4, 8, 12, and 16—caffeine + MPTP, respectively in the pre-treated and post-treated groups. The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes are expressed as *(P < 0.05), **(P < 0.01), ***(P < 0.001) in comparison with control, #(P < 0.05), ##(P < 0.01), ###(P < 0.001) with caffeine and $(P < 0.05), $$(P < 0.01) with MPTP.

CYP1A2 expression and activity, whereas MPTP treatment attenuated the same. As CYP1A2 contributes to the detoxification of MPTP, therefore, caffeine was expected to alter MPTP detoxification (Xu et al., 2002). The MPP+ level measured in the presence of CYP1A2 inhibitor, ciprofloxacin, did not show any alteration. The results indicate that an altered MPTP metabolism as a result of caffeine treatment could be via some other routes (Singh et al., 2008) and was not mediated by CYP1A2. Caffeine pre- and post-treatment prevented the MPTPmediated reduction in CYP1A2 enzymatic activity and its

expression. Caffeine is known to increase its own metabolism in a dose dependent manner through induction of CYP1A2 in the liver (Goasduff et al., 1996). Altered CYP1A2 activity is expected to be a reason for neuroprotection offered by caffeine in this study, as CYP1A2 get induced in vivo by chronic caffeine exposure (Xu et al., 2002). Ciprofloxacin, a moderately potent inhibitor of CYP1A2, attenuated the expression and activity of CYP1A2. This is in accordance with the previous report showing 70% decrease in the activity of CYP1A2 in vitro by ciprofloxacin (Fuhr et al., 1992).

120

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

Fig. 5 – Effect of MPTP and caffeine on adenosine A2A mRNA and protein expression in the pre- and post-treatment groups. Adenosine A2A mRNA expression is shown in panel (a), band density ratios (A2A/GAPDH mRNA) in (b), Western blot in (c) and relative protein expression in (d). Lanes 1, 5, 9, and 13—controls, lanes 2, 6, 10, and 14—caffeine, lanes 3, 7, 11, and 15—MPTP, lanes 4, 8, 12, and 16—caffeine + MPTP, respectively in the pre-treated and post-treated groups (a and c). The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes *(P < 0.05), **(P < 0.01), ***(P < 0.001) are expressed in comparison with control, #(P < 0.05), ##(P < 0.01), ###(P < 0.001) with caffeine and $(P < 0.05), $$$(P < 0.001) with MPTP.

Caffeine, a non-selective antagonist of adenosine A2A receptor attenuated its expression at transcriptional and translational levels, whereas MPTP treatment augmented its expression. This is supported by the fact that the neuroprotective effect of caffeine is mediated by adenosine receptor antagonism (Fredholm et al., 1999), and the inactivation or inhibition of A2A receptor inhibits MPTP-induced dopaminergic damage (Pierri et al., 2005). Blockade of A2A receptors via caffeine alters the release of GABA, acetylcholine and gluta-

mate neurotransmitters. A2A receptor antagonism has been reported to play a critical neuroprotective role in brain injury (Jones, 2008; Monopoli et al., 1998; Ravina et al., 2003). The activation of the striatal adenosine A2A receptors decreases the affinity of D2 receptors for dopamine and has opposing effect on cyclic AMP (cAMP) formation, which ultimately leads to the activation of the striatopallidal/indirect pathway. Blockade of adenosine A2A receptor activity inhibits the indirect pathway/inhibitory pathway leading to facilitated

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

121

Fig. 6 – Effect of MPTP and caffeine on CYP1A2 mRNA and protein expression and its catalytic activity in the pre- and post-treatment groups. CYP1A2 mRNA expression is shown in panel (a), band density ratios (CYP1A2/GAPDH mRNA) in (b), Western blot in (c), relative protein expression in (d) and catalytic activity (MROD) in (e). Lanes 1, 5, 9, and 13—control, lanes 2, 6, 10, and 14—caffeine, lanes 3, 7, 11, and 15—MPTP, lanes 4, 8, 12, and 16—caffeine + MPTP, respectively in the pre- and post-treatment groups (a and c). The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes *(P < 0.05), **(P < 0.01), ***(P < 0.001) are expressed in comparison with control, #(P < 0.05), ##(P < 0.01), ###(P < 0.001) with caffeine, $(P < 0.05), $$(P < 0.01), $$$(P < 0.001) with MPTP.

122

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

Fig. 7 – Effect of ciprofloxacin, a CYP1A2 inhibitor, on CYP1A2 mRNA and protein expression and its catalytic activity in the pre-treatment groups. CYP1A2 mRNA expression is shown in panel (a), band density ratios (CYP1A2/GAPDH mRNA) in (b), Western blot in (c), relative protein expression in (d) and catalytic activity (MROD) in (e). Lanes 1 and 9 controls, 2 and 10 control + ciprofloxacin, 3 and 11 caffeine, 4 and 12 caffeine + ciprofloxacin, 5 and 13 MPTP, 6 and 14 MPTP + ciprofloxacin 7 and 15 caffeine + MPTP, 8 and 16 caffeine + MPTP + ciprofloxacin respectively in 2 and 4 weeks of forward treatment groups (a and c). The data are expressed as means ± S.E.M. (n = 3–5 separate experiments). Significant changes *(P < 0.05), **(P < 0.01) are expressed in comparison with control, #(P < 0.05), ###(P < 0.001) with caffeine, $(P < 0.05), $$(P < 0.01) with MPTP and τ(P < 0.05), ττ(P < 0.01), τττ(P < 0.001) with caffeine + MPTP.

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

movements (Ochi et al., 2000). VMAT-2 expression is down regulated by cAMP production (Nakanishi et al., 1995), which may alter the toxicity response, thus protecting dopaminergic neurons. In this study, MPTP treatment significantly attenuated DAT mRNA and protein expression. This is not an unusual phenomenon, as reduced DAT mRNA expression following MPTP treatment has been reported in a number of studies (Bousquet et al., 2008; Thiriet et al., 2008; Xu et al., 2005). Liu et al. (2008a; 2008b) have also reported a significant decrease in DAT expression in the midbrain of MPTP-treated mice in two independent studies. The change in DAT level is in accordance with the fact that MPTP targets DA neuron and DAT acts as a molecular gateway for MPP+ entry (Kurosaki et al., 2003; Gainetdinov et al., 1997). Caffeine restored DAT expression in both pre- and post-treated groups possibly by protecting DA neurons from degeneration. The present study demonstrates that caffeine-mediated neuroprotective effect could be partially contributed by CYP1A2, adenosine A2A receptor and DAT.

4.

Experimental procedures

4.1.

Chemicals

The following chemicals were procured from Sigma-Aldrich, USA—acetic acid, acetone, agarose, acetonitrile, bovine serum albumin, Bradford reagent, bromophenol blue, caffeine, chloroform, disodium hydrogen orthophosphate (Na2HPO4), dithiothreitol (DTT), ethidium bromide, ethanol, ethylenediamine-tetra-acetic acid (EDTA), goat anti-rabbit IgG horseradish peroxidase (HRP) conjugated secondary antibody, heptane sulphonic acid, hydrogen peroxide, magnesium chloride, magnesium sulphate, methanol, MPTP hydrochloride, rabbit monoclonal-HRP conjugate, monoclonal antityrosine hydroxylase antibody, monoclonal anti-β-actin antibody, mouse monoclonal-HRP conjugate, methanol, nicotinamide adenine dinucleotide phosphate (NADPH), perchloric acid, phenyl methylsulphonyl fluoride (PMSF), p-nitrophenol, potassium phosphate, 4-nitrocatechol, potassium chloride (KCl), sodium chloride (NaCl), sodium dihydrogen phosphate (NaH2PO4), sodium dodecyl sulphate (SDS), sodium hydroxide, sodium pyrophosphate, sucrose, tris-base, Triton-X100 and Tween-20. RT-PCR kit were procured from MBI Fermentas, USA and forward and reverse primers for A2A, CYP1A2, DAT and GAPDH, Taq DNA polymerase, dNTPs and 100 bp ladder were purchased from Bangalore Genei, India. Polyvinylidene difluoride (PVDF) membrane was procured from GE Healthcare, Europe, mouse monoclonal anti-A2A antibody from Santa Cruz Biotechnology, Incorporation; rabbit anti-DAT, rabbit anti-rat 1A2 antibody from Chemicon International, USA and Vectastain Universal Quick kit was procured from Vector Laboratory, USA.

4.2.

Animal treatment

Male Swiss albino mice (20–25 g) were obtained from the animal colony of the Indian Institute of Toxicology Research (IITR), Lucknow. The animals were kept under standard conditions

123

(temperature—22 °C± 2 °C, humidity—45–55% and light intensity 300–400 lx). The animals were fed standard pellet diet and water ad libitum (Singh et al., 2008). The Institutional Ethics Committee for the Use of Laboratory Animals approved the study. In the pre-treatment group, the animals were treated daily intraperitoneally with caffeine (20 mg/kg) for 8 weeks followed by MPTP hydrochloride (20 mg/kg) co-treatment once in a day for 2–4 weeks (Singh et al., 2008). In the post-treatment group, the animals were treated daily intraperitoneally with MPTP hydrochloride (20 mg/kg) once in a day for 2–4 weeks, followed by 2–4 weeks caffeine (20 mg/kg) and finally with either normal saline (0.9% NaCl) or caffeine for 8 weeks. Control/ vehicle animals were treated with the corresponding volume of normal saline. After the final treatment, the animals were sacrificed via cervical dislocation; the striatum was dissected out and frozen immediately in liquid nitrogen till further use.

4.3.

Immunohistochemistry

TH immunoreactivity was performed using standard procedure (Gorbatyuk et al., 2008). Animals were anesthetized and intra-cardiac perfusion was done with normal saline, followed by paraformaldehyde (4%) in phosphate buffered saline. After perfusion, the brain was dissected coronally through median eminence. The caudal block was post-fixed, cryoprotected and sections were cut using a cryostat. The non-specific labeling was blocked by incubating the sections in blocking buffer (1.5% normal horse serum 0.1% triton X-100 in phosphate buffered saline) for 2 h. The sections were incubated in monoclonal anti-TH antibody (1:250) at 4 °C for 12 h. The sections were washed thrice with phosphate buffered saline for 15 min each and incubated with secondary antibody for 1 h, followed by streptavidin peroxidase complex for 30 min. The color was developed with 3, 3 diaminobenzidine and the sections were dehydrated in graded ethanol and permanently mounted with DPX. The mounted sections were visualized under the microscope. The images were captured at 10× magnification. The TH+ cells were counted using a method described elsewhere (Mochizuki et al., 2001).

4.4. High performance liquid chromatography (HPLC) analysis of dopamine and 1-methyl 4-phenylpyridinium ion (MPP+) The striatal dopamine and MPP+ content were measured, as described previously (Singh et al. 2008). The dopamine level is expressed in ng/mg of tissue and MPP+ level is expressed as ng/mg of protein. The limit of detection of MPP+ was 5 ng/ml.

4.5.

Preparation of microsomes

The perfused striatum was homogenized in potassium phosphate buffer (10% w/v; 0.1 M, pH 7.4), containing EDTA (1 mM), pepstatin (0.1 mM), PMSF (0.1 mM) 0.135 M KCl and glycerol (20%) in ice-cold condition. The supernatant obtained (900 ×g, 10 min) was re-centrifuged (100,000 ×g, 1 h). The pellet was suspended in phosphate buffer (67 mM), containing sucrose (0.25 M), EDTA (1 mM), PMSF (0.1 mM), protease inhibitor cocktail (20 g/ml) and glycerol (20%) and was stored at −80 °C till further use.

124 4.6.

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

Estimation of the protein content

The protein content was measured using standard curve of bovine serum albumin (Bradford 1976).

cence was measured at 550 nm excitation and 585 nm emission wavelengths. The enzymatic activity was calculated in pmol/ min/mg protein.

4.10. 4.7.

Protein (100 μg) was denatured with SDS buffer, separated on 12% polyacrylamide gel and transferred to PVDF membrane (Sigma). The blots were blocked with tris buffered saline (TBS) containing 5% non-fat dry milk for 2 h to arrest non-specific binding and incubated with primary antibodies against CYP1A2, A2A receptor and DAT (1:200) in TBS at 4 °C overnight. Rabbit monoclonal-HRP conjugate, mouse monoclonal-HRP conjugate and goat anti-rabbit IgG HRP conjugated secondary antibody (1:500) respectively in TBS were used to detect CYP1A2, A2A and DAT. The blots were visualized using DAB/ H2O2 as substrates. Relative band density was calculated with respect to β-actin and the data are expressed as % of control.

4.8. Isolation of RNA and reverse transcription-polymerase chain reaction RNA was extracted from the striatum using Trizol reagent following manufacturer's instructions. Revert aid™ minus MuLV reverse transcriptase was used to synthesize cDNA. The primers were synthesized and PCR amplification conditions were used as reported elsewhere. In brief, primers used for CYP1A2 (Choudhary et al., 2003) were 5′ 5′GACGTCAGCATCCTCTTGCT3′ (forward) and 5′GGCACTTGTGATGTCTTGGA3′ (reverse), annealing temperature was 65.5 °C and the product size was 400-base pair. Similarly, the primers for DAT (Patel et al., 2008) were 5′CGGTGGCAGCTCACAGC3′ (forward) and 5′TGGAGAAGGCGATCAGCAC3′ (reverse), annealing temperature was 60 °C and the product size was 292-base pair. The primers used for A2A (Tarditi et al., 2006) were 5′TGTCCTGGTCCTCACGCAGAG3′ (forward) and 5′ CGGATCCTGTAGGCGTAGATGAAGG3′ (reverse), annealing temperature was 55 °C and the product size was 600-base pair. The primer sequences for GAPDH (Singh et al., 2008) were 5′CTCATGACCACAGTCCATGC3′ (forward) and 5′CACATTGGGGGTAGGAACAC3′ (reverse). The GAPDH was amplified concurrently with the respective genes. PCR products were visualized in 2% agarose gel using ethidium bromide under UV. The band density was calculated by computerized densitometry system and normalized with GAPDH.

4.9.

Statistical analysis

Western blotting

CYP1A2 catalytic activity

Catalytic activity of CYP1A2 (7-methoxyresorufin O-demethylase, MROD) was measured by mixing 50–250 μg microsomal protein with 0.1 M phosphate buffer (pH 7.4) containing 5 mM glucose–6-phosphate, 2 U of glucose–6-phosphate dehydrogenase, 5 mM magnesium sulphate, 1.6 mg/ml BSA, 1.5 μM 7methoxy resorufin (Upadhyay et al., 2007). In brief, NADPH (0.6 nmol) was added into the reaction mixture to initiate the reaction. The mixed content was incubated at 37 °C for 20 min and the reaction was stopped by adding 2.5 ml methanol and keeping the mixture in ice. Reaction mixture was centrifuged at 825 ×g for 10 min and supernatant was collected. Fluores-

The data are expressed as means ± standard error of means (S.E.M.). Two-way analysis of variance (ANOVA) was used for comparison between different groups with Bonferroni posttest. The difference was considered statistically significant when “P” value was less than 0.05.

Acknowledgments The authors thank the Department of Biotechnology (DBT) for the financial support. Authors also acknowledge the University Grant Commission (UGC), New Delhi, India for providing research fellowship to Seema Singh. The IITR communication number of this article is 2728.

REFERENCES

Ascherio, A., Zhang, S.M., Hernan, M.A., Kawachi, I., Colditz, G.A., Speizer, F.E., Willett, W.C., 2001. Prospective study of caffeine consumption and risk of Parkinson's disease in men and women. Ann. Neurol. 50, 56–63. Avshalumov, M.V., Chen, B.T., Koos, T., Tepper, J.M., Rice, M.E., 2005. Endogenous hydrogen peroxide regulates the excitability of midbrain dopamine neurons via ATP-sensitive potassium channels. J. Neurosci. 25, 4222–4231. Bousquet, M., Saint-Pierre, M., Julien, C., Salem, N.Jr., Cicchetti, F., Calon, F., 2008. Beneficial effects of dietary omega-3 polyunsaturated fatty acid on toxin-induced neuronal degeneration in an animal model of Parkinson's disease. FASEB J. 22, 1213–1225. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Canals, M., Marcellino, D., Fanelli, F., Ciruela, F., de Benedetti, P., Goldberg, S.R., Neve, K., Fuxe, K., Agnati, L.F., Woods, A.S., Ferre, S, Lluis, C., Bouvier, M., Franco, R., 2003. Adenosine A2A-dopamine D2 receptor–receptor heteromerization: qualitative and quantitative assessment by fluorescence and bioluminescence energy transfer. J. Biol. Chem. 278, 46741–46749. Carrillo, J.A., Benitez, J., 1996. CYP1A2 activity, gender and smoking, as variables influencing the toxicity of caffeine. Br. J. Clin. Pharmacol. 41, 605–608. Chen, J.F., Xu, K., Petzer, J.P., Staal, R., Xu, Y.H., Beilstein, M., Sonsalla, P.K., Castangoli, K., Castangoli, N.J., Scharzchild, M.A., 2001. Neuroprotection by caffeine and A(2A) adenosine receptor inactivation in a model of Parkinson's disease. J. Neurosci. 21, RC143. Chen, X., Lan, X., Roche, I., Liu, R., Geiger, J.D., 2008. Caffeine protects against MPTP-induced blood–brain barrier dysfunction in mouse striatum. J Neurochem. 107, 1147–1157. Choudhary, D., Jansson, I., Schenkman, J.B., Sarfarazi, M., Stoilov, I., 2003. Comparative expression profiling of 40 mouse cytochrome P450 genes in embryonic and adult tissues. Arch. Biochem. Biophys. 414, 91–100. Ciruela, F., Burgueno, J., Casado, V., Canals, M., Marcellino, D., Goldberg, S.R., Bader, M., Fuxe, K., Agnati, L.F., Lluis, C., Franco,

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –1 26

R., Ferre, S., Woods, A.S., 2004. Combining mass spectrometry and pull-down techniques for the study of receptor heteromerization. Direct epitope–epitope electrostatic interactions between adenosine A2A and dopamine D2 receptors. Anal. Chem. 76, 5354–5363. El Yacoubi, M., Ledent, C., Menard, J.F., Parmentier, M., Costentin, J., Vaugeois, J.M., 2000. The stimulant effects of caffeine on locomotor behaviour in mice are mediated through its blockade of adenosine A(2A) receptors. Br. J. Pharmacol. 129, 1465–1473. Ferre, S., Fuxe, K., von Euler, G., Johansson, B., Fredholm, B.B., 1992. Adenosine–dopamine interactions in the brain. Neuroscience 51, 501–512. Fredholm, B.B., 2004. Connection between caffeine, adenosine receptors and dopamine. Coffee reduces the risk of Parkinson disease. Lakartidningen 101, 2552–2555. Fredholm, B.B., Battig, K., Holmen, J., Nehlig, A., Zvartau, E.E., 1999. Actions of caffeine in the brain with special reference to factors that contribute to its widespread use. Pharmacol. Rev. 51, 83–133. Fuhr, U., Anders, E.M., Mahr, G., Sorgel, F., Staib, A.H., 1992. Inhibitory potency of quinolone antibacterial agents against cytochrome P450IA2 activity in vivo and in vitro. Antimicrob. Agents Chemother. 36, 942–948. Fuxe, K., Ferre, S., Zoli, M., Agnati, L.F., 1998. Integrated events in central dopamine transmission as analyzed at multiple levels. Evidence for intramembrane adenosine A2A/dopamine D2 and adenosine A1/dopamine D1 receptor interactions in the basal ganglia. Brain Res. Brain Res. Rev. 26, 258–273. Gainetdinov, R.R., Fumagalli, F., Jones, S.R., Caron, M.G., 1997. Dopamine transporter is required for in vivo MPTP neurotoxicity: evidence from mice lacking the transporter. J. Neurochem. 69, 1322–1325. Gerlach, M., Riederer, P., 1996. Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J. Neural. Transm. 103, 987–1041. Goasduff, T., Dreano, Y., Guillois, B., Menez, J.F., Berthou, F., 1996. Induction of liver and kidney CYP1A1/1A2 by caffeine in rat. Biochem. Pharmacol. 52, 1915–1919. Gorbatyuk, O.S., Li, S., Sullivan, L.F., Chen, W., Kondrikova, G., Manfredsson, F.P., Mandel, R.J., Muzyczka, N., 2008. The phosphorylation state of Ser-129 in human α-synuclein determines neurodegeneration in a rat model of Parkinson disease. Proc. Natl. Acad. Sci. U. S. A. 105, 763–768. Gu, L., Gonzalez, F.J., Kalow, W., Tang, B.K., 1992. Biotransformation of caffeine, paraxanthine, theophylline, and theobromine by cDNA expressed human CYP1A2 and CYP2E1. Pharmacogenetics 2, 73–77. Johannessen, J.N., Chiueh, C.C., Burns, R.S., Markey, S.P., 1985. Differences in the metabolism of MPTP in the rodent and primate parallel differences in sensitivity to its neurotoxic effects. Life Sci. 36, 219–224. Jones, G., 2008. Caffeine and other sympathomimetic stimulants: modes of action and effects on sports performance. Essays Biochem. 44, 109–123. Kalow, W., Tang, B.K., 1993. The use of caffeine for enzyme assays; a critical appraisal. Clin. Pharmacol. Ther. 53, 503–514. Kurokawa, M., Koga, K., Kase, H., Nakamura, J., Kuwana, Y., 1996. Adenosine A2a receptor-mediated modulation of striatal acetylcholine release in vivo. J. Neurochem. 66, 1882–1888. Kurosaki, R., Muramatsu, Y., Watanabe, H., Michimata, M., Matsubara, M., Imai, Y., Araki, T., 2003. Role of dopamine transporter against MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) neurotoxicity in mice. Metab. Brain Dis. 18, 139–146. Lindskog, M., Svenningsson, P., Pozzi, L., Kim, Y., Fienberg, A.A., Bibb, J.A., Fredholm, B.B., Nairn, A.C., Greengard, P., Fisone, G.,

125

2002. Involvement of DARPP-32 phosphorylation in the stimulant action of caffeine. Nature 418, 774–778. Liu, B., Xie, J.X., Tsang, L.L., Rowlands, D.K., Ho, L.S., Gou, Y.L., Chung, Y.W., Chan, H.C., 2008a. Bak Foong protects dopaminergic neurons against MPTP-induced neurotoxicity by its anti-apoptotic activity. Cell Biol. Int. 32, 86–92. Liu, L.X., Chen, W.F., Xie, J.X., Wong, M.S., 2008b. Neuroprotective effects of genistein on dopaminergic neurons in the mice model of Parkinson's disease. Neurosci. Res. 60, 156–161. Mao, X., Chai, Y., Lin, Y.F., 2007. Dual regulation of the ATP-sensitive potassium channel by caffeine. Am. J. Physiol. Cell Physiol. 292, C2239–2258. McCall, A.L, Millington, W.R., Wurtman, R.J., 1982. Blood–brain barrier transport of caffeine: dose-related restriction of adenine transport. Life Sci. 31, 2709–2715. Mochizuki, H., Hayakawa, H., Migita, M., Shibata, M., Tanaka, R., Suzuki, A., Shimo-Nakanishi, Y., Urabe, T., Yamada, M., Tamayose, K., Shimada, T., Miura, M., Mizuno, Y., 2001. An AAV-derived Apaf-1 dominant negative inhibitor prevents MPTP toxicity as antiapoptotic gene therapy for Parkinson's disease. Proc. Natl. Acad. Sci. U. S. A. 98, 10918–10923. Monopoli, A., Lozza, G., Forlani, A., Mattavelli, A., Ongini, E., 1998. Blockade of adenosine A2A receptors by SCH 58261 results in neuroprotective effects in cerebral ischaemia in rats. NeuroReport 9, 3955–3959. Mori, A., Shindou, T., Ichimura, M., Nonaka, H., Kase, H., 1996. The role of adenosine A2a receptors in regulating GABAergic synaptic transmission in striatal medium spiny neurons. J. Neurosci. 16, 605–611. Nakanishi, N., Onozawa, S., Matsumoto, R., Kurihara, K., Ueha, T., Hasegawa, H., Minami, N., 1995. Effects of protein kinase inhibitors and protein phosphatase inhibitors on cyclic AMP-dependent down-regulation of vesicular monoamine transport in pheochromocytoma PC12 cells. FEBS Lett. 368, 411–414. Nakaso, K., Ito, S., Nakashima, K., 2008. Caffeine activates the PI3K/Akt pathway and prevents apoptotic cell death in a Parkinson's disease model of SH-SY5Y cells. Neurosci. Lett. 432, 146–150. Ochi, M., Koga, K., Kurokawa, M., Kase, H., Nakamura, J., Kuwana, Y., 2000. Systemic administration of adenosine A(2A) receptor antagonist reverses increased GABA release in the globus pallidus of unilateral 6-hydroxydopamine-lesioned rats: a microdialysis study. Neuroscience 100, 53–62. Patel, S., Singh, K., Singh, S., Singh, M.P., 2008. Gene expression profiles of mouse striatum in control and maneb - paraquat induced Parkinson's disease phenotype: validation of differentially expressed energy metabolizing transcripts. Mol. Biotechnol. 40, 59–68. Pierri, M., Vaudano, E., Sager, T., Englund, U., 2005. KW-6002 protects from MPTP induced dopaminergic toxicity in the mouse. Neuropharmacology 48, 517–524. Przedborski, S., Jackson Lewis, V., Djaldetti, R., Liberatore, G., Vila, M., Vukosavic, S., Almer, G., 2000. The Parkinsonian-toxin MPTP: action and mechanism. Restor. Neurol. Neurosci. 16, 135–142. Rajeswari, A., Sabesan, M., 2008. Neuropathological changes induced by neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine in male Swiss albino mice. Toxicol. Ind. Health 24, 189–194. Ravina, B.M., Fagan, S.C., Hart, R.G., Hovinga, C.A., Murphy, D.D., Dawson, T.M., Marler, J.R., 2003. Neuroprotective agents for clinical trials in Parkinson-s disease: a systematic assessment. Neurology 60, 1234–1240. Riachi, N.J., Harik, S.I., Kalaria, R.N., Sayre, L.M., 1988. On the mechanisms underlying

126

BR A I N R ES E A RC H 1 2 8 3 ( 2 00 9 ) 1 1 5 –12 6

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine neurotoxicity. II. Susceptibility among mammalian species correlates with the toxin's metabolic patterns in brain microvessels and liver. J. Pharmacol. Exp. Ther. 244, 443–448. Richardson, P.J., Kase, H., Jenner, P.G., 1997. Adenosine A2A receptor antagonists as new agents for the treatment of Parkinson-s disease. Trends Pharmacol. Sci. 18, 338–344. Singh, S., Singh, K., Patel, S., Patel, D.K., Singh, C., Nath, C., Singh, M.P., 2008. Nicotine and caffeine-mediated modulation in the expression of toxicant responsive genes and vesicular monoamine transporter-2 in 1-methyl 4-phenyl-1,2,3,6-tetrahydropyridine'induced Parkinson's disease phenotype in mouse. Brain Res. 1207, 193–207. Svenningsson, P., Fredholm, B.B., 2003. Exciting news about A2A receptors. Neurology 61, S10–S11. Tanner, C.M., Ottman, R., Goldman, S.M., Ellenberg, J., Chan, P., Mayeux, R., Langston, J.W., 1999. Parkinson disease in twins: an etiologic study. JAMA 281, 341–346. Tarditi, A., Camurri, A., Varani, K., Borea, P.A., Woodman, B., Bates, G., Cattaneo, E., Abbracchio, M.P., 2006. Early and transient alteration of adenosine A2A receptor signaling in a mouse model of Huntington disease. Neurobiol. Dis. 23, 44–53. Thiriet, N., Amar, L., Toussay, X., Lardeux, V., Ladenheim, B., Becker, K.G., Cadet, J.L., Solinas, M., Jaber, M., 2008. Environmental enrichment during adolescence regulates gene expression in the striatum of mice. Brain Res. 1222, 31–41.

Ulanowska, K., Piosik, J., Gwizdek-Wisniewska, A., We Grzyn, G., 2005. Formation of stacking complexes between caffeine (1,2,3-trimethylxanthine) and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine may attenuate biological effects of this neurotoxin. Bioorg. Chem. 33, 402–413. Upadhyay, G., Kumar, A., Singh, M.P., 2007. Effect of silymarin on pyrogallol-and rifampicin-induced hepatotoxicity in mouse. Eur. J. Pharmacol. 565, 190–201. Vieregge, P., Hagenah, J., Heberlein, I., Klein, C., Ludin, H.P., 1999. Parkinson's disease in twins: a follow-up study. Neurology 53, 566–572. Wirdefeldt, K., Gatz, M., Schalling, M., Pedersen, N.L., 2004. No evidence for heritability of Parkinson disease in Swedish twins. Neurology 63, 305–311. Xu, K., Xu, Y., Brown-Jermyn, D., Chen, J.F., Ascherio, A., Dluzen, D.E., Schwarzschild, M.A., 2006. Estrogen prevents neuroprotection by caffeine in the mouse 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson's disease. J. Neurosci. 26, 535–541. Xu, K., Xu, Y.H., Chen, J.F., Schwarzschild, M.A., 2002. Caffeine-s neuro-protection against 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine toxicity shows no tolerance to chronic caffeine administration in mice. Neurosci. Lett. 322, 13–16. Xu, Z., Cawthon, D., McCastlain, K.A., Slikker Jr., W., Ali, S.F., 2005. Selective alterations of gene expression in mice induced by MPTP. Synapse 55, 45–51.