- Email: [email protected]
Effect of cheY deletion on growth and colonization in a Haemophilus parasuis serovar 13 clinical strain EP3
Gene 577 (2016) 96–100
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Effect of cheY deletion on growth and colonization in a Haemophilus parasuis serovar 13 clinical strain EP3 Lvqin He, Xintian Wen, Xuefeng Yan, Lingqiang Ding, Sanjie Cao, Xiaobo Huang, Rui Wu, Yiping Wen ⁎ Research Center of Swine Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
a r t i c l e
i n f o
Article history: Received 13 July 2015 Received in revised form 4 November 2015 Accepted 20 November 2015 Available online 2 December 2015 Keywords: Haemophilus parasuis cheY Serum resistance Biofilm formation Autoagglutination
a b s t r a c t CheY, a response regulator of controlling the bacterial chemotactic swimming, can be modulated by either phosphorylation or acetylation to generate clockwise rotation of the flagella. Here, we researched the biological characteristics of cheY deletion mutant in Haemophilus parasuis, and found that the growth rate of this mutant was significantly slower compared with serovar 13 wild strain EP3. Additionally, the cheY mutant didn't show obvious sensitivity to porcine sera. The results of biofilm formation assay showed that H. parasuis cheY mutant produced less biofilm mass compared with wild strain. The H. parasuis cheY mutant reduced autoagglutination obviously. These findings were vital for revealing the function of cheY in growth, biofilm formation and autoagglutination. Thus, cheY plays a crucial role in growth and colonization in vivo of H. parasuis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Haemophilus parasuis, the etiological agent of Glässer's disease, is a non-motile, nicotinamide denine inucleotide (NAD)-dependent, and small Gram-negative rhabditiform of the family Pasteurellaceae (del Río et al., 2006). Glässer's disease, causing serious financial losses on a global scale, is characterized by fibrinous polyserositis, polyarthritis and meningitis (Cai et al., 2005). Currently, this disease has become one of the major causes of nursery mortality in swine herds (Zou et al., 2013). Pathogenic bacteria have a variety of signal system to continuously monitor external environment to adjust its structure and physiological behavior, which make them adapt to the new environment and colonization. Two-component signal transduction system (TCSTS) plays a major role in the process of a variety of biological processes (Beier and Gross, 2006). The TCSTS consists of a histidine protein kinase (HK) which contains a conserved kinase core, and a response regulator protein (RR) which contains a conserved
Abbreviations: NAD, nicotinamide-adenine dinucleotide; PA, polyacrylamide; PAGE, PA-gel electrophoresis; rRNA, ribosomal RNA; SDS, sodium dodecyl sulfate; kDa, kilodalton(s); Kan, kanamycin; ORF, open reading frame. ⁎ Corresponding author. E-mail addresses: [email protected] (L. He), [email protected] (X. Wen), [email protected] (X. Yan), [email protected] (L. Ding), [email protected] (S. Cao), [email protected] (X. Huang), [email protected] (R. Wu), [email protected] (Y. Wen).
http://dx.doi.org/10.1016/j.gene.2015.11.046 0378-1119/© 2015 Elsevier B.V. All rights reserved.
regulatory domain. When the bacteria sense the extracellular stimulant by HK, the HK carries out phosphorylation, and subsequently transfers the phosphoryl group to the RR. The RR with phosphoryl group results in activation of a downstream effector domain that elicits the specific response to regulate the gene expression or make the target protein occur adaptive changes (Stock et al., 2000). cheY/qseC is one of the TCSTS in H. parasuis. CheY belongs to cytoplasmic response regulatory proteins, which regulate the expression of specific genes. QseC is a transmembrane protein with histidine protein kinase activity to accept an extracellular stimulating signal. cheY/qseC is mainly associated with bacterial population density, the formation of biofilm, bacterial mobility and colonization. qseB/ qseC, with cheY/qseC homology, is the TCSTS in Haemophilus influence, Escherichia coli and Salmonella enterica. QseB/QseC is involved in the biofilm formation of Non-typeable Haemophilus influenzae in vitro (Unal et al., 2012). qseB mutant has poor biofilms, which results in the cell displaying poor adhesion and motility in Escherichia coli (Wood et al., 2006). In Salmonella enterica, QseB is classified as a negative regulator of bacterial motility and swine colonization (Bearson et al., 2010). To date, there is no relative report about cheY/qseC system in H. parasuis. In this study, we investigated the biological characteristics of H. parasuis cheY mutant strain, including growth characteristics, serum resistance, biofilm formation and autoagglutination, aiming to preliminary understand the correlation of cheY gene and the virulence of H. parasuis, and provide some data for the further study in TCSTS. This is the first report that relates the growth, virulence and colonization about cheY gene in H.parasuis.
L. He et al. / Gene 577 (2016) 96–100
2. Materials and methods
Table 2 Sequences of PCR oligonucleotide primers.
2.1. Bacterial strains and growth conditions A field isolate of H. parasuis serovar 13 strain, EP3, isolated from Sichuan, China and recombinant plasmids is listed in Table 1. Bacteria were routinely cultured on Tryptic Soy Broth (TSB, Difco, Detroit, USA) or Tryptic Soy Agar (TSA, Difco, Detroit, USA) at 37 °C, containing 5% inactivated bovine serum and 0.01% nicotinamide adenine dinucleotide (NAD, Sigma Aldrich, Missouri, USA). E. coli DH5α was cultured in Luria–Bertani medium at 37 °C. If necessary, 50 mg/mL of kanamycin or 100 mg/mL of ampicillin was complemented. The vector pK18mobsacB was utilized for constructing the vector of the homologous recombination. The antisera against H. parasuis EP3 and H. parasuis EP3-1 were prepared by using five to six weeks old pathogen-free KM mice were obtained from Chengdu Dossy Experimental Animals Company, Ltd. 2.2. Construction of H. parasuis cheY mutant Primers used for amplification (Table 2) in this study were ordered from the Invitrogen (Shanghai, China). The 771-bp upstream homologous arm region and the 925-bp down homologous arm region of cheY were amplified using primers P1/P2 and P3/P4 from the genome of EP3, respectively. A kanamycin resistant (kanR) cassette was amplified from pKD4 using primer pairs P5/P6. These three PCR fragments were integrated by overlap PCR with primer pairs P1 and P4. Then the fusion segment was digested by BamHI and HindIII, and subsequently cloned into pK18mobsacB which was also digested by BamHI and HindIII to construct pLQ1. Both two DNA fragments (upstream homologous arm and down homologous arm) included a 9-bp core DNA uptake signal sequence (USS) of 5′- ACCGCTTGT -3′ (Zhang et al., 2012a). Eventually, the plasmid was mobilized into EP3 by natural transformations. 2.3. Genetic stability and distinct growth defect in the H. parasuis cheY mutant The H. parasuis cheY mutant was cultured and passaged for 10 times continuously in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD (Liu et al., 2013). The corresponding fragments were amplified by PCR to identify the genetic stability of each generation of the mutant strain. The Single colonies of H. parasuis cheY mutant and the wild-type strain EP3 were picked respectively and inoculated in TSB medium supplemented with 5% inactivated bovine serum and 0.01% NAD with shaking 12 h. The next day, the bacterial suspension were inoculated into the new TSB medium supplemented with 5% inactivated bovine serum and 0.01% NAD at a dilution of 1:100. The
Table 1 Bacterial strains and plasmids. Bacterial strain/plasmid
Relevant characteristic(s)a
Source
E. coli DH5a
F ф80ΔlacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 F ompT hsdS (rBB-mB−) gal dcm (DE3) Haemophilus parasuis, wild type, serovar 13 clinical isolate EP3 cheY mutant (△cheY); Kanr Expression vector, Kanr Kanr, suicide and narrow-broad-host vector Ampr, Kanr, gene knock-out vector A 1696-bp PCR fragment containing Kanr, the upstream and downstream sequences of the cheY gene in pK18mobsacB, Kanr
TIANGEN
E. coli BL21 EP3 EP3-1 PET-28a pK18mobsacB pKD4 pLQ1
a
Abbreviation: Kan, kanamycin; r, resistance.
97
TIANGEN This study This study Laboratory collection Laboratory collection Laboratory collection This study
Primers
Primer sequence (5′-3′)a
P1(cheY-UpF-BamHI)
CGGGATCCACCGCTTGTGCTGGCTACGGAGTACACGAT ACTTTGCAGGGCTTCCCAACCTTACTCAACCTCCAAATTC TAAAAG ACTCTGGGGTTCGAAATGACCGACCAAATACCAGTTTG CGTTTTCG CCCAAGCTTACCGCTTGTTTCTACACCTCCCAATTCCGT CGGGATCCATGCGTATTTTATTAATTGAAG CCCAAGCTTTTAAGCAACTTCATCGTTTTTTC GTAAGGTTGGGAAGCCCTGCAAAGT GGTCGGTCATTTCGAACCCCAGAGT GTGATGAGGAAGGGTGGTGT GGCTTCGTCACCCTCTGT
P2(cheY- UpR) P3(cheY-DownF) P4(cheY-DownR- HindIII) P5(cheY F–BamHI) P6(cheY R- HindIII) P7(Kan F) P8(Kan- R) P9(HPS-F) P10(HPS-R) a
Restriction sites are underlined.
bacterial cells were incubated by TSB at 37 °C with 220 rpm/min. An absorbance reading at 600 nm (A600) was taken and viable count every 1 h. Method of viable count: bacterial suspension samples diluted 10 times in a row, and selected three suitable dilutions, Taking 100 μL of each dilutions drops on TSA plates uniformly and spreadable. All experiments were performed in triplicate. These TSA plates were incubated at 37 °C for 24 h, then counted, averaged, and then drew the growth curve. 2.4. Biofilm formation assay Biofilm formation assay was performed as described previously (Kaplan and Mulks, 2005; Jin et al., 2006). Briefly, 10 μL bacterial culture into 1 mL TSB medium containing 5% inactivated bovine serum and 0.01% NAD, which was incubated at 37 °C with circular agitation (150 rpm/min) for 16 h. The content of tubes was removed with injector. Then each tube was stained with 2 mL of 1% Hucker crystal violet solution at room temperature for 5 min. The dyestuff was removed with injector and washed under tap water for 3–5 min. The tubes were dried at 37 °C for 1 h. 1 mL 33% (v/v) acetic acid was added into each tube. Finally, the optical density (OD) was measured at a wavelength of 630 nm. TSB without bacterial cultures was designed as a negative control in this experiment. All experiments were performed in triplicate. 2.5. Serum bactericidal assay (SBA) The serum bactericidal assay was performed as the previously described method (Zhang et al., 2012b). Porcine sera were collected from healthy piglets which were filtered by the filtration membrane of 0.22 μm. A part of the sera were treated at 56 °C for 30 min to inactivate the complement. 80 μL bacterial cultures (approximately 1 × 10 (Bearson et al., 2010) CFU/mL) were mixed with 20 μL fresh sera or heat-treated sera. The mixtures were incubated at 37 °C for 1 h with gentle agitation (130 rpm/min on a horizontal shaker), and subsequently were diluted with 10-fold serial and treated with TSA containing 5% inactivated bovine serum and 0.01% NAD. Then they were incubated at 37 °C for 24 h. The survival ratio was calculated by the following formula: CFU after 1 h of growth with fresh serum)/(CFU after 1 h of growth with heat-treated serum) × 100%. All experiments were performed in triplicate. 2.6. Autoagglutination assay The autoagglutinate ability was evaluated as follows. In short, bacterial cells were inoculated in 10 mL TSB with 5% inactivated bovine serum and 0.01% NAD, subsequently cultured at 37 °C with 220 rpm/min to an optical density at 600 nm (OD600) of ~0.7. Then, 1 mL bacterial cultures were added into colorimetric dish to remain static at room temperature. The absorbance of the suspensions was measured every 30 min for 8 h continuously.
98
L. He et al. / Gene 577 (2016) 96–100
3. Results 3.1. Construction of the H. parasuis cheY mutant The H. parasuis cheY mutant was constructed by using H. parasuis serovar 13 strain, EP3. As predicted, the primers (P7/P8) amplified a 935-bp fragment and the primers (P9, P10) amplified a 672-bp fragment in the cheY mutant, while the primers (P5, P6) amplified no suitable stripe in the mutant (Fig. 1). Additionally, the result of Western blot indicated that the expression of a protein about 28 kDa was absent in the cheY mutant strain compared with the wild-type strain EP3 (Fig. 2). The result confirmed that the cheY gene was deleted from the genome of strain EP3. 3.2. Growth characterization of the mutant and wild strains As Fig. 3 showed, compared with the wild-type strain, the growth curve of the H. parasuis cheY mutant in TSB broth containing 5% inactivated bovine serum and 0.01% NAD was significantly decreased. The absorbance reading at 600 nm (A600) in the 12 h of cheY mutant was 0.236, whereas the H. parasuis EP3 strain achieved 1.479 in this moment. The results showed that deletion of the cheY gene in H. parasuis EP3 strain led to a significant growth defect (Fig. 3). 3.3. Biofilm formation assay As shown in Fig.4A/B, less biofilm was observed in the cheY mutant than in the wild strain. Biofilm productions of EP3 strain and cheY mutant strain were detected by the absorbance (630 nm) of crystal violet solution. The values of the blank control group were −0.004 ± 0.001, the wild strain group were 0.638 ± 0.051, and the cheY mutants were 0.222 ± 0.096. The results revealed that the biofilm production of wild strain was apparently more than cheY mutant. The cheY mutant significantly weakens the ability to form biofilm. 3.4. Complement-mediated serum killing In order to determine whether cheY was involved in serum resistance, the serum bactericidal assay was performed (Fig. 5). The results showed that the cheY mutant showed slight sensitivity to serum. The survival rate of the cheY mutant in 20% serum was 68.45% which is less than the wild strain (72.01%). These results revealed that the cheY
Fig. 2. Western blotting analysis of the cheY mutant, wild strain and positive control (CheY protein). Lane M: protein molecular marker, Lane 1: cheY mutant, Lane 2: the wild strain, and Lane 3: positive control (CheY protein).
mutant had slightly reduced serum resistance compared with the wild strain, indicating cheY may have little association with serum resistance. 3.5. Autoagglutination phenotypes of the cheY mutant and the wild strain Autoagglutination, as a suspected symbolic indicator of virulence (Janda et al., 1987), was tested in this experiment as described in Materials and methods (Fig. 6). The absorbance reading at 600 nm (A600) of cheY mutant was 0.747 at 8 h, but the wild strain EP3 was 0.202 with an absorbance reading at 600 nm (A600). A lower absorbance reading at 600 nm (A600) was accompanied by a higher agglutination. The results showed that cheY mutant autoagglutinated apparently slower than wild strain. This discovery indicated that cheY was involved in bacterial autoagglutination. 4. Discussion and conclusion CheY is a response regulator of two-component signal transduction system (TCSTS), which plays an important role in bacterial motility, colonization, and formation of biofilm in E. coli. In order to investigate the biological functions of cheY gene in H. parasuis strain, we constructed the cheY deletion mutant by use of a clinically isolated strain EP3.
Fig. 1. PCR identification of the cheY mutant and the wild strain. Three pairs of primers (P5/ P6, P7/P8, P9/P10) were used to amplify the cheY gene, the kanamycin cassette, and the H. parasuis 16 s rRNA fragment, respectively. Lane 1: the cheY gene from the cheY mutant, Lane 2: the fusion segment (the 771-bp upstream homologous arm region, the kanamycin region, and the 925-bp down homologous arm region of cheY) was amplified from the cheY mutant with primer 1 and primer 4. Lane 3: the kanamycin cassette from the cheY mutant, Lane 4: the H. parasuis 16 s rRNA fragment from the cheY mutant, Lane5: the cheY gene from wild strain, Lane6: the segment (the 771-bp upstream homologous arm region, the cheY region, and the 925-bp down homologous arm region of cheY) was amplified from the wild strain with primer 1 and primer 4, Lane7: the kanamycin cassette from wild strain, and Lane8: the H. parasuis 16 s rRNA fragment from wild strain. Lane M shows a DNA molecular marker.
Fig. 3. Growth of wild-type H. Parasuis EP3 and the cheY mutant in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD.
L. He et al. / Gene 577 (2016) 96–100
Fig. 4. Biofilm formation of H. parasuis cheY mutant and the wild strain EP3. (A). Formed at the air–liquid interface of glass tubes and stained with crystal violet solution. Lane 1: EP31(the H. parasuis cheY mutant), Lane 2: Blank control (without bacteria), and Lane 3: the wild strain EP3. (B). Quantification of biofilm productions. Error bars represent the standard deviations of three independent experiments.
pLQ1 was introduced into the EP3 strains by natural transformation to get the H. parasuis cheY mutant. Due to the pk18mobsacB suicide plasmid was a kanamycin-resistant vector, which disturbed the selection by resistance. According to the results of previous experiments, other resistant recombinant plasmids except kanamycinresistant plasmid could not be introduced into strain EP3 by natural transformation. Based on the result of growth curves of the wild strain EP3 and cheY mutant strain, we found that the cheY played a crucial role in the growth of the H. parasuis strain. As Fig. 3 showed, the bacterial count of wild-
Fig. 5. Survival rate of H. parasuis strains treated with 20% porcine serum. The survival rate of the cheY mutant in 20% serum was 68.45%, less than wild-type strain (72.01%).
99
Fig. 6. Autoagglutination of the cheY mutant and the wild strain. (A). Photograph of the static suspensions after 8.5 h. Lane 1: the cheY mutant, Lane 2: the wild strain EP3, and Lane 3: Blank control. (B). Autoagglutination rates of the cheY mutant and the wild strain.
type H. Parasuis EP3 was 1.318 at 10 h with an absorbance reading at 600 nm (A600), however the cheY mutant was 0.089 in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD at this time. The results showed that the deletion of cheY significantly reduces the growth rate of Haemophilus parasuis EP3. Agglutination has been counted as a virulence-associated marker, which is responsible for pathogenesis. As Fig. 6 showed, compared with the wild strain, the autoagglutination rate of the cheY mutant was clearly reduced. The results revealed that the absorbance at 600 nm of cheY mutant strain was 0.205 declined compared with an absorbance reading at 600 nm (A600) of the bacterial suspension of wild strain EP3 reduced 0.622 after 8.5 h. The results indicated that cheY may play an important role in H.parasuis virulence. As the previous study revealed (Cerda-Cuellar and Aragon, 2008), serum-resistance was a mechanism of the virulence of H. parasuis strain, which seemed to be composed by non-virulent strains, but noninvasive strains, virulent and invasive strains. Serum-resistance may play an important role in the virulence of H. parasuis. The study of serum killing of wild strain EP3 and cheY mutant was performed using 20% porcine serum. The results indicated that cheY mutant was slightly sensitive to porcine serum, demonstrating a 68.97% survival rate. Nevertheless wild strain EP3 was a similar serum resistant, exhibiting a 71.51% survival rate. Thus, deletion of cheY from wild strain EP3 did not result in a significant serum-resistant defect. Biofilms formation in vivo was concerned with weaker invasiveness and restrained cytokine response (Blanchette-Cain et al., 2013). So high-biofilm production phenotype might not always be linked to bacterial virulence. Biofilms play a key role in causing persistent infections (Costerton et al., 1999), which helped the bacteria evade from the host immune system. As shown in this study, absorbance reading at 630 nm (A600) of cheY mutant was about 0.416 decreased compared with the wild strain EP3. The experimental results showed that the ability of cheY mutant to form biofilms was weaker than the wild-type strain. So cheY may play a role in biofilms formation.
100
L. He et al. / Gene 577 (2016) 96–100
Overall, in this study we successfully constructed the H. parasuis cheY mutant named EP3-1. Through these studies of the biological characteristics in the cheY mutant and wild strain EP3, we got a preliminary understanding of the function of cheY gene. The results indicated that the cheY gene played an extremely important role in growth rate, biofilms formation and autoagglutination of H. parasuis strain. We found that the cheY mutant strain has significantly reduced the growth rate, less biofilms formed, and obviously slower agglutination compared with the wild strain EP3. What showed the cheY may play a crucial role in growth, virulence and colonization in vivo of H. parasuis. But we didn't observe apparent differences of serum-resistance between the wild strain EP3 and cheY mutant strain. Further studies are needed to determine the role of cheY gene in regulating the expression of specific genes under the transmembrane protein QseC, which owns histidine protein kinase activity to accept extracellular stimulating signal. Acknowledgments This work was supported by the Haemophflussuis and Porcine Contagious Pleuropneumonia Prevention Technology Research and Demonstration Project (201303034), which was financed by public service sector (Agriculture) research project special funds. References Bearson, B.L., Bearson, S.M., Lee, I.S., Brunelle, B.W., 2010. The Salmonella enterica serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase. Microb. Pathog. 48 (6), 214–219. Beier, D., Gross, R., 2006. Regulation of bacterial virulence by two-component systems. Curr. Opin. Microbiol. 9 (2), 143–152. Blanchette-Cain, K., Hinojosa, C.A., Akula Suresh Babu, R., Lizcano, A., Gonzalez-Juarbe, N., Munoz-Almagro, C., Sanchez, C.J., Bergman, M.A., Orihuela, C.J., 2013. Streptococcus pneumoniae biofilm formation is strain dependent, multifactorial, and associated
with reduced invasiveness and immunoreactivity during colonization. MBio 4 (5) e00745 – 13. Cai, X., Chen, H., Blackall, P.J., Yin, Z., Wang, L., Liu, Z., Jin, M., 2005. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 111 (3–4), 231–236. Cerda-Cuellar, M., Aragon, V., 2008. Serum-resistance in Haemophilus parasuis is associated with systemic disease in swine. Vet. J 175 (3), 384–389. Costerton, J.W., Stewart, P.S., Greenberg, E.P., 1999. Bacterial biofilms: a common cause of persistent infections. Science 284 (5418), 1318–1322. del Río, M.L., Navas, J., Martín, A.J., Gutiérrez, C.B., Rodríguez-Barbosa, J.I., Rodríguez Ferri, E.F., 2006. Molecular characterization of Haemophilus parasuis erric hydroxamate uptake (fhu) genes and constitutive xpression of the FhuA receptor. Vet. Res. 37 (1), 49–59. Janda, J.M., Oshiro, L.S., Abbott, S.L., Duffey, P.S., 1987. Virulence markers of mesophilic aeromonads: association of the autoagglutination phenomenon with mouse pathogenicity and the presence of a peripheral cell-associated layer. Infect. Immun. 55 (12), 3070–3077. Jin, H., Zhou, R., Kang, M., Luo, R., Cai, X., Chen, H., 2006. Biofilm formation by field isolates and reference strains of Haemophilus parasuis. Vet. Microbiol. 118 (1–2), 117–123. Kaplan, J.B., Mulks, M.H., 2005. Biofilm formation is prevalent among field isolates of Actinobacillus pleuropneumoniae. Vet. Microbiol. 108 (1–2), 89–94. Liu, Q., Gong, Y., Cao, Y., Wen, X., Huang, X., Yan, Q., Huang, Y., Cao, S., 2013. Construction and immunogenicity of a ΔapxIC/ompP2 mutant of Actinobacillus pleuropneumoniae and Haemophilus parasuis. Vet. Res. 80 (1), 519–524. Stock, A.M., Robinson, V.L., Goudreau, P.N., 2000. Two-component signal transduction. Annu. Rev. Biochem. 69, 183–215. Unal, C.M., Singh, B., Fleury, C., Singh, K., Chávez de Paz, L., Svensäter, G., Riesbeck, K., 2012. QseC controls biofilm formation of non-typeable Haemophilus influenzae in addition to an AI-2-dependent mechanism. Int. J. Med. Microbiol. 302 (6), 261–269. Wood, T.K., González Barrios, A.F., Herzberg, M., Lee, J., 2006. Motility influences biofilm architecture in Escherichia coli. Appl. Microbiol. Biotechnol. 72 (2), 361–367. Zhang, B., Feng, S., Xu, C., Zhou, S., He, Y., Zhang, L., Zhang, J., Guo, L., Liao, M., 2012a. Serum resistance in Haemophilus parasuis SC096 strain requires outer membrane protein P2 expression. FEMS Microbiol. Lett. 326 (2), 109–115. Zhang, B., He, Y., Xu, C., Xu, L., Feng, S., Liao, M., Ren, T., 2012b. Cytolethal distending toxin (CDT) of the Haemophilus parasuis SC096 strain contributes to serum resistance and adherence to and invasion of PK-15 and PUVEC cells. Vet. Microbiol. 157 (1–2), 237–242. Zou, Y., Feng, S., Xu, C., Zhang, B., Zhou, S., Zhang, L., He, X., Li, J., Yang, Z., Liao, M., 2013. The role of galU and galE of Haemophilus parasuis SC096 in serum resistance and biofilm formation. Vet. Microbiol. 162 (1), 278–284.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Effect of cheY deletion on growth and colonization in a Haemophilus parasuis serovar 13 clinical strain EP3 Lvqin He, Xintian Wen, Xuefeng Yan, Lingqiang Ding, Sanjie Cao, Xiaobo Huang, Rui Wu, Yiping Wen ⁎ Research Center of Swine Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
a r t i c l e
i n f o
Article history: Received 13 July 2015 Received in revised form 4 November 2015 Accepted 20 November 2015 Available online 2 December 2015 Keywords: Haemophilus parasuis cheY Serum resistance Biofilm formation Autoagglutination
a b s t r a c t CheY, a response regulator of controlling the bacterial chemotactic swimming, can be modulated by either phosphorylation or acetylation to generate clockwise rotation of the flagella. Here, we researched the biological characteristics of cheY deletion mutant in Haemophilus parasuis, and found that the growth rate of this mutant was significantly slower compared with serovar 13 wild strain EP3. Additionally, the cheY mutant didn't show obvious sensitivity to porcine sera. The results of biofilm formation assay showed that H. parasuis cheY mutant produced less biofilm mass compared with wild strain. The H. parasuis cheY mutant reduced autoagglutination obviously. These findings were vital for revealing the function of cheY in growth, biofilm formation and autoagglutination. Thus, cheY plays a crucial role in growth and colonization in vivo of H. parasuis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Haemophilus parasuis, the etiological agent of Glässer's disease, is a non-motile, nicotinamide denine inucleotide (NAD)-dependent, and small Gram-negative rhabditiform of the family Pasteurellaceae (del Río et al., 2006). Glässer's disease, causing serious financial losses on a global scale, is characterized by fibrinous polyserositis, polyarthritis and meningitis (Cai et al., 2005). Currently, this disease has become one of the major causes of nursery mortality in swine herds (Zou et al., 2013). Pathogenic bacteria have a variety of signal system to continuously monitor external environment to adjust its structure and physiological behavior, which make them adapt to the new environment and colonization. Two-component signal transduction system (TCSTS) plays a major role in the process of a variety of biological processes (Beier and Gross, 2006). The TCSTS consists of a histidine protein kinase (HK) which contains a conserved kinase core, and a response regulator protein (RR) which contains a conserved
Abbreviations: NAD, nicotinamide-adenine dinucleotide; PA, polyacrylamide; PAGE, PA-gel electrophoresis; rRNA, ribosomal RNA; SDS, sodium dodecyl sulfate; kDa, kilodalton(s); Kan, kanamycin; ORF, open reading frame. ⁎ Corresponding author. E-mail addresses: [email protected] (L. He), [email protected] (X. Wen), [email protected] (X. Yan), [email protected] (L. Ding), [email protected] (S. Cao), [email protected] (X. Huang), [email protected] (R. Wu), [email protected] (Y. Wen).
http://dx.doi.org/10.1016/j.gene.2015.11.046 0378-1119/© 2015 Elsevier B.V. All rights reserved.
regulatory domain. When the bacteria sense the extracellular stimulant by HK, the HK carries out phosphorylation, and subsequently transfers the phosphoryl group to the RR. The RR with phosphoryl group results in activation of a downstream effector domain that elicits the specific response to regulate the gene expression or make the target protein occur adaptive changes (Stock et al., 2000). cheY/qseC is one of the TCSTS in H. parasuis. CheY belongs to cytoplasmic response regulatory proteins, which regulate the expression of specific genes. QseC is a transmembrane protein with histidine protein kinase activity to accept an extracellular stimulating signal. cheY/qseC is mainly associated with bacterial population density, the formation of biofilm, bacterial mobility and colonization. qseB/ qseC, with cheY/qseC homology, is the TCSTS in Haemophilus influence, Escherichia coli and Salmonella enterica. QseB/QseC is involved in the biofilm formation of Non-typeable Haemophilus influenzae in vitro (Unal et al., 2012). qseB mutant has poor biofilms, which results in the cell displaying poor adhesion and motility in Escherichia coli (Wood et al., 2006). In Salmonella enterica, QseB is classified as a negative regulator of bacterial motility and swine colonization (Bearson et al., 2010). To date, there is no relative report about cheY/qseC system in H. parasuis. In this study, we investigated the biological characteristics of H. parasuis cheY mutant strain, including growth characteristics, serum resistance, biofilm formation and autoagglutination, aiming to preliminary understand the correlation of cheY gene and the virulence of H. parasuis, and provide some data for the further study in TCSTS. This is the first report that relates the growth, virulence and colonization about cheY gene in H.parasuis.
L. He et al. / Gene 577 (2016) 96–100
2. Materials and methods
Table 2 Sequences of PCR oligonucleotide primers.
2.1. Bacterial strains and growth conditions A field isolate of H. parasuis serovar 13 strain, EP3, isolated from Sichuan, China and recombinant plasmids is listed in Table 1. Bacteria were routinely cultured on Tryptic Soy Broth (TSB, Difco, Detroit, USA) or Tryptic Soy Agar (TSA, Difco, Detroit, USA) at 37 °C, containing 5% inactivated bovine serum and 0.01% nicotinamide adenine dinucleotide (NAD, Sigma Aldrich, Missouri, USA). E. coli DH5α was cultured in Luria–Bertani medium at 37 °C. If necessary, 50 mg/mL of kanamycin or 100 mg/mL of ampicillin was complemented. The vector pK18mobsacB was utilized for constructing the vector of the homologous recombination. The antisera against H. parasuis EP3 and H. parasuis EP3-1 were prepared by using five to six weeks old pathogen-free KM mice were obtained from Chengdu Dossy Experimental Animals Company, Ltd. 2.2. Construction of H. parasuis cheY mutant Primers used for amplification (Table 2) in this study were ordered from the Invitrogen (Shanghai, China). The 771-bp upstream homologous arm region and the 925-bp down homologous arm region of cheY were amplified using primers P1/P2 and P3/P4 from the genome of EP3, respectively. A kanamycin resistant (kanR) cassette was amplified from pKD4 using primer pairs P5/P6. These three PCR fragments were integrated by overlap PCR with primer pairs P1 and P4. Then the fusion segment was digested by BamHI and HindIII, and subsequently cloned into pK18mobsacB which was also digested by BamHI and HindIII to construct pLQ1. Both two DNA fragments (upstream homologous arm and down homologous arm) included a 9-bp core DNA uptake signal sequence (USS) of 5′- ACCGCTTGT -3′ (Zhang et al., 2012a). Eventually, the plasmid was mobilized into EP3 by natural transformations. 2.3. Genetic stability and distinct growth defect in the H. parasuis cheY mutant The H. parasuis cheY mutant was cultured and passaged for 10 times continuously in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD (Liu et al., 2013). The corresponding fragments were amplified by PCR to identify the genetic stability of each generation of the mutant strain. The Single colonies of H. parasuis cheY mutant and the wild-type strain EP3 were picked respectively and inoculated in TSB medium supplemented with 5% inactivated bovine serum and 0.01% NAD with shaking 12 h. The next day, the bacterial suspension were inoculated into the new TSB medium supplemented with 5% inactivated bovine serum and 0.01% NAD at a dilution of 1:100. The
Table 1 Bacterial strains and plasmids. Bacterial strain/plasmid
Relevant characteristic(s)a
Source
E. coli DH5a
F ф80ΔlacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 F ompT hsdS (rBB-mB−) gal dcm (DE3) Haemophilus parasuis, wild type, serovar 13 clinical isolate EP3 cheY mutant (△cheY); Kanr Expression vector, Kanr Kanr, suicide and narrow-broad-host vector Ampr, Kanr, gene knock-out vector A 1696-bp PCR fragment containing Kanr, the upstream and downstream sequences of the cheY gene in pK18mobsacB, Kanr
TIANGEN
E. coli BL21 EP3 EP3-1 PET-28a pK18mobsacB pKD4 pLQ1
a
Abbreviation: Kan, kanamycin; r, resistance.
97
TIANGEN This study This study Laboratory collection Laboratory collection Laboratory collection This study
Primers
Primer sequence (5′-3′)a
P1(cheY-UpF-BamHI)
CGGGATCCACCGCTTGTGCTGGCTACGGAGTACACGAT ACTTTGCAGGGCTTCCCAACCTTACTCAACCTCCAAATTC TAAAAG ACTCTGGGGTTCGAAATGACCGACCAAATACCAGTTTG CGTTTTCG CCCAAGCTTACCGCTTGTTTCTACACCTCCCAATTCCGT CGGGATCCATGCGTATTTTATTAATTGAAG CCCAAGCTTTTAAGCAACTTCATCGTTTTTTC GTAAGGTTGGGAAGCCCTGCAAAGT GGTCGGTCATTTCGAACCCCAGAGT GTGATGAGGAAGGGTGGTGT GGCTTCGTCACCCTCTGT
P2(cheY- UpR) P3(cheY-DownF) P4(cheY-DownR- HindIII) P5(cheY F–BamHI) P6(cheY R- HindIII) P7(Kan F) P8(Kan- R) P9(HPS-F) P10(HPS-R) a
Restriction sites are underlined.
bacterial cells were incubated by TSB at 37 °C with 220 rpm/min. An absorbance reading at 600 nm (A600) was taken and viable count every 1 h. Method of viable count: bacterial suspension samples diluted 10 times in a row, and selected three suitable dilutions, Taking 100 μL of each dilutions drops on TSA plates uniformly and spreadable. All experiments were performed in triplicate. These TSA plates were incubated at 37 °C for 24 h, then counted, averaged, and then drew the growth curve. 2.4. Biofilm formation assay Biofilm formation assay was performed as described previously (Kaplan and Mulks, 2005; Jin et al., 2006). Briefly, 10 μL bacterial culture into 1 mL TSB medium containing 5% inactivated bovine serum and 0.01% NAD, which was incubated at 37 °C with circular agitation (150 rpm/min) for 16 h. The content of tubes was removed with injector. Then each tube was stained with 2 mL of 1% Hucker crystal violet solution at room temperature for 5 min. The dyestuff was removed with injector and washed under tap water for 3–5 min. The tubes were dried at 37 °C for 1 h. 1 mL 33% (v/v) acetic acid was added into each tube. Finally, the optical density (OD) was measured at a wavelength of 630 nm. TSB without bacterial cultures was designed as a negative control in this experiment. All experiments were performed in triplicate. 2.5. Serum bactericidal assay (SBA) The serum bactericidal assay was performed as the previously described method (Zhang et al., 2012b). Porcine sera were collected from healthy piglets which were filtered by the filtration membrane of 0.22 μm. A part of the sera were treated at 56 °C for 30 min to inactivate the complement. 80 μL bacterial cultures (approximately 1 × 10 (Bearson et al., 2010) CFU/mL) were mixed with 20 μL fresh sera or heat-treated sera. The mixtures were incubated at 37 °C for 1 h with gentle agitation (130 rpm/min on a horizontal shaker), and subsequently were diluted with 10-fold serial and treated with TSA containing 5% inactivated bovine serum and 0.01% NAD. Then they were incubated at 37 °C for 24 h. The survival ratio was calculated by the following formula: CFU after 1 h of growth with fresh serum)/(CFU after 1 h of growth with heat-treated serum) × 100%. All experiments were performed in triplicate. 2.6. Autoagglutination assay The autoagglutinate ability was evaluated as follows. In short, bacterial cells were inoculated in 10 mL TSB with 5% inactivated bovine serum and 0.01% NAD, subsequently cultured at 37 °C with 220 rpm/min to an optical density at 600 nm (OD600) of ~0.7. Then, 1 mL bacterial cultures were added into colorimetric dish to remain static at room temperature. The absorbance of the suspensions was measured every 30 min for 8 h continuously.
98
L. He et al. / Gene 577 (2016) 96–100
3. Results 3.1. Construction of the H. parasuis cheY mutant The H. parasuis cheY mutant was constructed by using H. parasuis serovar 13 strain, EP3. As predicted, the primers (P7/P8) amplified a 935-bp fragment and the primers (P9, P10) amplified a 672-bp fragment in the cheY mutant, while the primers (P5, P6) amplified no suitable stripe in the mutant (Fig. 1). Additionally, the result of Western blot indicated that the expression of a protein about 28 kDa was absent in the cheY mutant strain compared with the wild-type strain EP3 (Fig. 2). The result confirmed that the cheY gene was deleted from the genome of strain EP3. 3.2. Growth characterization of the mutant and wild strains As Fig. 3 showed, compared with the wild-type strain, the growth curve of the H. parasuis cheY mutant in TSB broth containing 5% inactivated bovine serum and 0.01% NAD was significantly decreased. The absorbance reading at 600 nm (A600) in the 12 h of cheY mutant was 0.236, whereas the H. parasuis EP3 strain achieved 1.479 in this moment. The results showed that deletion of the cheY gene in H. parasuis EP3 strain led to a significant growth defect (Fig. 3). 3.3. Biofilm formation assay As shown in Fig.4A/B, less biofilm was observed in the cheY mutant than in the wild strain. Biofilm productions of EP3 strain and cheY mutant strain were detected by the absorbance (630 nm) of crystal violet solution. The values of the blank control group were −0.004 ± 0.001, the wild strain group were 0.638 ± 0.051, and the cheY mutants were 0.222 ± 0.096. The results revealed that the biofilm production of wild strain was apparently more than cheY mutant. The cheY mutant significantly weakens the ability to form biofilm. 3.4. Complement-mediated serum killing In order to determine whether cheY was involved in serum resistance, the serum bactericidal assay was performed (Fig. 5). The results showed that the cheY mutant showed slight sensitivity to serum. The survival rate of the cheY mutant in 20% serum was 68.45% which is less than the wild strain (72.01%). These results revealed that the cheY
Fig. 2. Western blotting analysis of the cheY mutant, wild strain and positive control (CheY protein). Lane M: protein molecular marker, Lane 1: cheY mutant, Lane 2: the wild strain, and Lane 3: positive control (CheY protein).
mutant had slightly reduced serum resistance compared with the wild strain, indicating cheY may have little association with serum resistance. 3.5. Autoagglutination phenotypes of the cheY mutant and the wild strain Autoagglutination, as a suspected symbolic indicator of virulence (Janda et al., 1987), was tested in this experiment as described in Materials and methods (Fig. 6). The absorbance reading at 600 nm (A600) of cheY mutant was 0.747 at 8 h, but the wild strain EP3 was 0.202 with an absorbance reading at 600 nm (A600). A lower absorbance reading at 600 nm (A600) was accompanied by a higher agglutination. The results showed that cheY mutant autoagglutinated apparently slower than wild strain. This discovery indicated that cheY was involved in bacterial autoagglutination. 4. Discussion and conclusion CheY is a response regulator of two-component signal transduction system (TCSTS), which plays an important role in bacterial motility, colonization, and formation of biofilm in E. coli. In order to investigate the biological functions of cheY gene in H. parasuis strain, we constructed the cheY deletion mutant by use of a clinically isolated strain EP3.
Fig. 1. PCR identification of the cheY mutant and the wild strain. Three pairs of primers (P5/ P6, P7/P8, P9/P10) were used to amplify the cheY gene, the kanamycin cassette, and the H. parasuis 16 s rRNA fragment, respectively. Lane 1: the cheY gene from the cheY mutant, Lane 2: the fusion segment (the 771-bp upstream homologous arm region, the kanamycin region, and the 925-bp down homologous arm region of cheY) was amplified from the cheY mutant with primer 1 and primer 4. Lane 3: the kanamycin cassette from the cheY mutant, Lane 4: the H. parasuis 16 s rRNA fragment from the cheY mutant, Lane5: the cheY gene from wild strain, Lane6: the segment (the 771-bp upstream homologous arm region, the cheY region, and the 925-bp down homologous arm region of cheY) was amplified from the wild strain with primer 1 and primer 4, Lane7: the kanamycin cassette from wild strain, and Lane8: the H. parasuis 16 s rRNA fragment from wild strain. Lane M shows a DNA molecular marker.
Fig. 3. Growth of wild-type H. Parasuis EP3 and the cheY mutant in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD.
L. He et al. / Gene 577 (2016) 96–100
Fig. 4. Biofilm formation of H. parasuis cheY mutant and the wild strain EP3. (A). Formed at the air–liquid interface of glass tubes and stained with crystal violet solution. Lane 1: EP31(the H. parasuis cheY mutant), Lane 2: Blank control (without bacteria), and Lane 3: the wild strain EP3. (B). Quantification of biofilm productions. Error bars represent the standard deviations of three independent experiments.
pLQ1 was introduced into the EP3 strains by natural transformation to get the H. parasuis cheY mutant. Due to the pk18mobsacB suicide plasmid was a kanamycin-resistant vector, which disturbed the selection by resistance. According to the results of previous experiments, other resistant recombinant plasmids except kanamycinresistant plasmid could not be introduced into strain EP3 by natural transformation. Based on the result of growth curves of the wild strain EP3 and cheY mutant strain, we found that the cheY played a crucial role in the growth of the H. parasuis strain. As Fig. 3 showed, the bacterial count of wild-
Fig. 5. Survival rate of H. parasuis strains treated with 20% porcine serum. The survival rate of the cheY mutant in 20% serum was 68.45%, less than wild-type strain (72.01%).
99
Fig. 6. Autoagglutination of the cheY mutant and the wild strain. (A). Photograph of the static suspensions after 8.5 h. Lane 1: the cheY mutant, Lane 2: the wild strain EP3, and Lane 3: Blank control. (B). Autoagglutination rates of the cheY mutant and the wild strain.
type H. Parasuis EP3 was 1.318 at 10 h with an absorbance reading at 600 nm (A600), however the cheY mutant was 0.089 in TSB supplemented with 5% inactivated bovine serum and 0.01% NAD at this time. The results showed that the deletion of cheY significantly reduces the growth rate of Haemophilus parasuis EP3. Agglutination has been counted as a virulence-associated marker, which is responsible for pathogenesis. As Fig. 6 showed, compared with the wild strain, the autoagglutination rate of the cheY mutant was clearly reduced. The results revealed that the absorbance at 600 nm of cheY mutant strain was 0.205 declined compared with an absorbance reading at 600 nm (A600) of the bacterial suspension of wild strain EP3 reduced 0.622 after 8.5 h. The results indicated that cheY may play an important role in H.parasuis virulence. As the previous study revealed (Cerda-Cuellar and Aragon, 2008), serum-resistance was a mechanism of the virulence of H. parasuis strain, which seemed to be composed by non-virulent strains, but noninvasive strains, virulent and invasive strains. Serum-resistance may play an important role in the virulence of H. parasuis. The study of serum killing of wild strain EP3 and cheY mutant was performed using 20% porcine serum. The results indicated that cheY mutant was slightly sensitive to porcine serum, demonstrating a 68.97% survival rate. Nevertheless wild strain EP3 was a similar serum resistant, exhibiting a 71.51% survival rate. Thus, deletion of cheY from wild strain EP3 did not result in a significant serum-resistant defect. Biofilms formation in vivo was concerned with weaker invasiveness and restrained cytokine response (Blanchette-Cain et al., 2013). So high-biofilm production phenotype might not always be linked to bacterial virulence. Biofilms play a key role in causing persistent infections (Costerton et al., 1999), which helped the bacteria evade from the host immune system. As shown in this study, absorbance reading at 630 nm (A600) of cheY mutant was about 0.416 decreased compared with the wild strain EP3. The experimental results showed that the ability of cheY mutant to form biofilms was weaker than the wild-type strain. So cheY may play a role in biofilms formation.
100
L. He et al. / Gene 577 (2016) 96–100
Overall, in this study we successfully constructed the H. parasuis cheY mutant named EP3-1. Through these studies of the biological characteristics in the cheY mutant and wild strain EP3, we got a preliminary understanding of the function of cheY gene. The results indicated that the cheY gene played an extremely important role in growth rate, biofilms formation and autoagglutination of H. parasuis strain. We found that the cheY mutant strain has significantly reduced the growth rate, less biofilms formed, and obviously slower agglutination compared with the wild strain EP3. What showed the cheY may play a crucial role in growth, virulence and colonization in vivo of H. parasuis. But we didn't observe apparent differences of serum-resistance between the wild strain EP3 and cheY mutant strain. Further studies are needed to determine the role of cheY gene in regulating the expression of specific genes under the transmembrane protein QseC, which owns histidine protein kinase activity to accept extracellular stimulating signal. Acknowledgments This work was supported by the Haemophflussuis and Porcine Contagious Pleuropneumonia Prevention Technology Research and Demonstration Project (201303034), which was financed by public service sector (Agriculture) research project special funds. References Bearson, B.L., Bearson, S.M., Lee, I.S., Brunelle, B.W., 2010. The Salmonella enterica serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase. Microb. Pathog. 48 (6), 214–219. Beier, D., Gross, R., 2006. Regulation of bacterial virulence by two-component systems. Curr. Opin. Microbiol. 9 (2), 143–152. Blanchette-Cain, K., Hinojosa, C.A., Akula Suresh Babu, R., Lizcano, A., Gonzalez-Juarbe, N., Munoz-Almagro, C., Sanchez, C.J., Bergman, M.A., Orihuela, C.J., 2013. Streptococcus pneumoniae biofilm formation is strain dependent, multifactorial, and associated
with reduced invasiveness and immunoreactivity during colonization. MBio 4 (5) e00745 – 13. Cai, X., Chen, H., Blackall, P.J., Yin, Z., Wang, L., Liu, Z., Jin, M., 2005. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 111 (3–4), 231–236. Cerda-Cuellar, M., Aragon, V., 2008. Serum-resistance in Haemophilus parasuis is associated with systemic disease in swine. Vet. J 175 (3), 384–389. Costerton, J.W., Stewart, P.S., Greenberg, E.P., 1999. Bacterial biofilms: a common cause of persistent infections. Science 284 (5418), 1318–1322. del Río, M.L., Navas, J., Martín, A.J., Gutiérrez, C.B., Rodríguez-Barbosa, J.I., Rodríguez Ferri, E.F., 2006. Molecular characterization of Haemophilus parasuis erric hydroxamate uptake (fhu) genes and constitutive xpression of the FhuA receptor. Vet. Res. 37 (1), 49–59. Janda, J.M., Oshiro, L.S., Abbott, S.L., Duffey, P.S., 1987. Virulence markers of mesophilic aeromonads: association of the autoagglutination phenomenon with mouse pathogenicity and the presence of a peripheral cell-associated layer. Infect. Immun. 55 (12), 3070–3077. Jin, H., Zhou, R., Kang, M., Luo, R., Cai, X., Chen, H., 2006. Biofilm formation by field isolates and reference strains of Haemophilus parasuis. Vet. Microbiol. 118 (1–2), 117–123. Kaplan, J.B., Mulks, M.H., 2005. Biofilm formation is prevalent among field isolates of Actinobacillus pleuropneumoniae. Vet. Microbiol. 108 (1–2), 89–94. Liu, Q., Gong, Y., Cao, Y., Wen, X., Huang, X., Yan, Q., Huang, Y., Cao, S., 2013. Construction and immunogenicity of a ΔapxIC/ompP2 mutant of Actinobacillus pleuropneumoniae and Haemophilus parasuis. Vet. Res. 80 (1), 519–524. Stock, A.M., Robinson, V.L., Goudreau, P.N., 2000. Two-component signal transduction. Annu. Rev. Biochem. 69, 183–215. Unal, C.M., Singh, B., Fleury, C., Singh, K., Chávez de Paz, L., Svensäter, G., Riesbeck, K., 2012. QseC controls biofilm formation of non-typeable Haemophilus influenzae in addition to an AI-2-dependent mechanism. Int. J. Med. Microbiol. 302 (6), 261–269. Wood, T.K., González Barrios, A.F., Herzberg, M., Lee, J., 2006. Motility influences biofilm architecture in Escherichia coli. Appl. Microbiol. Biotechnol. 72 (2), 361–367. Zhang, B., Feng, S., Xu, C., Zhou, S., He, Y., Zhang, L., Zhang, J., Guo, L., Liao, M., 2012a. Serum resistance in Haemophilus parasuis SC096 strain requires outer membrane protein P2 expression. FEMS Microbiol. Lett. 326 (2), 109–115. Zhang, B., He, Y., Xu, C., Xu, L., Feng, S., Liao, M., Ren, T., 2012b. Cytolethal distending toxin (CDT) of the Haemophilus parasuis SC096 strain contributes to serum resistance and adherence to and invasion of PK-15 and PUVEC cells. Vet. Microbiol. 157 (1–2), 237–242. Zou, Y., Feng, S., Xu, C., Zhang, B., Zhou, S., Zhang, L., He, X., Li, J., Yang, Z., Liao, M., 2013. The role of galU and galE of Haemophilus parasuis SC096 in serum resistance and biofilm formation. Vet. Microbiol. 162 (1), 278–284.