- Email: [email protected]
Effect of chitooligosaccharide on neuronal differentiation of PC-12 cells
Cell Biology International 33 (2009) 352e356 www.elsevier.com/locate/cellbi
Effect of chitooligosaccharide on neuronal differentiation of PC-12 cells Yumin Yang1, Mei Liu1, Yun Gu, Sheyu Lin, Fei Ding, Xiaosong Gu* Jiangsu Key Laboratory of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong City, Jiangsu 226001, PR China Received 10 June 2008; revised 17 November 2008; accepted 9 January 2009
Abstract Chitosan is now being widely used biomaterial in the tissue engineering field, and has great potential as a candidate material for preparing nerve guidance conduits due to its various favorable properties, especially that of good nerve cell affinity. Chitosan can be degraded in vivo into chitooligosaccharide. We have investigated the in vitro effects of chitooligosaccharide on neuronal differentiation of PC-12 cells to see what effects chitooligosaccharide have on certain functions in the regenerating neurons. The morphologic observation and assessment using the specific reagent of tetrazolium salt WST-8 indicated that neurite outgrowths from PC-12 cells and the viability of PC-12 cells were enhanced by treatment of chitooligosaccharide. The real-time quantitative RT-PCR and Western blot analysis revealed showed that chitooligosaccharide could upregulate the expression of neurofilament-H mRNA or protein and N-cadherin protein in PC-12 cells. The maximum effect of 0.1 mg/ml chitooligosaccharide was obtained after 2 week culture. All the data suggest that chitooligosaccharide possesses good nerve cell affinity by supporting nerve cell adhesion and promoting neuronal differentiation and neurite outgrowth. Ó 2009 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. Keywords: Chitosan; Chitooligosaccharide; Nerve cell affinity; Neuronal differentiation; PC-12 cells
1. Introduction Chitosan is made up of D-glucosamine units linked by b (1e4) glycosidic bonds and is derived from deacetylation of chitin, the main component of the exoskeleton of crustaceans. It has a number of biomedical applications, including those in tissue engineering, due to its various favorable properties; especially its specific interactions with the extra cellular matrix and growth factors (Freier et al., 2005; Zheng et al., 2007). Many studies on peripheral nerve regeneration have also reported that chitosan-based nerve guidance conduits were used to bridge an extended nerve gap with considerable success because the conduit not only acted as a supporting scaffold to guide axonal growth, but also enhanced both the survival and neurite outgrowth of neurons
* Corresponding author. Tel.: þ86 513 85051818; fax: þ86 513 85511585. E-mail address: [email protected] (X. Gu). 1 Contributed equally to this work.
(Wang et al., 2005; Christina et al., 2006; Isamu et al., 2003; Gianluca and Valeria, 2006; Bini et al., 2005; Yannas and Hill, 2004). Chitosan is degraded in vivo by an enzymatic hydrolysis of lysozyme normally produced by macrophages (Ohara et al., 2004). The biodegradation products of chitosan are (low MW) chitooligosaccharides with different polymerization degrees (from 2 to 10) (Mendis et al., 2007). After implantation of chitosan conduits, undegraded chitosan and chitooligosaccharide produced from degraded chitosan are likely to coexist around the regenerating neurons for a considerable period of time. Despite previous reports that chitosan material exhibited nerve cell affinity in vitro (Yuan et al., 2004; Yang et al., 2004; Freier et al., 2005; Gong et al., 2000), the issue of whether chitooligosaccharides, also affect certain functions in the regenerating neurons is worth exploring. Therefore we have chosen rat pheochromocytoma PC-12 cells to examine the neurobiological changes induced by chitooligosaccharide under in vitro conditions.
1065-6995/$ - see front matter Ó 2009 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.cellbi.2009.01.005
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
2. Materials and methods 2.1. Preparation and purification of chitooligosaccharide Chitosan, obtained from Nantong Xincheng Biochemical Company (Jiangsu, China), was refined twice by dissolving it in 10 g/L acetic acid solution. It was filtered, precipitated with 50 g/L NaOH, and finally dried in a vacuum at room temperature. Its degree of deacetylation was 92.3% according to titration analysis and its average MW was 2.5 105 according to viscosity measurements (Jia and Shen, 2002). Crude chitooligosaccharide prepared by our previously reported method (Shao et al., 2003), was dissolved in a minimum volume of distilled water, and partially purified on a Sephadex-25 column (column size: 1.6 85 cm bed volume). The sample was placed on the column top and eluted with distilled water. The eluted chitooligosaccharide solution was lyophilised under vacuum (35e45 mTorr) to obtain chitooligosaccharide powder. Its number average MW was determined by end-group analysis (Yang et al., 2006). The MW value showed that the chitooligosaccharide preparation was a mixture with variable molecular length, with an average polymerization of w7.
353
20 -deoxyuridine) labeling solution (Cell Proliferation ELISA BrdU, Colorimetric, Roche, Nutley, NJ, USA) was added to each well, plates were then incubated for 3 h. The cellular DNA was denatured, and Anti-BrdU-POD bound to the BrdU incorporated in newly synthesized DNA of proliferating cells. The immune complexes were detected by the subsequent peroxidase-substrate reactions. Absorbance at 450 nm was measured with a microplate reader (ELx800), and was expressed as a percentage of the value obtained relative to normalised control cells. 2.5. Real-time quantitative RT-PCR Gene specific primers and probes were designed according to the whole sequences of NF-H (GeneBank No. NM_012607.1) and GAPDH (as an internal control, GeneBank No. BC059110.1), respectively (Table 1). The details for preparing standard plasmid and real-time PCR have previously been described (Liu et al., 2006). Briefly, the PC-12 cells were collected in Trizol reagent (Invitrogen, Carlsbad, CA, USA), and total RNA was extracted and reverse transcriptized (Omniscript RT kit from Qiagen). The mRNA quantity of NF-H or GAPDH was automatically calculated based on the calibration curves generated by serially diluted NF-H or GAPDH plasmids.
2.2. PC-12 cell culture and treatments
2.6. Western blot analysis
PC-12 cells were obtained from Shanghai Cell Bank, Chinese Academy of Sciences, and routinely maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2.5% fetal bovine serum and 15% horse serum (Invitrogen Carlsbad, CA, USA). Exponentially growing PC-12 cells were seeded onto 6well plates in fresh culture medium containing chitooligosaccharide at concentrations of 0.01, 0.10 and 1.0 mg/ml, containing either 50 ng/ml NGF (Sigma, St. Louis, MO, USA) or no additive. The 2 latter served as positive or negative controls, respectively. After 2 weeks, PC-12 cells were observed under an inverted light microscope.
PC-12 cells were cultured in different conditional mediums for 2 weeks and then lysed in cell/tissue protein extraction reagent (Biocolors, Shanghai, China) with protease inhibitor on ice. Whole-cell lysates, whose protein concentrations had been measured by a BCA Protein Assay Reagent kit (Biocolors), were resolved by 10% SDS-PAGE and transferred to PVDF membranes (Bio-Rad). The membranes were blotted with 5% non-fat dry milk in TBST buffer and incubated with the primary antibodies: anti-N-cadherin (Abcam, Cambridge, MA, USA) or anti-b-actin (Sigma). After incubation with the second antibody goat anti-mouse-IRDye (1:10 000) or donkey anti-goat-IRDye (1:10 000), the membrane was washed with PBS/T and scanned with an Odyssey Infrared imager (Licor, Lincoln, NE, USA). The data were analyzed with the software attached to the imager. The antibody used was specific for recognizing an intracellular domain that commonly existed in most known N-cadherins. b-Actin was used as an internal control for normalizing the loaded protein.
2.3. Cell viability assay PC-12 cells were seeded in triplicate in 96-well plates (5 103 cells/well), and treated with 3 different concentrations of chitooligosaccharide or 50 ng/ml NGF, with or without any additive. After incubation for 1, 4, 7 and 10 days, a cell counting kit-8 consisting of tetrazolium salt WST-8 (CCK-8, Dojindo, Japan) was used to analyze the cell viability in different culture mediums according to the manual. Absorbance at 450 nm was measured with a microplate reader (ELx800, Bio-Tech Instruments, Winooski, VT, USA).
Target gene
Sequence (50 e30 )
Position
NF-H-sense
nt1405ent1428
2.4. Cell proliferation assay
NF-H-antisense NF-H- probe
PC-12 cells were seeded in triplicate in 96-well plates (5 103 cells/well) and treated as described in Section 2.3. After incubation for 3, 4, and 5 days, BrdU (5-bromo-
GAPDH-sense GAPDH-antisense GAPDH-probe
aaggaaaccgtcatt gtagaggaa ggagacgtagttgctgcttctt FAM-cttctgcctccttct tcttcctcccctt -TAMRA ccttcattgacctcaactacatg cttctccatggtggtggaaac FAM-cccatcaccatcttccaggagc-TAMRA
Table 1 Olignonucleotide primers and probes.
nt1544ent1523 nt1487ent1514 nt177ent199 nt 428ent 413 nt 287ent 308
354
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
2.7. Statistics Data are presented as means SEM. One-way AVONA and post-hoc Student t-test were used to compare differences between groups. Statistical analyses were conducted with an STATA 7.0 software package (Stata Corp, College Station, TX, USA), and significance levels were set at p < 0.05. 3. Results 3.1. Effect of chitooligosaccharide on PC-12 cell morphology After 2 weeks of culture, the PC-12 cells treated with chitooligosaccharide began to exhibit a neuron-like morphology compared to the negative control. A portion of PC-12 cells with short neurite outgrowths formed neural network after treatment with chitooligosaccharide (Fig. 1), and the most obvious effect occurred upon treatment with 0.1 mg/ ml chitooligosaccharide (Fig. 1C). 3.2. Effect of chitooligosaccharide on viability and proliferation of PC-12 cells The cell viability of PC-12 cells was significantly increased by treatments with 50 ng/ml NGF for 4 days, or with 0.01 mg/ ml chitooligosaccharide for 7 days, or with 0.1 mg/ml chitooligosaccharide for 4 or 7 days, or with 1.0 mg/ml chitooligosaccharide for 4, 7 or 10 days as compared to the negative control. But it was significantly decreased by treatments for 10 days with either 50 ng/ml NGF or 0.01, 0.1 mg/ml chitooligosaccharide compared to the negative control (Fig. 2A). In
contrast, treatments whether with chitooligosaccharide or NGF induced no significant change in the proliferation of PC12 cells as compared to the negative control (Fig. 2B). 3.3. Effect of chitooligosaccharide on expression of NFH mRNA and protein in PC-12 cells After 1 week culture, the NF-H mRNA level in PC-12 cells treated with 3 different concentrations of chitooligosaccharide was significantly higher than the negative control; and the NF-H protein level in PC-12 cells treated only with 0.1 mg/ml chitooligosaccharide was significantly higher than the negative control. After 3-week culture, the NF-H mRNA level in PC-12 cells treated with 0.1 or 1.0 mg/ml chitooligosaccharide was significantly higher than that of the negative control; and the NF-H protein level in PC-12 cells treated with 0.01 or 0.1 mg/ml chitooligosaccharide was significantly higher than negative control. In addition, it appears that treatment with 0.1 mg/ml chitooligosaccharide produce to a maximum elevation in the NF-H mRNA level (Fig. 3). 3.4. Effect of chitooligosaccharide on expression of Ncadherin protein in PC-12 cells After 2 weeks of culture in conditional mediums, N-cadherin protein was significantly increased in the PC-12 cells treated with 0.1 mg/ml chitooligosaccharide as compared to the negative control, (Fig. 4), despite 2 specific bands of N-cadherin protein between 120e140 kDa the expression of which were increased in PC-12 cells treated with 3 different concentrations of chitooligosaccharide (inset in Fig. 4).
Fig. 1. Morphology of PC-12 cells after 2-week culture for the negative control (A), the positive control 50 ng/ml NGF treated (B) and underwent treatment with 0.01 (C), 0.1 (D) and 1.0 (E) mg/ml chitooligosaccharide, respectively. Scale bar: 20 mm.
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
Fig. 2. The cell viability (A) and cell proliferation (B) of PC-12 cells which had been cultured in different conditional mediums, as indicated by legends: control, NGF, 0.01 mg/ml, 0.1 mg/ml, 1.0 mg/ml, for different times. *p < 0.05; **p < 0.01: vs. the negative control.
355
Fig. 3. The mRNA (A) and protein (B) expression levels of NF-H in PC-12 cells after 1- or 3-week culture for the negative control and underwent treatment with 0.01, 0.1 and 1.0 mg/ml chitooligosaccharide, respectively. Both *p < 0.05, **p < 0.01 vs. the negative control.
4. Discussion Chitooligosaccharide has many biological activities including free radical scavenging activity (Yang et al., 2006), antitumor activity (Huang et al., 2006), immunostimulating effects (Suzuki et al., 1992), and antimicrobial activity (Jung et al., 2006). These results, especially the fact that chitooligosaccharide modulates the activity of osteoblastic cells through mRNA levels (Ohara et al., 2004), led us to examine the nerve cell affinity of chitooligosaccharide, which might be involved in the neuron growth-promoting effects of chitosan in the body. After two weeks of culture PC-12 cells treated with chitooligosaccharide exhibited a neuron-like morphology compared to the negative control. In addition, certain concentrations of chitooligosaccharide, just as NGF, increased the viability of treated PC-12 cells, measured with WST-8 reagent (Green and Tischler, 1976). More importantly, 0.1 mg/ml chitooligosaccharide significantly upregulated the expression of NF-H and N-cadherins in the PC-12 cells. Neurofilaments (NFs), neuron-specific intermediate filaments, are the major cytoskeletal element in neurons and much more numerous in axons, made up by the copolymerization of 3 polypeptides e the NF light (NF-L), medium (NF-M), and heavy (NF-H) subunits. NF investment into axons is essential for establishment of axonal caliber, and
Fig. 4. Expression levels of N-cadherin protein in PC-12 cells after 2 week culture for the negative control and underwent treatment with 0.01, 0.1 and 1.0 mg/ml chitooligosaccharide, respectively. Both *p < 0.05, **p < 0.01 vs. the negative control. Also shown (inset) are representative Western blot of Ncadherin and beta-actin (internal control).
356
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
is a key determinant of conduction velocity (Julien and Mushynski, 1998; Lee et al., 1993). In particular, NF-H can regulate the neurite extension by modulating microtubule assembly (Jacomy et al., 1999). Cell adhesion molecules are involved in cell migration, growth of axons, nerve pathways formation and synaptogenesis, and N-cadherin protein plays a key role in multiple steps of neuron development, including initial neurite sprouting, axon specification, and later dendritic elaboration. Therefore, neurons grown on the N-cadherin substrate can generate the neurite and migrate more rapidly (Bixby and Zhang, 1990). We therefore conclude that chitooligosaccharide, the biodegradation product of chitosan, could support nerve cell adhesion and promote neuronal differentiation and neurite outgrowth through the upregulation of the expression of both NF-H and N-cadherin factors. Acknowledgements The financial supports of the Hi-Tech Research and Development Program of China (863 Program, Grant no. 2006AA02A128), the Nature Science Foundation of china (Grant no. 30770585), Basic Research Program of Jiangsu Education Department (Grant no. 07KJA31025) and Program for New Century Excellent Talents in University are gratefully acknowledged. References Bini TB, Gao SJ, Wang S, Ramakrishna S. Development of fibrous biodegradable polymer conduits for guided nerve regeneration. Journal of Materials Science e Materials in Medicine 2005;16:367e375. Bixby JL, Zhang R. Purified N-cadherin is a potent substrate for the rapid induction of neurite outgrowth. Journal of Cell Biology 1990;110:1253e 1260. Christina A, Andreas J, Kerstin R, Susanne K, Peter MV. Use of spider silk fibres as an innovative material in a biocompatible artificial nerve conduit. Journal of Cellular and Molecular Medicine 2006;10:770e777. Freier T, Koh HS, Kazazian K, Shoichet MS. Controlling cell adhesion and degradation of chitosan films by N-acetylation. Biomaterials 2005;26:5872e 5878. Gianluca C, Valeria C. Materials for peripheral nerve regeneration. Macromolecular Bioscience 2006;6:13e26. Gong H, Zhong Y, Li J, Gong Y, Zhao N, Zhang X. Studies on nerve cell affinity of chitosan-derived materials. Journal of Biomedical Materials Research 2000;52:285e295. Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proceedings of the National Academy of Sciences of the.United States of America 1976;73:2424e2428.
Huang RH, Mendis E, Rajapakse N, Kim SK. Strong electronic charge as an important factor for anticancer activity of chitooligosaccharide. Life Science 2006;78:2399e2408. Isamu Y, Soichiro I, Masumi S, Akiyoshi O, Junzo T. The chitosan prepared from crab tendons. II. The chitosan/apatite composites and their application to nerve regeneration. Biomaterials 2003;24:3285e3292. Jacomy H, Zhu Q, Couillard DS, Beaulieu JM, Julien JP. Disruption of type IV intermediate filament network in mice lacking the neurofilament medium and heavy subunits. Journal of Neurochemistry 1999;73:972e984. Jia ZS, Shen DF. Effect of reaction temperature and reaction time on the preparation of low-molecular-weight chitosan using phosphoric acid. Carbohydrate Polymers 2002;49:393e396. Julien JP, Mushynski WE. Neurofilaments in health and disease. Progress in Nucleic Acid Research and Molecular Biology 1998;61:1e23. Jung WK, Moon SH, Kim SK. Effect of chitooligosaccharides on calcium bioavailability and bone strength in ovariectomized rats. Life Science 2006;78:970e976. Lee MVY, Xu Z, Wong PC, Cleveland DW. Neurofilaments are obligate heteropolymers in vivo. Journal of Cell Biology 1993;122:1337e1350. Liu M, Gu X, Zhang Q, Liu Y, Lin S, Gu Y. Tpc1808 increases expression of NF-H in PC-12 cells. Journal of Molecular Neuroscience 2006;29:123e 129. Mendis E, Kim MM, Rajapakse N, Kim SK. An in vitro cellular analysis of the radical scavenging efficacy of chitooligosaccharides. Life Science 2007; 80:2118e2127. Ohara N, Hayashi Y, Yamada S, Kim SK, Matsunaga T, Yanagiguchi K. Early gene expression analyzed by cDNA microarray and RT-PCR in osteoblasts cultured with water-soluble and low molecular chitooligosaccharide. Biomaterials 2004;25:1749e1754. Shao J, Yang YM, Zhong QQ. Studies on preparation of oligoglucosamine by oxidative degradation under microwave irradiation. Polymer Degradation and Stability 2003;82:393e398. Suzuki S, Watanabe T, Mikami T, Matsumoto T, Suzuki M. Immunoenhancing effects of N-acetylchitohexaose. In: Brine CJ, Sanford PA, Zikakis JP, editors. Advances in chitin and chitosan; 1992. p. 277e316. Wang XD, Hu W, Cao Y, Wu J, Gu XS. Dog sciatic nerve regeneration across a 30 mm defect bridged by a chitosan/PGA artificial nerve graft. Brain 2005;128:1897e1910. Yannas IV, Hill BJ. Selection of biomaterials for peripheral nerve regeneration using data from the nerve chamber model. Biomaterials 2004;25: 1593e1600. Yang YM, Gu XS, Tan RX, Hu W, Wang XD, Zhang PY. Fabrication and properties of a porous chitin/chitosan conduit for nerve regeneration. Biotechnology Letters 2004;26:1793e1797. Yang YM, Shu RG, Shao J, Xu GF, Gu XX. Radical scavenging activity of chitooligosaccharide with different molecular weights. European Food Research and Technology 2006;222:36e40. Yuan Y, Zhang PY, Yang YM, Wang XD, Gu XS. The interaction of Schwann cells with chitosan membranes and fibers in vitro. Biomaterials 2004;25: 4273e4278. Zheng F, Shi XW, Yang GF, Gong LL, Yuan HY, Cui YJ, et al. Chitosan nanoparticle as gene therapy vector via gastrointestinal mucosa administration: results of an in vitro and in vivo study. Life Science 2007;80: 388e396.
Effect of chitooligosaccharide on neuronal differentiation of PC-12 cells Yumin Yang1, Mei Liu1, Yun Gu, Sheyu Lin, Fei Ding, Xiaosong Gu* Jiangsu Key Laboratory of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong City, Jiangsu 226001, PR China Received 10 June 2008; revised 17 November 2008; accepted 9 January 2009
Abstract Chitosan is now being widely used biomaterial in the tissue engineering field, and has great potential as a candidate material for preparing nerve guidance conduits due to its various favorable properties, especially that of good nerve cell affinity. Chitosan can be degraded in vivo into chitooligosaccharide. We have investigated the in vitro effects of chitooligosaccharide on neuronal differentiation of PC-12 cells to see what effects chitooligosaccharide have on certain functions in the regenerating neurons. The morphologic observation and assessment using the specific reagent of tetrazolium salt WST-8 indicated that neurite outgrowths from PC-12 cells and the viability of PC-12 cells were enhanced by treatment of chitooligosaccharide. The real-time quantitative RT-PCR and Western blot analysis revealed showed that chitooligosaccharide could upregulate the expression of neurofilament-H mRNA or protein and N-cadherin protein in PC-12 cells. The maximum effect of 0.1 mg/ml chitooligosaccharide was obtained after 2 week culture. All the data suggest that chitooligosaccharide possesses good nerve cell affinity by supporting nerve cell adhesion and promoting neuronal differentiation and neurite outgrowth. Ó 2009 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. Keywords: Chitosan; Chitooligosaccharide; Nerve cell affinity; Neuronal differentiation; PC-12 cells
1. Introduction Chitosan is made up of D-glucosamine units linked by b (1e4) glycosidic bonds and is derived from deacetylation of chitin, the main component of the exoskeleton of crustaceans. It has a number of biomedical applications, including those in tissue engineering, due to its various favorable properties; especially its specific interactions with the extra cellular matrix and growth factors (Freier et al., 2005; Zheng et al., 2007). Many studies on peripheral nerve regeneration have also reported that chitosan-based nerve guidance conduits were used to bridge an extended nerve gap with considerable success because the conduit not only acted as a supporting scaffold to guide axonal growth, but also enhanced both the survival and neurite outgrowth of neurons
* Corresponding author. Tel.: þ86 513 85051818; fax: þ86 513 85511585. E-mail address: [email protected] (X. Gu). 1 Contributed equally to this work.
(Wang et al., 2005; Christina et al., 2006; Isamu et al., 2003; Gianluca and Valeria, 2006; Bini et al., 2005; Yannas and Hill, 2004). Chitosan is degraded in vivo by an enzymatic hydrolysis of lysozyme normally produced by macrophages (Ohara et al., 2004). The biodegradation products of chitosan are (low MW) chitooligosaccharides with different polymerization degrees (from 2 to 10) (Mendis et al., 2007). After implantation of chitosan conduits, undegraded chitosan and chitooligosaccharide produced from degraded chitosan are likely to coexist around the regenerating neurons for a considerable period of time. Despite previous reports that chitosan material exhibited nerve cell affinity in vitro (Yuan et al., 2004; Yang et al., 2004; Freier et al., 2005; Gong et al., 2000), the issue of whether chitooligosaccharides, also affect certain functions in the regenerating neurons is worth exploring. Therefore we have chosen rat pheochromocytoma PC-12 cells to examine the neurobiological changes induced by chitooligosaccharide under in vitro conditions.
1065-6995/$ - see front matter Ó 2009 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.cellbi.2009.01.005
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
2. Materials and methods 2.1. Preparation and purification of chitooligosaccharide Chitosan, obtained from Nantong Xincheng Biochemical Company (Jiangsu, China), was refined twice by dissolving it in 10 g/L acetic acid solution. It was filtered, precipitated with 50 g/L NaOH, and finally dried in a vacuum at room temperature. Its degree of deacetylation was 92.3% according to titration analysis and its average MW was 2.5 105 according to viscosity measurements (Jia and Shen, 2002). Crude chitooligosaccharide prepared by our previously reported method (Shao et al., 2003), was dissolved in a minimum volume of distilled water, and partially purified on a Sephadex-25 column (column size: 1.6 85 cm bed volume). The sample was placed on the column top and eluted with distilled water. The eluted chitooligosaccharide solution was lyophilised under vacuum (35e45 mTorr) to obtain chitooligosaccharide powder. Its number average MW was determined by end-group analysis (Yang et al., 2006). The MW value showed that the chitooligosaccharide preparation was a mixture with variable molecular length, with an average polymerization of w7.
353
20 -deoxyuridine) labeling solution (Cell Proliferation ELISA BrdU, Colorimetric, Roche, Nutley, NJ, USA) was added to each well, plates were then incubated for 3 h. The cellular DNA was denatured, and Anti-BrdU-POD bound to the BrdU incorporated in newly synthesized DNA of proliferating cells. The immune complexes were detected by the subsequent peroxidase-substrate reactions. Absorbance at 450 nm was measured with a microplate reader (ELx800), and was expressed as a percentage of the value obtained relative to normalised control cells. 2.5. Real-time quantitative RT-PCR Gene specific primers and probes were designed according to the whole sequences of NF-H (GeneBank No. NM_012607.1) and GAPDH (as an internal control, GeneBank No. BC059110.1), respectively (Table 1). The details for preparing standard plasmid and real-time PCR have previously been described (Liu et al., 2006). Briefly, the PC-12 cells were collected in Trizol reagent (Invitrogen, Carlsbad, CA, USA), and total RNA was extracted and reverse transcriptized (Omniscript RT kit from Qiagen). The mRNA quantity of NF-H or GAPDH was automatically calculated based on the calibration curves generated by serially diluted NF-H or GAPDH plasmids.
2.2. PC-12 cell culture and treatments
2.6. Western blot analysis
PC-12 cells were obtained from Shanghai Cell Bank, Chinese Academy of Sciences, and routinely maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2.5% fetal bovine serum and 15% horse serum (Invitrogen Carlsbad, CA, USA). Exponentially growing PC-12 cells were seeded onto 6well plates in fresh culture medium containing chitooligosaccharide at concentrations of 0.01, 0.10 and 1.0 mg/ml, containing either 50 ng/ml NGF (Sigma, St. Louis, MO, USA) or no additive. The 2 latter served as positive or negative controls, respectively. After 2 weeks, PC-12 cells were observed under an inverted light microscope.
PC-12 cells were cultured in different conditional mediums for 2 weeks and then lysed in cell/tissue protein extraction reagent (Biocolors, Shanghai, China) with protease inhibitor on ice. Whole-cell lysates, whose protein concentrations had been measured by a BCA Protein Assay Reagent kit (Biocolors), were resolved by 10% SDS-PAGE and transferred to PVDF membranes (Bio-Rad). The membranes were blotted with 5% non-fat dry milk in TBST buffer and incubated with the primary antibodies: anti-N-cadherin (Abcam, Cambridge, MA, USA) or anti-b-actin (Sigma). After incubation with the second antibody goat anti-mouse-IRDye (1:10 000) or donkey anti-goat-IRDye (1:10 000), the membrane was washed with PBS/T and scanned with an Odyssey Infrared imager (Licor, Lincoln, NE, USA). The data were analyzed with the software attached to the imager. The antibody used was specific for recognizing an intracellular domain that commonly existed in most known N-cadherins. b-Actin was used as an internal control for normalizing the loaded protein.
2.3. Cell viability assay PC-12 cells were seeded in triplicate in 96-well plates (5 103 cells/well), and treated with 3 different concentrations of chitooligosaccharide or 50 ng/ml NGF, with or without any additive. After incubation for 1, 4, 7 and 10 days, a cell counting kit-8 consisting of tetrazolium salt WST-8 (CCK-8, Dojindo, Japan) was used to analyze the cell viability in different culture mediums according to the manual. Absorbance at 450 nm was measured with a microplate reader (ELx800, Bio-Tech Instruments, Winooski, VT, USA).
Target gene
Sequence (50 e30 )
Position
NF-H-sense
nt1405ent1428
2.4. Cell proliferation assay
NF-H-antisense NF-H- probe
PC-12 cells were seeded in triplicate in 96-well plates (5 103 cells/well) and treated as described in Section 2.3. After incubation for 3, 4, and 5 days, BrdU (5-bromo-
GAPDH-sense GAPDH-antisense GAPDH-probe
aaggaaaccgtcatt gtagaggaa ggagacgtagttgctgcttctt FAM-cttctgcctccttct tcttcctcccctt -TAMRA ccttcattgacctcaactacatg cttctccatggtggtggaaac FAM-cccatcaccatcttccaggagc-TAMRA
Table 1 Olignonucleotide primers and probes.
nt1544ent1523 nt1487ent1514 nt177ent199 nt 428ent 413 nt 287ent 308
354
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
2.7. Statistics Data are presented as means SEM. One-way AVONA and post-hoc Student t-test were used to compare differences between groups. Statistical analyses were conducted with an STATA 7.0 software package (Stata Corp, College Station, TX, USA), and significance levels were set at p < 0.05. 3. Results 3.1. Effect of chitooligosaccharide on PC-12 cell morphology After 2 weeks of culture, the PC-12 cells treated with chitooligosaccharide began to exhibit a neuron-like morphology compared to the negative control. A portion of PC-12 cells with short neurite outgrowths formed neural network after treatment with chitooligosaccharide (Fig. 1), and the most obvious effect occurred upon treatment with 0.1 mg/ ml chitooligosaccharide (Fig. 1C). 3.2. Effect of chitooligosaccharide on viability and proliferation of PC-12 cells The cell viability of PC-12 cells was significantly increased by treatments with 50 ng/ml NGF for 4 days, or with 0.01 mg/ ml chitooligosaccharide for 7 days, or with 0.1 mg/ml chitooligosaccharide for 4 or 7 days, or with 1.0 mg/ml chitooligosaccharide for 4, 7 or 10 days as compared to the negative control. But it was significantly decreased by treatments for 10 days with either 50 ng/ml NGF or 0.01, 0.1 mg/ml chitooligosaccharide compared to the negative control (Fig. 2A). In
contrast, treatments whether with chitooligosaccharide or NGF induced no significant change in the proliferation of PC12 cells as compared to the negative control (Fig. 2B). 3.3. Effect of chitooligosaccharide on expression of NFH mRNA and protein in PC-12 cells After 1 week culture, the NF-H mRNA level in PC-12 cells treated with 3 different concentrations of chitooligosaccharide was significantly higher than the negative control; and the NF-H protein level in PC-12 cells treated only with 0.1 mg/ml chitooligosaccharide was significantly higher than the negative control. After 3-week culture, the NF-H mRNA level in PC-12 cells treated with 0.1 or 1.0 mg/ml chitooligosaccharide was significantly higher than that of the negative control; and the NF-H protein level in PC-12 cells treated with 0.01 or 0.1 mg/ml chitooligosaccharide was significantly higher than negative control. In addition, it appears that treatment with 0.1 mg/ml chitooligosaccharide produce to a maximum elevation in the NF-H mRNA level (Fig. 3). 3.4. Effect of chitooligosaccharide on expression of Ncadherin protein in PC-12 cells After 2 weeks of culture in conditional mediums, N-cadherin protein was significantly increased in the PC-12 cells treated with 0.1 mg/ml chitooligosaccharide as compared to the negative control, (Fig. 4), despite 2 specific bands of N-cadherin protein between 120e140 kDa the expression of which were increased in PC-12 cells treated with 3 different concentrations of chitooligosaccharide (inset in Fig. 4).
Fig. 1. Morphology of PC-12 cells after 2-week culture for the negative control (A), the positive control 50 ng/ml NGF treated (B) and underwent treatment with 0.01 (C), 0.1 (D) and 1.0 (E) mg/ml chitooligosaccharide, respectively. Scale bar: 20 mm.
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
Fig. 2. The cell viability (A) and cell proliferation (B) of PC-12 cells which had been cultured in different conditional mediums, as indicated by legends: control, NGF, 0.01 mg/ml, 0.1 mg/ml, 1.0 mg/ml, for different times. *p < 0.05; **p < 0.01: vs. the negative control.
355
Fig. 3. The mRNA (A) and protein (B) expression levels of NF-H in PC-12 cells after 1- or 3-week culture for the negative control and underwent treatment with 0.01, 0.1 and 1.0 mg/ml chitooligosaccharide, respectively. Both *p < 0.05, **p < 0.01 vs. the negative control.
4. Discussion Chitooligosaccharide has many biological activities including free radical scavenging activity (Yang et al., 2006), antitumor activity (Huang et al., 2006), immunostimulating effects (Suzuki et al., 1992), and antimicrobial activity (Jung et al., 2006). These results, especially the fact that chitooligosaccharide modulates the activity of osteoblastic cells through mRNA levels (Ohara et al., 2004), led us to examine the nerve cell affinity of chitooligosaccharide, which might be involved in the neuron growth-promoting effects of chitosan in the body. After two weeks of culture PC-12 cells treated with chitooligosaccharide exhibited a neuron-like morphology compared to the negative control. In addition, certain concentrations of chitooligosaccharide, just as NGF, increased the viability of treated PC-12 cells, measured with WST-8 reagent (Green and Tischler, 1976). More importantly, 0.1 mg/ml chitooligosaccharide significantly upregulated the expression of NF-H and N-cadherins in the PC-12 cells. Neurofilaments (NFs), neuron-specific intermediate filaments, are the major cytoskeletal element in neurons and much more numerous in axons, made up by the copolymerization of 3 polypeptides e the NF light (NF-L), medium (NF-M), and heavy (NF-H) subunits. NF investment into axons is essential for establishment of axonal caliber, and
Fig. 4. Expression levels of N-cadherin protein in PC-12 cells after 2 week culture for the negative control and underwent treatment with 0.01, 0.1 and 1.0 mg/ml chitooligosaccharide, respectively. Both *p < 0.05, **p < 0.01 vs. the negative control. Also shown (inset) are representative Western blot of Ncadherin and beta-actin (internal control).
356
Y. Yang et al. / Cell Biology International 33 (2009) 352e356
is a key determinant of conduction velocity (Julien and Mushynski, 1998; Lee et al., 1993). In particular, NF-H can regulate the neurite extension by modulating microtubule assembly (Jacomy et al., 1999). Cell adhesion molecules are involved in cell migration, growth of axons, nerve pathways formation and synaptogenesis, and N-cadherin protein plays a key role in multiple steps of neuron development, including initial neurite sprouting, axon specification, and later dendritic elaboration. Therefore, neurons grown on the N-cadherin substrate can generate the neurite and migrate more rapidly (Bixby and Zhang, 1990). We therefore conclude that chitooligosaccharide, the biodegradation product of chitosan, could support nerve cell adhesion and promote neuronal differentiation and neurite outgrowth through the upregulation of the expression of both NF-H and N-cadherin factors. Acknowledgements The financial supports of the Hi-Tech Research and Development Program of China (863 Program, Grant no. 2006AA02A128), the Nature Science Foundation of china (Grant no. 30770585), Basic Research Program of Jiangsu Education Department (Grant no. 07KJA31025) and Program for New Century Excellent Talents in University are gratefully acknowledged. References Bini TB, Gao SJ, Wang S, Ramakrishna S. Development of fibrous biodegradable polymer conduits for guided nerve regeneration. Journal of Materials Science e Materials in Medicine 2005;16:367e375. Bixby JL, Zhang R. Purified N-cadherin is a potent substrate for the rapid induction of neurite outgrowth. Journal of Cell Biology 1990;110:1253e 1260. Christina A, Andreas J, Kerstin R, Susanne K, Peter MV. Use of spider silk fibres as an innovative material in a biocompatible artificial nerve conduit. Journal of Cellular and Molecular Medicine 2006;10:770e777. Freier T, Koh HS, Kazazian K, Shoichet MS. Controlling cell adhesion and degradation of chitosan films by N-acetylation. Biomaterials 2005;26:5872e 5878. Gianluca C, Valeria C. Materials for peripheral nerve regeneration. Macromolecular Bioscience 2006;6:13e26. Gong H, Zhong Y, Li J, Gong Y, Zhao N, Zhang X. Studies on nerve cell affinity of chitosan-derived materials. Journal of Biomedical Materials Research 2000;52:285e295. Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proceedings of the National Academy of Sciences of the.United States of America 1976;73:2424e2428.
Huang RH, Mendis E, Rajapakse N, Kim SK. Strong electronic charge as an important factor for anticancer activity of chitooligosaccharide. Life Science 2006;78:2399e2408. Isamu Y, Soichiro I, Masumi S, Akiyoshi O, Junzo T. The chitosan prepared from crab tendons. II. The chitosan/apatite composites and their application to nerve regeneration. Biomaterials 2003;24:3285e3292. Jacomy H, Zhu Q, Couillard DS, Beaulieu JM, Julien JP. Disruption of type IV intermediate filament network in mice lacking the neurofilament medium and heavy subunits. Journal of Neurochemistry 1999;73:972e984. Jia ZS, Shen DF. Effect of reaction temperature and reaction time on the preparation of low-molecular-weight chitosan using phosphoric acid. Carbohydrate Polymers 2002;49:393e396. Julien JP, Mushynski WE. Neurofilaments in health and disease. Progress in Nucleic Acid Research and Molecular Biology 1998;61:1e23. Jung WK, Moon SH, Kim SK. Effect of chitooligosaccharides on calcium bioavailability and bone strength in ovariectomized rats. Life Science 2006;78:970e976. Lee MVY, Xu Z, Wong PC, Cleveland DW. Neurofilaments are obligate heteropolymers in vivo. Journal of Cell Biology 1993;122:1337e1350. Liu M, Gu X, Zhang Q, Liu Y, Lin S, Gu Y. Tpc1808 increases expression of NF-H in PC-12 cells. Journal of Molecular Neuroscience 2006;29:123e 129. Mendis E, Kim MM, Rajapakse N, Kim SK. An in vitro cellular analysis of the radical scavenging efficacy of chitooligosaccharides. Life Science 2007; 80:2118e2127. Ohara N, Hayashi Y, Yamada S, Kim SK, Matsunaga T, Yanagiguchi K. Early gene expression analyzed by cDNA microarray and RT-PCR in osteoblasts cultured with water-soluble and low molecular chitooligosaccharide. Biomaterials 2004;25:1749e1754. Shao J, Yang YM, Zhong QQ. Studies on preparation of oligoglucosamine by oxidative degradation under microwave irradiation. Polymer Degradation and Stability 2003;82:393e398. Suzuki S, Watanabe T, Mikami T, Matsumoto T, Suzuki M. Immunoenhancing effects of N-acetylchitohexaose. In: Brine CJ, Sanford PA, Zikakis JP, editors. Advances in chitin and chitosan; 1992. p. 277e316. Wang XD, Hu W, Cao Y, Wu J, Gu XS. Dog sciatic nerve regeneration across a 30 mm defect bridged by a chitosan/PGA artificial nerve graft. Brain 2005;128:1897e1910. Yannas IV, Hill BJ. Selection of biomaterials for peripheral nerve regeneration using data from the nerve chamber model. Biomaterials 2004;25: 1593e1600. Yang YM, Gu XS, Tan RX, Hu W, Wang XD, Zhang PY. Fabrication and properties of a porous chitin/chitosan conduit for nerve regeneration. Biotechnology Letters 2004;26:1793e1797. Yang YM, Shu RG, Shao J, Xu GF, Gu XX. Radical scavenging activity of chitooligosaccharide with different molecular weights. European Food Research and Technology 2006;222:36e40. Yuan Y, Zhang PY, Yang YM, Wang XD, Gu XS. The interaction of Schwann cells with chitosan membranes and fibers in vitro. Biomaterials 2004;25: 4273e4278. Zheng F, Shi XW, Yang GF, Gong LL, Yuan HY, Cui YJ, et al. Chitosan nanoparticle as gene therapy vector via gastrointestinal mucosa administration: results of an in vitro and in vivo study. Life Science 2007;80: 388e396.