Effect of chitooligosaccharides with different degrees of acetylation on wheat seedlings under salt stress

Carbohydrate Polymers 126 (2015) 62–69

Contents lists available at ScienceDirect

Carbohydrate Polymers journal homepage: www.elsevier.com/locate/carbpol

Effect of chitooligosaccharides with different degrees of acetylation on wheat seedlings under salt stress Ping Zou a,b , Kecheng Li a , Song Liu a,∗ , Ronge Xing a , Yukun Qin a , Huahua Yu a , Miaomiao Zhou a,b , Pengcheng Li a,∗ a b

Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Graduate University of the Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 19 December 2014 Received in revised form 11 February 2015 Accepted 14 March 2015 Available online 21 March 2015 Keywords: Chitooligosaccharides Acetylation Salt stress Antioxidant enzyme activities Photosynthesis Gene expressions

a b s t r a c t In this study, chitooligosaccharides (COSs) with varying degrees of acetylation (DAs) were applied to wheat seedlings in order to investigate their effect on the plants’ defence response under salt stress. The results showed that treatment with exogenous COSs that had different DAs could promote the growth of plants, decrease the concentration of malondialdehyde (MDA), improve the photosynthetic efficiency and enhance the activities of antioxidant enzymes. The mRNA expression level examination of several salt stress response genes suggested that COS could protect plants from the damage of salt stress by adjusting intracellular ion concentration and enhancing the activities of antioxidant enzymes. Furthermore, COS with DA 50% was the most effective in alleviating salt stress to wheat seedlings, which indicated that the activity of COS was closely related with its DAs. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Soil salinity is an important factor in crop growth, and variations within the salinity can cause abiotic stress and lead to significant inhibition of germination, growth and productivity of crops. High salt concentration can cause an imbalance of cellular ions and disrupt the equilibrium between production and scavenging of reactive oxygen species (ROS) (Apel & Hirt, 2004). Salinity disturbs the Na+ /K+ ratio leading to severe toxic effects on genes and enzymes – causing impairments on metabolism (Rivero et al., 2014). Increased level of Na+ in cells disrupts physiological processes, especially photosynthesis, by reducing the photosynthetic efficiency (Munns, 2002). Additionally, salt stress can lead to the generation of ROS such as superoxide (O2 •− ), hydrogen peroxide (H2 O2 ) and hydroxyl radicals, which in turn can generate other destructive species such as lipid peroxides (Mittler, Vanderauwera, Gollery, & Breusegem, 2004). Plants have evolved complex mechanisms to combat against the salt stress-induced oxidative stress. These mechanisms include a host of antioxidants, including superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD), which

∗ Corresponding authors. Tel.: +86 532 82898707; fax: +86 532 82968951. E-mail addresses: [email protected] (S. Liu), [email protected] (P. Li). http://dx.doi.org/10.1016/j.carbpol.2015.03.028 0144-8617/© 2015 Elsevier Ltd. All rights reserved.

play significant roles in scavenging ROS (Bose, Rodrigo-Moreno, & Shabala, 2013). With increases in population growth and the development of industry, the amount of farmland worldwide is decreasing, and the saline land is gradually increasing (Diby & Harshad, 2014). Therefore, it is crucial to develop techniques to increase crop yield and quality in saline land. One current technique to improve salt tolerance of plants is transgenic technology which has limited effectiveness and is enveloped in controversy. Another technique is the application of exogenous biostimulators, which is able to decrease the negative effect of abiotic stress and increase yield and quality of crops. Chitosan has been reported to possess diverse biological activities such as antifungal activity (Ma, Yang, Yan, Kennedy, & Meng, 2013, Souza, Hallan, Mirelli, & Oliveira, 2013), antibacterial activity (Li, Liu, et al., 2013) and antiviral activity (Kulikov, Chirkov, Ilina, Lopatin, & Varlamov, 2006). Although chitosan appears to improve the tolerance of plants, such as safflower and sunflower (Jabeen & Ahmad, 2013), to salt stress (salt concentration 0–0.8%), the exact physiological mechanisms are not currently understood. How the DAs exactly works in altering activities of chitosan is unclear, but the DA is the most important parameter influencing the chitosans’ various properties (Kasaai, 2010). The effectiveness of chitosan in various applications appears to be dependent on the DA (Je & Kim, 2006; Maksimov, Valeev, Cherepanova, & Burkhanova, 2013). When compared with chitosan,

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

COS has lower molecular weight and higher water solubility and, in some studies, is reported to exhibit better antifungal (Meng, Yang, Kennedy, & Tian, 2010; Rabea et al., 2005) and antiviral (Kulikov et al., 2006) activity and better ability to promote plant growth (Nguyen, Vo, & Tran, 2011). However, most of these reports fail to mention the function of COS with different DAs in improving the capacity of plants against salt stress. Accordingly, in this study, we exposed wheat seedlings to salt stress and investigated the effect of exogenous COSs with different DAs on wheat seedlings. Furthermore, we evaluated the expression of a series of salt-associated genes in wheat by quantitative RT-PCR to explore the physiological mechanisms of exogenous COS with different DAs on wheat tolerance to salt stress.

63

at 25 ◦ C/20 ◦ C, respectively, with a relative humidity of 65% and a light intensity of 800 ␮mol m−2 s−1 . When the second leaf of wheat seedlings was fully expanded, 100 mM NaCl was added into the solution. Preliminary studies using various Mw of COS (1300, 3300, 5300, 9300 Da) showed that 0.01% 1300 Da COS solution was close to optimal for enhancing salt tolerance of wheat seedlings. Thus, the experiments were divided into seven groups, including a control check (CK, neither COS nor NaCl), NaCl stressed as a negative control, salicylic acid (SA) treated as a positive control, and 4 COSNaCl stressed (treated with 0.01% COS of 1300 Da with various DAs of 2, 29, 50 and 68%) groups. The nutrient solution was renewed every other day. 2.3. Growth parameters

2. Materials and methods 2.1. Preparation of COS with different DAs Highly deacetylated chitosan (DA < 10%) was obtained according to the method reported by Song, Li, Li, and Ding (2005). Highly deacetylated COS was prepared by the degradation of highly deacetylated chitosan as reported by Li et al. (2012). The chitosan powder (3 g) was introduced in 100 mL 2% acetic acid. Then 1 mL 30% H2 O2 was added into the chitosan solution. The degradation assisted with microwave radiation was carried out with the power of 600 W at 70 ◦ C for 60 min. When cooled to room temperature, the reaction mixture was adjusted to pH 7.0 and then dialyzed to remove salts and the rest of H2 O2 . The dialysis fluid was lyophilized to yield powdered products. The N-acetylation was performed according to the method reported by Li, Liu, Xing, Qin, and Li (2013). The highly deacetylated COS powder (20 mg) was dissolved in 5 mL methanol/water (50:50, v/v) solution. Different amount of acetic anhydride was added stoichiometrically into the COS solution under magnetic stirring at room temperature for 1 h. Subsequently, the resulting solution was concentrated and lyophilized to yield powdered COS with different DAs. The weight average molecular weight (Mw) were measured by an Agilent 1260 gel permeation chromatography (Agilent Technologies, USA) equipped with a refractive index detector. Chromatography was performed on TSK G3000-PWXL columns, using 0.2 M CH3 COOH/0.1 M CH3 COONa aqueous solution as mobile phases at a flow rate of 0.8 mL/min with column temperature at 30 ◦ C. The sample concentration was 0.4% (w/v). The standards used to calibrate the column were dextrans Mw 80,000, 50,000, 25,000, 12,000, 5000 and 1000 Da (Sigma, USA). Fourier transform infrared (FT-IR) spectra of samples were measured in the range of 4000–400 cm−1 regions using a Thermo Scientific Nicolet iS10 FT-IR spectrometer in KBr discs. The DA value was measured by ultraviolet spectrophotometry (Muzzarelli & Rocchetti, 1985). The highly deacetylated COS powder (10–20 mg) was introduced in 0.001 mol L−1 HCl. After complete dissolution, the absorbance of the solution was measured at 199 nm. The DA value was quantified by comparison with a standard curve using N-acetyl glucosamine.

After 10 days of NaCl treatment, wheat seedlings of each group were harvested for determination of shoot length and wet weight; after which samples were dried at 105 ◦ C for 2 h to obtain dry weight. 2.4. Lipid peroxidation degrees The level of lipid peroxidation in plants was determined based on malondialdehyde (MDA) content. MDA, a product of lipid peroxidation, was determined using a thiobarbituric acid (TBA) reaction (Seckin, Sekmen, & Türkan, 2008). After 10 days of NaCl treatment, leaf samples (0.5 g) were homogenized in 10% trichloroacetic acid (TCA). The homogenate was centrifuged at 4000 × g for 10 min. The supernatant was used for estimating the MDA content. Then, 2 mL of 0.6% TBA was added to 2 mL supernatant, and the mixture was heated at 100 ◦ C for 15 min and cooled in an ice bath immediately afterwards. Next, the mixture was centrifuged at 10,000 × g for 15 min. The absorbance of the supernatant was recorded at 450, 532 and 600 nm, separately. The MDA content was expressed as ␮mol MDA g−1 fresh weight (FW). 2.5. Chlorophyll content, fluorescence and photosynthetic characters After 10 days of NaCl treatment, chlorophyll was extracted with 95% ethanol. Chlorophyll a (Chl-a), chlorophyll b (Chl-b) and total chlorophyll (a + b) content were determined spectrophotometrically (Pongprayoon, Roytrakul, Pichayangkura, & Chadchawan, 2013). Photosynthetic rate (Pn), transpiration rate (E), stomatal conductance (gs) and intercellular CO2 concentration (Ci) were measured with a portable photosynthesis system (L.MAN-LCProSD, BioScientific Ltd., UK). Atmospheric conditions consisted of 25 ± 2 ◦ C, gas flow rate of 200 ␮mol s−1 , photosynthetic photon flux density of 800 ␮mol m−2 s−1 and CO2 concentration of 400 ± 5 ␮mol m−2 s−1 . Chlorophyll fluorescence was measured using a portable fluorometer (PAM-2100, Walz, Germany). The maximum quantum yield of PSII (Fv/Fm) was determined after dark adaptation for 30 min.

2.2. Plant material and treatments

2.6. Determination of soluble sugar

The following experiments were conducted with wheat (Triticum aestivum L. Jimai 22) seeds, which were surface sterilized with a 1% sodium hypochlorite solution for 10 min and thoroughly washed with distilled water. Seeds were soaked in distilled water for 5 h and then transferred to a Petri dish with moist gauze for germination at 25 ◦ C for 24 h in the dark. Germinated seeds were sowed in Petri dishes with nylon mesh and were grown in Hoagland solution in a growth incubator at a day/night cycle of 14 h/10 h,

After 10 days of NaCl treatment, soluble sugar was measured by the following procedure: 0.5 g of leaf samples were cut up and heated at 100 ◦ C for 30 min in 5 mL distilled water. The extract was diluted 5-fold for determination. 500 ␮L diluents, 1 mL 5% phenol and 5 mL sulfuric acid were mixed and after standing for 3 min, the absorbance was read at 485 nm. Soluble sugar concentration was quantified by comparison with a standard curve using the criterion of glucose.

64

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

2.7. Antioxidant enzyme activities

2.9. Statistical analysis

After 10 days of NaCl treatment, enzymes were extracted from the second fully expanded leaves (0.5 g). The samples were homogenized in liquid nitrogen and brought up to a volume of 5 mL by cold sodium phosphate buffer solution (pH 7.8). The homogenates were centrifuged at 12,000 × g at 4 ◦ C for 15 min, after which the supernatants were immediately used for determination of enzyme activity. The total soluble protein was determined using the Bradford method (Nounjan, Nghia, & Theerakulpisut, 2012). A total of 100 ␮L of supernatant and 5 mL of Coomassie brilliant blue G250 staining were mixed, and the absorbance was read at 595 nm. Protein concentration was quantified by comparison with a standard curve using bovine serum albumin. SOD activity was assayed by the inhibition of the photochemical reduction of ␤-nitro blue tetrazolium chloride (NBT) (Rasool, Ahmad, Siddiqi, & Ahmad, 2012). One unit of SOD was defined as the amount of enzyme needed to produce a 50% inhibition of NBT reduction at 560 nm. The activity of CAT was calculated based on the rate of disappearance of H2 O2 , which was measured as a decline in the absorbance at 240 nm. The CAT activity was expressed as H2 O2 reduced min−1 mg−1 protein (Nounjan et al., 2012). To determine POD activity, the method described by Seckin et al. (2008) was used. The absorbance was then measured at 470 nm. The activity of POD was calculated from the rate of formation of guaiacol dehydrogenation product and expressed as ␮mol GDHP min−1 mg−1 protein.

Each test was performed in triplicate, and the results were averaged. Data were subjected to ANOVA analysis by SPSS (version 19.0) and Duncan’s multiple range tests (P < 0.05) to compare the mean value of different treatments. Each of the data points was expressed as the average ± SD of three independent replicates.

2.8. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of genes expression Total RNA was extracted from wheat leaves (0.2 g) using PureLink® RNA Mini Kit (Life Technologies, USA). Total RNA was quantified by UV spectrophotometer. First-strand cDNA was synthesized by RevertAidTM First Strand cDNA Synthesis Kit (Takara, Dalian, China). qRT-PCR was performed in an Eppendorf Master cycler (Eppendorf, Hamburg, Germany) using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously (Li, Sun, Xiao, & Sun, 2013). Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The expression level of gene was analyzed using comparative threshold cycle method (2−Ct ) with ␤-actin as the control. Specific primers for each gene were designed in Table 1.

Table 1 DNA sequences of PCR primers were used for qPCR determination of the salt-related genes in wheat seedlings. Gene

Accession

Primer pairs

NHX2

AY040246

SOS1

AY326952

SOD

KC158224.1

POD

X53675.1

Fa : TTCCAACCAGAACCAACCC Rb : GTCCTTCATCGCTGAGACTTTT F: CGGAGGGTGGATTGAACGA R: GCAGGGCGGTAGGAGAAGAT F: GCCTTTTGGCCTCTTTATCC R: AACCTCAAGCCCATCAGCG F: CAGCCCTGTAGCCAACATAAA R: GCACTTCCACGACTGCTTTG F: GGCTGCTTGAAGTTGTTCTCCT R: CTGCTAGTACCTCCTGATCCGTT F: CTCTGACAATTTCCCGCTCA R: ACACGCTTCCTCATGCTATCC

CAT

GU984379.1

␤-actin

AB181991

a b

Forward primer. Reverse primer.

3. Results and discussion 3.1. Preparation of COS with different DAs The DA value of highly deacetylated COS is 2%, and the Mw of COS with DA 2% measured by high performance liquid chromatography (HPLC) is approximately 1300 Da (Fig. S1). After acetylated, the DA of COS measured by ultraviolet spectrophotometry is 29, 50 and 68%, respectively. In hydro-alcoholic solution, the acetylation reaction has selectivity and amino group was preferable to hydroxyl group (Freier, Koh, Kazazian, & Shoichet, 2005). Fig. S2 depicts the FT-IR spectrum of COS with DA 2 and 50%. Compared with the FT-IR spectra of COS with DA 2%, the spectra COS with DA 50% exhibited some differences in the range of the wave numbers 1700–1300 cm−1 . After acetylation, the bands at 1641 and 1567 cm−1 corresponding to the characteristic absorbance peak of NH3+ shifted to high wave number. In addition, the band at 1317 cm−1 appeared in the spectra of COS with DA 50%. It was worthwhile to note that the band at around 1735 cm−1 did not appear after acetylation, which was assigned to the absorbance peak of COO-reported by prior studies on acetylation of chitosan (Huang & Liu, 2005). Therefore, in our conditions, the acetylation only occurred on the free amino group but not on the hydroxyl group and the acetylated product was an N-acetylated COS mixture. 3.2. Plant growth and biomass accumulation Although there are reports showing COS could enhance the tolerance of plants to abiotic stress, the exact physiological mechanisms are not fully understood as of yet. In this study, we investigated the effect of exogenous COSs with different DAs on wheat seedlings under salt stress. The results showed that exogenous COSs, depending on their DAs, increased biomass of plants, decreased the content of MDA, increased the photosynthetic efficiency and improved antioxidant activities of SOD, POD and CAT of wheat seedlings. Additionally, plants treated with COS with DA of 50% exhibited higher tolerance to salt stress. As shown in Table 2, shoot length, wet weight and dry weight were significantly inhibited under 100 mM NaCl treatment (P < 0.05). However, shoot length, wet weight and dry weight were increased in plants treated with COSs with different DAs under salt stress. Furthermore, wet weight and dry weight of wheat treated with DA 50% COS were higher than those treated with other DAs (P < 0.05).

Table 2 Effects of COSs on growth parameters of wheat seedlings. Values are mean ± SD of 3 replicates. Different letters indicate significant differences at P < 0.05. Shoot length (cm) CK NaCl SA + NaCl DA2%COS + NaCl DA29%COS + NaCl DA50%COS + NaCl DA68%COS + NaCl

24.8 19.1 22.1 20.6 20.9 21.5 21.4

± ± ± ± ± ± ±

0.6a 0.7e 0.4b 0.4d 0.3d 0.4c 0.5c

Wet weight (g) 0.362 0.252 0.315 0.289 0.301 0.352 0.330

± ± ± ± ± ± ±

0.034a 0.015e 0.015c 0.021d 0.027cd 0.022a 0.021b

Dry weight (g) 0.047 0.036 0.046 0.041 0.044 0.054 0.050

± ± ± ± ± ± ±

0.006c 0.002f 0.002cd 0.003e 0.004d 0.004a 0.003b

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

Fig. 1. Effect of COSs on MDA content in leaves of Jimai-22. Values are the mean ± SD of three replicates. Different letters indicate significant differences at P < 0.05.

3.3. Lipid peroxidation degree Detection of MDA, a product of lipid peroxidation, is generally an indicator of free radical damage to cell membranes caused by severe oxidative stress. The results showed that MDA content in leaves of wheat seedlings (Fig. 1) increased dramatically by 88% responding to NaCl stress (P < 0.05). COSs with different DAs appeared to reduce MDA content, especially DA 50% and DA 68% COS, which reduced MDA content to 69.1% (P < 0.05) and 64.3% (P < 0.05) separately in comparison with NaCl-stressed plants. The exogenous COS treatment could effectively ameliorate NaCl induced oxidative stress, suggesting that COS might play crucial roles in scavenging radicals and thus preventing lipid peroxidation by excess active oxygen produced under salt stress. Moreover, DA 50% and DA 68% COS reduced MDA content much more than other groups when compared to NaCl-stressed plants. 3.4. Chlorophyll content and photosynthetic characters Chlorophyll content is widely used as an index of abiotic tolerance in plants. Plants exposed to stress environments such as salinity result in decreased chlorophyll concentration thereby leading to overall growth retardation (Sudhir & Murthy, 2004). In this work, compared with the control, Chl-b and total chlorophyll (Table 3) contents significantly decreased under NaCl stress by 37.8% (P < 0.05) and 16.7% (P < 0.05), respectively, and there was no difference in Chl-a content between NaCl stress and the control. Plants treated with COSs of different DAs had increased Chl-a contents but with no obvious variation trend; the Chl-b and total chlorophyll contents of DA 50% COS were significantly higher than Table 3 Effects of COSs on chlorophyll contents of wheat seedlings. Values are mean ± SD of 3 replicates. Different letters indicate significant differences at P < 0.05. Chl-a (mg g−1 ) CK NaCl SA + NaCl DA2%COS + NaCl DA29%COS + NaCl DA50%COS + NaCl DA68%COS + NaCl

0.998 0.907 1.108 1.212 1.222 1.379 1.253

± ± ± ± ± ± ±

Chl-b (mg g−1 ) c

0.145 0.035c 0.065bc 0.030ab 0.092ab 0.169a 0.109ab

0.347 0.216 0.411 0.434 0.455 0.524 0.489

± ± ± ± ± ± ±

Chl (a + b) (mg g−1 ) c

0.037 0.031d 0.056b 0.001b 0.028b 0.033a 0.047b

1.345 1.121 1.519 1.646 1.677 1.903 1.742

± ± ± ± ± ± ±

0.182c 0.06d 0.119bc 0.030b 0.118b 0.145a 0.077b

65

DA 2%, DA 29% and DA 68% COS (P < 0.05). Improvement in plant growth for plants treated with COS under various stressors is determined by an increase in chlorophylls and photosynthetic efficiency. In this work, plants treated with salt exhibited significant decreases in Chl-b and total chlorophyll contents compared with control, whereas COSs with different DAs led to a significant increase under NaCl stress. The result indicated that COS prevented chlorophyll degradation in the salt-stressed wheat seedling leaves. Chlorophyll fluorescence is a primary indication of the beginning of photosynthesis (Sayed, 2003). Fv/Fm, qP and NPQ values can be used as credible indicators to determine the function of photosynthetic apparatus. Under normal condition without salt stress, the maximal efficiency of PSII photochemistry (Fv/Fm) is approximately 0.83, when stressed with NaCl, it slipped to 0.79 (P < 0.05) (Table 4). The decrease in Fv/Fm value is generally associated with damage in chloroplasts, especially in thylakoid membranes (Kamal et al., 2013). COSs with different DAs recovered the values of Fv/Fm to 0.83. Salt stress also reduced the values of ФPSII and qP (P < 0.05), which significantly increased when COSs with different DAs were applied (P < 0.05). The values of qP were significantly reduced under salt stress, suggesting that salinity induced an inhibition of electron transfer from the primary acceptor plastoquinone (QA) to the secondary acceptor plastoquinone (QB) at the acceptor side of PSII (Mehta, Jajoo, Mathur, & Bharti, 2010). Conversely, salt stress caused a significant increase in NPQ value (P < 0.05), whereas COSs with different DAs brought it down but not to the normal level. The value of NPQ remarkably increased under salt stress indicating that antenna pigment could not transform light energy into chemical energy effectively and therefore was dissipated as heat (Shu, Yuan, Guo, Sun, & Yuan, 2013). When treated with COSs with different DAs, the value of NPQ remarkably decreased illustrating that COS improved the light utilization efficiency. It was reported that many stresses can lead to a decrease in the photochemical efficiency and electron transport activity due to the changes in the structure of the photosynthetic apparatus (Mittal, Kumari, & Sharma, 2012). Our results suggest that COS can modulate the intracellular ion concentrations and ensures the electrons transfer ability; these are associated with its enhanced capacity for antioxidant enzymes which helps prevent membrane degradation in the granal and stromal thylakoids under NaCl stress (Omoto, Taniguchi, & Miyake, 2010). It is generally recognized that growth inhibition by salt stress is mainly due to stomatal and non-stomatal limitation on photosynthesis (Chen et al., 2005). The results showed that treatment with salt, sharply reduced gs (P < 0.05) (Table 5), which was caused by an excessive accumulation of Na+ ion in the guard cells, leading to a decrease in available Ci as indicated. Closure of stomata and reduction of the availability of Ci leaded to Pn reduction. In this work, samples treated with NaCl had a 23% reduction in Pn compared with control (P < 0.05), which is in agreement with previous findings by Khan, Siddiqui, Mohammad, and Naeem (2009). When treated with COSs with different DAs, the value of Pn increased by 82, 105, 137 and 123%, separately (P < 0.05). The responding trends of gs and E were similar with Pn. However, Ci had a different trend. Under NaCl stress, Ci was obviously lower than the control group (P < 0.05), while Ci of COS groups with different DAs decreased as well in comparison with the NaCl stress group. This result suggests that COS alleviated the stomata closure caused by salt stress and promoted the use of CO2 . The remission of stomatal closure may also contribute to the regulation of ions in stomata guard cells. Overall, the promotion effect of COS on photosynthesis was reflected in the content of soluble sugar content (Fig. 2). Under NaCl stress, soluble sugar content in leaves of wheat seedlings decreased by 11% when compared with control (P < 0.05). When the samples were treated with COSs with different DAs, soluble sugar content markedly increased (P < 0.05), soluble sugar content

66

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

Table 4 Effects of COSs on photosynthetic characters of wheat seedlings. Values are mean ± SD of 3 replicates. Different letters indicate significant differences at P < 0.05.

ФPSII CK NaCl SA + NaCl DA2%COS + NaCl DA29%COS + NaCl DA50%COS + NaCl DA68%COS + NaCl

0.59 0.44 0.57 0.54 0.56 0.60 0.57

Fv/Fm

± ± ± ± ± ± ±

0.04a 0.07c 0.05ab 0.05b 0.03ab 0.05a 0.03ab

0.83 0.79 0.83 0.83 0.83 0.83 0.83

qP

± ± ± ± ± ± ±

0.01b 0.89a 1.40b 0.01b 0.00b 0.01b 0.01b

0.77 0.58 0.68 0.68 0.69 0.76 0.72

NPQ ± ± ± ± ± ± ±

0.03a 0.13c 0.08b 0.06b 0.06ab 0.09ab 0.08ab

0.42 0.64 0.55 0.59 0.58 0.52 0.54

± ± ± ± ± ± ±

0.07c 0.09a 0.09b 0.05ab 0.05ab 0.08b 0.11b

Table 5 Effects of COSs on photosynthetic fluorescence of wheat seedlings. Values are mean ± SD of 3 replicates. Different letters indicate significant differences at P < 0.05. Ci (␮mol m−2 s) CK NaCl SA + NaCl DA2%COS + NaCl DA29%COS + NaCl DA50%COS + NaCl DA68%COS + NaCl

372.40 344.45 324.73 323.82 319.82 317.42 321.25

± ± ± ± ± ± ±

5.04a 7.01b 14.42c 28.80c 22.41c 34.84c 24.14c

E (mol m−2 s−1 ) 10.93 8.15 8.93 8.71 9.52 10.66 10.13

± ± ± ± ± ± ±

1.12a 0.89c 1.40abc 2.07bc 2.07abc 3.51ab 2.54abc

gs (mol m−2 s−1 ) 1.28 0.60 0.68 0.64 0.70 0.97 0.83

± ± ± ± ± ± ±

0.18a 0.12d 0.14cd 0.21cd 0.18cd 0.23b 0.20bc

Pn (␮mol m−2 s−1 ) 14.90 11.42 23.75 20.80 23.46 27.02 25.45

± ± ± ± ± ± ±

1.70e 1.96d 4.72bc 3.68bc 3.02bc 3.45a 2.57ab

salt stress were determined. Our results show that exogenous COS can raise CAT and POD activities in wheat seedlings compared to the NaCl stress group. In general, these results indicated that exogenous COS was able to effectively scavenge ROS by enhancing the activities of antioxidant enzymes in wheat seedlings under salt stress and consequently play an important role in decreasing lipid peroxidation and increasing the ability of wheat to resist salt stress. 3.6. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of genes expression

Fig. 2. Effect of COSs on soluble sugar content in leaves of Jimai-22. Values are the mean ± SD of three replicates. Different letters indicate significant differences at P < 0.05.

of DA 50% was significantly higher than that of DA 68%, DA 29% and DA 2% (P < 0.05). 3.5. Antioxidant enzymes activities SOD is a critical enzyme responsible for the elimination of O2 •− in cells. Increased SOD activity correlated with increased protection from damage of oxidative stress (Apel & Hirt, 2004). The results from our study showed that NaCl stress induced higher SOD, POD and CAT activities than those in the control (P < 0.05) (Fig. 3a–c). Treatment with COSs with different DAs further resulted in an increase of SOD, POD and CAT activities in wheat (P < 0.05). These results suggest that COS-treated seedlings have better O2 •− scavenging ability to protect the plant from oxidative damage. Furthermore, SOD activity in leaves of wheat treated with DA 50% COS was significantly higher than the other groups. SOD initiates detoxification of O2 •− by forming H2 O2 , which is also toxic and must be eliminated by the concerted action of CAT and POD. Therefore, the effect of COS on POD, CAT activities in wheat seedlings under

Transcriptional responses of COS enhancing antioxidant enzyme activities is not completely understood. Previous research has shown that COS can reduce oxidative stress by increasing the activities of antioxidant enzymes; however, little is known about the expression alteration of antioxidant enzymes genes at the transcriptional level. Therefore, expression of three antioxidant enzyme genes in wheat under salt stress was analyzed by quantitative RTPCR. Our analysis showed that compared with the control, NaCl stress induced higher transcript levels of the SOD, POD and CAT genes (Fig. 4). Treatment with COSs with different DAs further resulted in up-regulated expression of SOD, POD and CAT genes. The transcript level of SOD, POD and CAT genes in leaves of wheat treated with DA 50% COS was significantly higher than the other groups (P < 0.05). These results are in agreement with that of Qiu, Guo, Zhu, Zhang, and Zhang (2014) who showed that jasmonic acid increased the transcript level of CAT in wheat under salt stress. Furthermore, in this study, the changes in transcript levels of genes encoding antioxidant enzymes (SOD, POD and CAT) in wheat seedlings under salt stress mainly coincide with the trend in activities of the corresponding enzymes. However, it is noteworthy that gene expression is characterized by only one isoenzyme of one gene family, whereas enzyme measurements typically include all expressed members of such a family. Moreover, enzyme activities can be affected by a number of feedback regulations, so the slight lack of correlation between gene expression and enzyme activity is not surprising (Rasool et al., 2012). Additionally, expression of two Na+ /H+ antiporter genes in wheat seedlings under salt stress were analyzed as well. Under salt stress, the extra Na+ ions in cytosol can be exported to extracellular through Na+ /H+ exchangers localized in the plasma membrane

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

67

Fig. 4. Effect of COSs with different DAs on SOD, POD and CAT relative transcript level in wheat seedlings under NaCl stress for 10 days. Relative SOD, POD and CAT transcript expression take control as 1. Values are the mean ± SD of three replicates. Different letters indicate significant differences at P < 0.05.

and to vacuole through Na+ /H+ exchangers localized in tonoplast membrane (Yamaguchi, Hamamoto, & Uozumi, 2013). Several important plasma membrane exchangers, such as SOS1, a highly conserved protein in mediating Na+ transportation in Arabidopsis and halophyte Puccinellia tenuiflora have important functions in regulating the cytosolic Na+ efflux (Qiu, Guo, Dietrich, Schumaker, & Zhu, 2002). In addition to the plasma membrane exchanger, the Na+ compartmentation into the vacuoles mediated by endosomal Na+ /H+ antiporters such as NHX-like also acts as a critical mechanism to alleviate the Na+ toxic effects (Apse & Blumwald, 2007). In this work, the results (Fig. 5) showed that the SOS1 gene expression was up-regulated while the NHX2 gene was down-regulated under salt stress. The transcript levels of NHX2 and SOS1 genes treated with DA 50% COS were significantly higher than those of

Fig. 3. Effect of COSs on SOD (a), POD (b) and CAT (c) activity in leaves of Jimai-22. Values are the mean ± SD of three replicates. Different letters indicate significant differences at P < 0.05.

Fig. 5. Effect of COSs with different DAs on NHX2 and SOS1 relative transcript level in wheat seedlings under NaCl stress for 10 days. Relative NHX2 and SOS1 transcript expression compared to control represented as 1. Values are mean ± SD of three replicates. Different letters indicate significant differences at P < 0.05.

68

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69

the other groups (P < 0.05). Our results indicated that NHX2 and SOS1 genes play important roles in regulating the Na+ transportation under high salinity, alleviating the Na+ damage effects. And the Na+ /H+ exchangers in plants synergically function to cope with the extra cytosolic Na+ when plants are exposed to a high-salinity condition. COS with DA 50% had more effective activities of alleviating salt stress to wheat than those with other DAs, which indicated the activities of COS was closely related with the degrees of substitution of acetyl group. When researching the antibacterial effect of chitosan to a pathogen, it is found that a lower acetylated degree chitosan has a better inhibitory effect than those with medium and higher acetylated degrees (Falcón et al., 2007). However, Maksimov found that treatment with COS with DA 65% activated higher anionic peroxidase activity than that with DA 13% (Maksimov et al., 2013). As Alejandro concluded in his study, less acetylated and degraded chitosan were better for direct inhibition of pathogen growth, and partially acetylated and degraded chitosan were suitable to protect tobacco against Phytophthora parasitica by systemic induction of plant resistance (Falcón et al., 2007). The observed elicitor activity of COSs with DA 50% and the other DAs may be explained by a mechanism dependent on specific receptors. Liu et al. (2012) found a chitin elicitor receptor kinase1 of Arabidopsis (AtCERK1) directly binds chitin to activate immune responses. The interaction is dependent on specific recognition of the N-acetyl moieties, which suggest that N-acetyl plays an important role in inducing its activation. COSs with different DAs may form various structures to interact with elicitor receptor on plant cell membrane because of their strict structural requirement. Mitsuo, Masatoshi, Yuki, and Naoto (2002) found the presence of high-affinity binding sites/proteins for N-acetyl chitooligosaccharide elicitor in the plasma membrane preparation from suspension-cultured carrot cells, barley cells and wheat leaves. The research indicates the function of these plasma membrane proteins is in the perception of the elicitor signal; however, the mechanisms of recognition of elicitors such as COS and signal transduction of plant needed to be further studied. 4. Conclusions In this study, we exposed wheat seedlings to 100 mM salt solution and investigated the effect of exogenous COSs with different DAs of 2, 29, 50 and 68% on wheat tolerance to salt stress. The results showed that treatments with exogenous COSs with different DAs increased the biomass of wheat seedlings; decreased the concentration of MDA; increased the contents of chlorophyll content, fluorescence and photosynthetic characters; and improved antioxidant activities of SOD, POD and CAT. To explore the physiological mechanisms of COS with different DAs on wheat tolerance to salt stress, expression of a series of salt-associated genes in wheat was analyzed using quantitative RT-PCR. The results illustrated that COS could protect plants from salt stress damage by modulating intracellular ions concentration and enhancing the capacity of antioxidant enzymes activities. Furthermore, COS with DA 50% had more effective activities of alleviating salt stress to wheat seedlings than those with other DAs, which indicated the degrees of substitution of acetyl group play important roles in the activities of COS. Acknowledgements The work was supported by the National Natural Science Foundation of China (No. 41406086), NSFC-Shandong joint fund (U1406402-5), the Public Science and Technology Research Funds Projects of Ocean (No. 201305016-2 and No. 201405038-2).

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.carbpol.2015.03.028. References Apel, K., & Hirt, H. (2004). Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review Plant Biology, 55, 373–399. Apse, M. P., & Blumwald, E. (2007). Na+ transport in plants. FEBS Letters, 581(12), 2247–2254. Bose, J., Rodrigo-Moreno, A., & Shabala, S. (2013). ROS homeostasis in halophytes in the context of salinity stress tolerance. Journal of Experimental Botany, 65(5), 1241–1257. Chen, Z. H., Newman, I., Zhou, M. X., Mendham, N., Zhang, G. P., & Shabala, S. (2005). Screening plants for salt tolerance by measuring K+ flux: A case study for barley. Plant Cell and Environment, 28(10), 1230–1246. Diby, P., & Harshad, L. (2014). Plant-growth-promoting rhizobacteria to improve crop growth in saline soils: A review. Agronomy for Sustainable Development, 34(4), 737–752. Falcón, A. B., Cabrera, J. C., Costales, D., Ramírez, M. A., Cabrera, G., Toledo, V., et al. (2007). The effect of size and acetylation degree of chitosan derivatives on tobacco plant protection against Phytophthora parasitica nicotianae. World Journal of Microbiology and Biotechnology, 24(1), 103–112. Freier, T., Koh, H. S., Kazazian, K., & Shoichet, M. S. (2005). Controlling cell adhesion and degradation of chitosan films by N-acetylation. Biomaterials, 26(29), 5872–5878. Huang, L., & Liu, C. (2005). Preparation of hydrophobing acyl chitosan with long fatly chain. Journal of Huachiao University, 26(4), 439–441. Jabeen, N., & Ahmad, R. (2013). The activity of antioxidant enzymes in response to salt stress in safflower (Carthamus tinctorius L.) and sunflower (Helianthus annuus L.) seedlings raised from seed treated with chitosan. Journal of Science Food Agriculture, 93(7), 1699–1705. Je, J. Y., & Kim, S. K. (2006). Reactive oxygen species scavenging activity of aminoderivatized chitosan with different degree of deacetylation. Bioorganic & Medicinal Chemistry, 14(17), 5989–5994. Kamal, A. M., Cho, K., Choi, J. S., Bae, K. H., Komatsu, S., Uozumi, N., et al. (2013). The wheat chloroplastic proteome. Journal of Proteomics, 93, 326–342. Kasaai, M. R. (2010). Determination of the degree of N-acetylation for chitin and chitosan by various NMR spectroscopy techniques: A review. Carbohydrate Polymers, 79(4), 801–810. Kulikov, S. N., Chirkov, S. N., Ilina, A. V., Lopatin, S. A., & Varlamov, V. P. (2006). Effect of the molecular weight of chitosan on its antiviral activity in plants. Prikladnaia Biokhimiia i Mikrobiologiia, 42(2), 224–228. Li, B., Liu, B., Shan, C., Ibrahim, M., Lou, Y., Wang, Y., et al. (2013). Antibacterial activity of two chitosan solutions and their effect on rice bacterial leaf blight and leaf streak. Pest Management Science, 69(2), 312–320. Li, K. C., Liu, S., Xing, R. E., Qin, Y. K., & Li, P. C. (2013). Preparation, characterization and antioxidant activity of two partially N-acetylated chitotrioses. Carbohydrate Polymers, 92, 1730–1736. Li, K. C., Xing, R. E., Liu, S., Qin, Y. K., Meng, X. T., & Li, P. C. (2012). Microwave-assisted degradation of chitosan for a possible use in inhibiting crop pathogenic fungi. International Journal of Biological Macromolecules, 51, 767–773. Li, M. F., Sun, B. G., Xiao, Z. Z., & Sun, L. (2013). First characterization of a teleost Epstein–Barr virus-induced gene 3 (EBI3) reveals a regulatory effect of EBI3 on the innate immune response of peripheral blood leukocytes. Developmental and Comparative Immunology, 41(4), 514–522. Liu, T., Liu, Z., Song, C., Hu, Y., Han, Z., She, J., et al. (2012). Chitin-induced dimerization activates a plant immune receptor. Science, 336(6085), 1160–1164. Ma, Z. X., Yang, L. Y., Yan, H. X., Kennedy, J. F., & Meng, X. H. (2013). Chitosan and oligochitosan enhance the resistance of peach fruit to brown rot. Carbohydrate Polymers, 94, 272–277. Maksimov, I. V., Valeev, A. S., Cherepanova, E. A., & Burkhanova, G. F. (2013). Effect of chitooligosaccharides with different degrees of acetylation on the activity of wheat pathogen-inducible anionic peroxidase. Applied Biochemistry and Microbiology, 50(1), 82–87. Mehta, P., Jajoo, A., Mathur, S., & Bharti, S. (2010). Chlorophyll a fluorescence study revealing effects of high salt stress on photosystem II in wheat leaves. Plant Physiology and Biochemistry, 48(1), 16–20. Meng, X. H., Yang, L. Y., Kennedy, J. F., & Tian, S. P. (2010). Effects of chitosan and oligochitosan on growth of two fungal pathogens and physiological properties in pear fruit. Carbohydrate Polymers, 81, 70–75. Mittal, S., Kumari, N., & Sharma, V. (2012). Differential response of salt stress on Brassica juncea: Photosynthetic performance, pigment, proline, D1 and antioxidant enzymes. Plant Physiology and Biochemistry, 54, 17–26. Mittler, R., Vanderauwera, S., Gollery, M., & Breusegem, F. V. (2004). Reactive oxygen gene network of plants. Trends in Plant Science, 9(10), 490–498. Mitsuo, O., Masatoshi, M., Yuki, I., & Naoto, S. (2002). High-affinity binding proteins for N-acetylchitooligosaccharide elicitor in the plasma membranes from wheat, barley and carrot cells: Conserved presence and correlation with the responsiveness to the elicitor. Plant and Cell Physiology, 43(5), 505–512. Munns, R. (2002). Comparative physiology of salt and water stress. Plant Cell and Environment, 25(2), 239–250.

P. Zou et al. / Carbohydrate Polymers 126 (2015) 62–69 Muzzarelli, R. A. A., & Rocchetti, R. (1985). Determination of the degree of acetylation of chitosans by first derivative ultraviolet spectrophotometry. Carbohydrate Polymers, 5(6), 461–472. Nasir, K. M., Siddiqui, M. H., Mohammad, F., Naeem, M., & Khan, M. M. (2009). Calcium chloride and gibberellic acid protect linseed (Linum usitatissimum L.) from NaCl stress by inducing antioxidative defence system and osmoprotectant accumulation. Acta Physiologiae Plantarum, 32(1), 121–132. Nguyen, A. D., Vo, T. P. K., & Tran, T. D. (2011). Research on impact of chitosan oligomers on biophysical characteristics, growth, development and drought resistance of coffee. Carbohydrate Polymers, 84, 751–755. Nounjan, N., Nghia, P. T., & Theerakulpisut, P. (2012). Exogenous proline and trehalose promote recovery of rice seedlings from salt-stress and differentially modulate antioxidant enzymes and expression of related genes. Journal of Plant Physiology, 169(6), 596–604. Omoto, E., Taniguchi, M., & Miyake, H. (2010). Effects of salinity stress on the structure of bundle sheath and mesophyll chloroplasts in NAD-malic enzyme and PCK type C-4 plants. Plant Production Science, 13(2), 169–176. Pongprayoon, W., Roytrakul, S., Pichayangkura, R., & Chadchawan, S. (2013). The role of hydrogen peroxide in chitosan-induced resistance to osmotic stress in rice (Oryza sativa L.). Plant Growth Regulation, 70(2), 159–173. Qiu, Q. S., Guo, Y., Dietrich, M. A., Schumaker, K. S., & Zhu, J. K. (2002). Regulation of SOS1, a plasma membrane Na+ /H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proceedings of the National Academy of Sciences of the United States of America, 99(12), 8436–8441. Qiu, Z., Guo, J., Zhu, A., Zhang, L., & Zhang, M. (2014). Exogenous jasmonic acid can enhance tolerance of wheat seedlings to salt stress. Ecotoxicology and Environmental Safety, 104, 202–208.

69

Rabea, E. I., El Badawy, M. T., Rogge, T. M., Stevens, C. V., Höfte, M., Steurbaut, W., et al. (2005). Insecticidal and fungicidal activity of new synthesized chitosan derivatives. Pest Management Science, 61, 951–960. Rasool, S., Ahmad, A., Siddiqi, T. O., & Ahmad, P. (2012). Changes in growth, lipid peroxidation and some key antioxidant enzymes in chickpea genotypes under salt stress. Acta Physiologiae Plantarum, 35(4), 1039–1050. Rivero, R. M., Mestre, T. C., Mittler, R., Rubio, F., Sanchez, F. G., & Martinez, V. (2014). The combined effect of salinity and heat reveals a specific physiological, biochemical and molecular response in tomato plants. Plant, Cell and Environment, 37, 1059–1073. Sayed, O. H. (2003). Chlorophyll fluorescence as a tool in cereal crop research. Photosynthetica, 41(3), 321–330. Seckin, B., Sekmen, A. H., & Türkan, I˙ . (2008). An enhancing effect of exogenous mannitol on the antioxidant enzyme activities in roots of wheat under salt stress. Journal of Plant Growth Regulation, 28(1), 12–20. Shu, S., Yuan, L. Y., Guo, S. R., Sun, J., & Yuan, Y. H. (2013). Effects of exogenous spermine on chlorophyll fluorescence, antioxidant system and ultrastructure of chloroplasts in Cucumis sativus L. under salt stress. Plant Physiology and Biochemistry, 63, 209–216. Song, Q., Li, Q., Li, G., & Ding, C. (2005). Preparation of highly deacetylated chitosan by phase transfer catalyst. Chinese Journal of Synthetic Chemistry, 13(2), 187–189. Souza, F. V., Hallan, R., Mirelli, T., & Oliveira, P. R. (2013). Hydrophobic effect of amphiphilic derivatives of chitosan on the antifungal activity against Aspergillus flavus and Aspergillus parasiticus. Molecules, 18(4), 4437–4450. Sudhir, P., & Murthy, S. D. S. (2004). Effects of salt stress on basic processes of photosynthesis. Photosynthetica, 42(4), 481–486. Yamaguchi, T., Hamamoto, S., & Uozumi, N. (2013). Sodium transport system in plant cells. Frontiers in Plant Science, 4, 1–9.