- Email: [email protected]
Effect of dietary supplementation of fish oil for lactating sows and weaned piglets on piglet Th polarization
Livestock Science 126 (2009) 286–291
Contents lists available at ScienceDirect
Livestock Science j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / l i v s c i
Effect of dietary supplementation of fish oil for lactating sows and weaned piglets on piglet Th polarization J. Luo a, F.R. Huang a, C.L. Xiao a, W. Chen a, S.W. Jiang b,⁎, J. Peng a,⁎ a
Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China Key Laboratory of Swine Breeding and Genetics of the Agricultural Ministry, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China
b
a r t i c l e
i n f o
Article history: Received 28 April 2009 Received in revised form 30 July 2009 Accepted 8 August 2009 Keywords: Fish oil IFN-γ IL-10 Th polarization Piglets
a b s t r a c t The present study was designed to investigate the effect of dietary fish oil supplementation on piglet T helper cells (Th) polarization in relation to its impact on piglet serum interferon γ (IFN-γ) and interleukin 10 (IL-10) concentrations and splenic expression of Th1/Th2 characteristic genes. The diets of 18 gestating sows were supplemented with 7% lard (C) (n = 10) or 7% fish oil (T) (n = 8) from 10 d before parturition to weaning. At weaning, a split plot experiment was designed, 56 piglets, 28 each from sows fed with fish oil diet or lard diet, were divided into four groups of 7 replicates (one female and one castrated male per replicate) based on both sow diet during lactation and post-weaning piglet diet (C had 7% lard and T had 7% fish oil): CC, CT, TC, TT, and were fed the 7% fish oil or lard diet from day 35 to day 70. Serum concentrations of IFN-γ and IL-10, and Th1/Th2 related genes expression levels in spleen were measured and analyzed. The results showed that piglets fed with fish oil diet during postweaning tended to have higher serum IFN-γ/IL-10 ratio (P = 0.09) than lard diet fed piglets. Lactation fish oil feeding increased splenic IL-12b, IL-12 receptor β2 (IL-12Rβ2), IL-2 and IFN-γ genes expression (P b 0.05 or P b 0.01) and post-weaning fish oil feeding increased splenic IL12b (P = 0.06), IL-2 (P b 0.01) and IFN-γ (P = 0.08) mRNA expression than that in lard diet fed piglets at the end of this experiment. On the other hand, IL-4 gene expression (P = 0.01) in spleen was lower in weaned piglet from fish oil diet fed sows than that from lard diet fed sows. However, post-weaning piglets fed fish oil diet had higher splenic IL-4 (P = 0.06), IL-6 (P b 0.01) and IL-10 (P = 0.05) mRNA abundances than that fed with lard diet. These results indicated that dietary fish oil during lactation could increase Th1 polarization and accelerate immune maturation; while 7% fish oil in weaned piglets' diet was likely to increase Th2 cytokines expression. © 2009 Published by Elsevier B.V.
1. Introduction The T-lymphocyte exerts its modulatory properties by proliferating in response to stimulation and producing various cytokines. Cytokines derived from the T helper lymphocytes (Th) are categorized as Th1 or Th2. The Th1 cytokines including
⁎ Corresponding authors. Peng is to be contacted Tel.: +86 27 87280122; fax: +86 27 87280408. Jiang, Tel.: +86 27 87284241; fax: +86 27 87280408. E-mail addresses: [email protected] (S.W. Jiang), [email protected] (J. Peng). 1871-1413/$ – see front matter © 2009 Published by Elsevier B.V. doi:10.1016/j.livsci.2009.08.002
interleukin-2 (IL-2), interferon-γ (IFN-γ), and tumor necrosis factor (TNF) influence cell-mediated immunity; while the Th2 cytokines, IL-4, IL-5, IL-6, and IL-10, regulate humoral or antibody-mediated immunity (Liblau et al., 1995). The differentiations of Th1/Th2 are regulated by some cytokines. IL-12 binds to the IL-12 receptor on naïve CD4+ T cells and induces them differentiate into Th1, leading to cytokines secretion such as IFN-γ and IL-2 (Reviewed by Agnello et al., 2003)., whereas, IL-4 regulates Th2 cytokines (such as IL-4 and IL-10) via inducing GATA-3 (GATA binding transcription factor 3) expression, which leads to Th2 differentiation (Reviewed by Agnello et al., 2003).
J. Luo et al. / Livestock Science 126 (2009) 286–291
Neonates are born with an immature immune system, characterized by a reduced ability to produce a number of cytokines (Field et al., 2001) and likely a Th2-polarization (Field, 2005). Immune maturation seems to be characterized by a Th1-polarization and an improvement in the capacity to produce cytokines such as INF-γ and IL-2 (Field et al., 2001). A faster immune maturation and Th1 polarization could result in better immune functioning (Lauritzen et al., 2005). Modulating Th1/Th2 balance may impact the immune maturation and the ability to defend against infections in young animal. (n-3) polyunsaturated fatty acids (PUFA) have antiinflammatory and immunomodulatory effect. Dietary fish oil, rich in (n-3) PUFA, possesses potent anti-inflammatory properties in human and rodent autoimmune disease models (Endres et al., 1989; Venkatraman et al., 1994; Kew et al., 2003). Most trials have shown a suppression of cytokine production with fish oil supplementation, especially TNF-α, IL-6, and IL-1β from peripheral immune cells (Endres et al., 1989; Meydani et al., 1991). However, an anti-inflammatory effect of (n-3) PUFA in early life may impair neonate protection and defense against infections (Damsgaard et al., 2007). Thus, the possible effects of (n-3) PUFA on innate immunity and the capacity to polarize Th toward a Th1response or a Th2-response are key points of interest. The (n-3) PUFA are thought to have immunosuppressive effects, but their immunomodulatory potential in young piglet has not been elucidated. To date, there were merely few randomized trials which investigated the effects of fish oil supplementation in infancy on immune function, and only measured the cytokines concentrations in whole-blood cultures challenged with antigens (Lauritzen et al., 2005; Damsgaard et al., 2007). Therefore, 7% of fish oil or lard were added to late gestation–lactating sow's diet and/or postweaning piglet's diet to study the effect of (n-3) PUFA supplementation on Th polarization and immune maturation in healthy piglets via determined serum IFN-γ and IL-10 concentrations and splenic IL-12b, IL-12 receptor β2 (IL12Rβ2), IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes expression. 2. Materials and methods 2.1. Animals and diets The study was approved by the Animal Care Committee at the Huazhong Agricultural University. Landrace × Large White sows (n = 20) at 10 d before parturition were assigned to 2 groups matched for parity and body weight. The test group (T) received a diet supplemented with 7% fish oil, while control group (C) received an isoenergetic, isonitrogenous and isolipidic diet with 7% lard. Fish oil and lard were purchased from China National Cereals, Oils & Foodstuffs Corp. (COFCO Limited). The oil and fat were for food or feedquality grade. And 500 mg/kg ethoxyquin was added to fish oil and lard as anti-oxidative. The two diets were formulated to meet NRC requirements of nutrient standards for lactation sow (NRC, 1998). All diets were prepared weekly to keep them fresh. Two sows in the test group gave birth to less than 3 piglets, and thus were dropped from the study. Upon farrowing, sows were fed their respective fish oil or lard diet
287
twice daily (0800 and 1600). Sows were initially fed 2.0 kg/ day after delivery, and the feed amount was increased daily by ∼ 0.5 kg until day 4 postpartum after which sows had free access to their diets until weaning at day 28. The fatty acids composition, ingredients and composition of the sow diets are shown in Table 1. At farrowing, litters were equalized within dietary treatments to the same number of piglets per litter (∼ 10). Pre-starter feed was freely available to the nursing piglets from 7 d of age until weaning. At 28 d of age, 56 piglets, 28 (half females and half castrated males) each from the fish oil diet sow group and the control diet sow group were moved to cages and reared in nursery rooms. Experimental animals were assigned to different treatments in a split plot experiment design. Pen was the experimental unit. The piglets were subdivided into 4 groups of 14 piglets (7 pens, one female and one castrated male per pen). Piglets were assigned randomly by animal weight and litter. Piglets from CT and TT groups were fed with a starter diet supplemented with 7% fish oil, and an isoenergetic, isonitrogenous and isolipidic diet supplemented with 7% lard was used as the starter diet for the CC and TC piglets. The two diets were formulated to meet NRC requirements of nutrient standards for piglets (NRC, 1998). All diets were prepared weekly to keep them fresh. The fatty acids composition, ingredients and composition of the piglet diets are shown in Table 1. Weaned piglets were fed with experimental diets from 35 d to 70 d. Table 1 Fatty acid composition, ingredients and composition of the experimental diets. Item
Sow diet a
7% lard
7% fish oil
Fatty acid composition, % total fatty acids C14:0 1.13 4.37 C16:0 23.32 22.29 C18:0 11.77 4.92 SFA 36.22 31.58 C16:1n-7 1.72 6.14 C18:1n-9 35.48 26.49 MUFA 37.20 32.63 C18:2n-6 20.09 14.00 C20:4n-6 0.20 0.30 (n-6) PUFA 20.30 14.30 C18:3n-3 0.92 0.97 C20:5n-3 0.13 6.55 C22:5n-3 0.10 0.62 C22:6n-3 0.22 3.87 (n-3) PUFA 1.37 12.01 PUFA 21.67 26.31
1.38 24.07 9.53 34.98 1.73 31.79 33.52 20.76 0.31 21.07 1.05 0.04 0.06 0.05 1.20 22.27
4.56 22.21 4.02 30.78 6.22 22.90 29.12 15.80 0.14 15.94 0.97 5.90 0.47 2.94 10.28 26.22
Chemical composition, % Digestible energy, Mcal/kg Crude protein Crude fat Calcium Total phosphorus Available phosphorus
3.36 19.38 9.72 0.79 0.65 0.39
3.35 19.38 9.69 0.79 0.65 0.38
7% lard
3.45 17.28 11.57 0.80 0.65 0.42
7% fish oil
Piglet diet b
3.44 17.32 11.32 0.79 0.63 0.42
a Ingredients (g/kg diet): corn 575, wheat bran 70, lard or fish oil 70, fish meal 30, soybean meal 215, sodium chloride 3.5, dicalcium phosphate 11.5, calcium carbonate 8, L-Lysine hydrochloride 2, vitamin mineral premix 15. b Ingredients (g/kg diet): corn 480, wheat bran 40, dried whey 80, lard or fish oil 70, fish meal 50, soybean meal 240, sodium chloride 3.5, dicalcium phosphate 10.5, calcium carbonate 5, L-Lysine hydrochloride 2.5, methione 1, vitamin mineral premix 17.5.
288
J. Luo et al. / Livestock Science 126 (2009) 286–291
2.2. Collection of samples At day 21 of lactation, 30–40 mL of milk was collected from the functional glands of each sow after injection of 2 mL of oxytocin (Inter-Chemical Ltd. China). The milk samples were immediately frozen at −20 °C for later analysis. Blood samples from precaval vein of each piglet were collected into 5 mL heparinized vacutainer tubes and centrifuged (3500 ×g for 5 min) to collect serum at day 70 of the experiment. Serum samples were stored at − 20 °C until measurement for cytokines concentrations. Sixteen piglets (4 from each group, 2 females and 2 castrated males) were slaughtered based on the same body weight across groups at the end of the experiment (day 70). The pigs were deprived of feed for 12 h before being humanely slaughtered via electric stun and exsanguination. The samples of spleen (∼5 g) were collected from the cacumen. All the collected samples were snap frozen in liquid nitrogen and stored at −80 °C for subsequent RNA isolation. 2.3. Fatty acid analysis Fatty acids composition of diets and milk was analyzed by gas chromatography. Lipids were extracted by chloroform: methanol (1:1) as described by Folch et al. (1957). Fatty acid methyl esters were prepared for gas chromatography determination using KOH/methanol (0.4 mol·L− 1). The CP-3800 gas chromatography (Varian, InC. USA) equipped with a 1177 injector, a flame ionization detector and a capillary chromatographic column CPSil88 (Varian, InC. USA) (50 m× 0.25 mm × 0.20 µm) for fatty acid methyl esters was used in this experiment. The injector and detector temperature were kept at 250 °C and 270 °C, respectively. Nitrogen was used as carrier gas with a flow rate of 1.0 mL·min− 1, and split ratio was 1:100. The column temperature was programmed as follows: 100 °C at first, increased to 200 °C (5 °C·min− 1) and held constant for 5 min; then, the temperature was increased to 225 °C (2 °C·min− 1) and kept constant for 2 min. The total analysis time was 39.5 min. The fatty acids were identified by comparing the retention times of the peaks with those of known standards (Sigma Chemical Co., St. Louis, Mo). Fatty acid results are presented as g/100 g fatty acids. Saturated fatty acids are the sum of C14:0, C16:0, and C18:0. The monounsaturated fatty acids are the sum of C16:1n-7 and C18:1n-9. The (n-3) PUFA are the sum of C18:3n-3, C20:5n-3, C22:5n-3, and C22:6n-3. The (n6) PUFA are the sum of C18:2n-6 and C20:4n-6. The sum of the PUFA was calculated as the sum of (n-3) PUFA and (n-6) PUFA.
(Toyobo, Osaka, Japan) was used as the primer in the first step of cDNA synthesis. Reverse transcription reaction solution (20 µL) consisted of 2 µg of total RNA, 1 µL of MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (Toyobo, Osaka, Japan), 0.5 µL of an RNAse inhibitor (Toyobo, Osaka, Japan), 0.5 mmol/L of dNTP (Toyobo, Osaka, Japan), and 2 µL oligo-dT primers. Primer sequences and optimal PCR annealing temperatures are listed in Table 2. Polymerase chain reactions were performed on a 2720 Thermal Cycler (Applied Biosystems, USA). The PCR program began with a 94 °C denaturation for 5 min, followed by 25–35 cycles denatured at 94 °C for 30 s, annealing for 45 s, and extension for 30 s at 72 °C, with a final extension at 72 °C for 10 min. The PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide (10 µg/mL). The gel images were digitally captured with G:BOX (Syngene, Cambridge, UK) and densitometry values were measured using the Gene Tool software (Syngene, Cambridge, UK). Values are presented as a ratio of the specified gene signal in the selected linear amplification cycle divided by the β-actin signal. Data for each replicate represented the mean of three individual RT-PCRs. 2.6. Statistical analysis Fatty acids composition of milk were presented as means ± pooled SEM and analyzed by t-test. Cytokines concentrations and IFNγ/IL-10 ratio of sera were presented as means ± SE (n). Statistical analysis of the serum parameters were performed using the Kruskal–Wallis and Bonferroni methods of SAS 8.01 (SAS, 1989). The serum cytokines data were not normal distribution, and must be analyzed by a nonparametric test using the Kruskal–Wallis and Bonferroni methods of SAS 8.01 (SAS, 1989) according to Okazaki et al. (2008). The interaction cannot be analyzed using the Kruskal–Wallis and only the main effects of lactation (L) and post-weaning (PW) were analyzed. The gene expression data were presented as means ± pooled Table 2 Oligonucleotide polymerase chain reaction primers of genes. Genes a
Primer sequences (5′→3′)
Product size
Ta b (°C)
IL-12b
F: GTCGCAAAGGAGGCGCAGTT R: GCAGATTCTTGGGAGGGT F: CAGATTTCCTCTAAGCCACA R: CCACTCCACCACATACTCC F: CTGCTGGATTTACAGTTGCT R: ATATTTGCTGAGTCAGAGTT F: AAGATAACCAGGCCATTC R: GTCATTCAGTTTCCCAGA F: CCGGCTTCGGATGCAAGT R: AGTCCTCCAGCGTGTCGTG F: CCTCCTGAGCGGACTTGA R: CATAATCGTCTTTAGCCTTT F: GCATTCCCTCCTCTGGTC R: ATAGTGTCCTAACGCTCAT F: ATCCACTTCCCAACCAGC R: TCGGCATTACGTCTTCCAG F: CCAGGTCATCACCATCGG R: CCGTGTTGGCGTAGAGGT F: GGACTTCGAGCAGGAGATGG R: GCACCGTGTTGGCGTAGAGG
444
59.5
498
56
197
47
92
49
423
60
115
46.5
IL-12Rβ2 IL-2 IFN-γ
2.4. Cytokines determination Serum concentrations of IFN-γ and IL-10 were determined using a porcine specific ELISA kit as per the instructions of the manufacturer (ADL, USA).
GATA-3 IL-4 IL-6 IL-10
2.5. Relative reverse transcription (RT)-PCR β-actin
Total RNA was extracted using the TRIzol reagent (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA samples were quantified spectrophotometrically at 260 and 280 nm. A two-step semi-quantitative RTPCR method was used to measure IL-12b, IL-12Rβ2, IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes expression. Oligo-(dT)20n
β-actin
93
58
199
50
158
–
233
–
a IL-12b = Interleukin 12B, IL-12Rβ2 = Interleukin 12 receptor β2, IL2 = Interleukin 2, IFN-γ = Interferon γ, GATA-3 = GATA binding protein 3, IL-4 = Interleukin 4, IL-6 = Interleukin 6, IL-10 = Interleukin 10. b Ta: optimal PCR annealing temperature.
J. Luo et al. / Livestock Science 126 (2009) 286–291
diets or post-weaning diets, and IFN-γ/IL-10 ratio also was not affected by lactation diets added with 7% fish oil or 7% lard (P N 0.05). However, post-weaning fish oil diet tended to increase serum IFN-γ/IL-10 ratio (P = 0.093).
Table 3 Lipid concentration and fatty acid composition of milk of sows fed with and without fish oil. a Item
7% lard
7% fish oil
SEM
P-value
Lipid, % milk solid
5.69
5.81
0.27
0.77
0.20 0.68 0.18 0.73 0.23 0.72 0.72 0.44 0.03 0.45 0.04 0.07 0.04 0.06 0.11 0.49
b0.01 0.22 0.55 0.04 b0.01 b0.01 b0.01 b0.01 b0.01 b0.01 0.10 b0.01 b0.01 b0.01 b0.01 b0.01
Fatty acid composition, C14:0 C16:0 C18:0 SFA C16:1n-7 C18:1n-9 MUFA C18:2n-6 C20:4n-6 (n-6) PUFA C18:3n-3 C20:5n-3 C22:5n-3 C22:6n-3 (n-3) PUFA PUFA
% total fatty acid 3.43 4.47 32.44 33.69 3.76 3.91 39.63 42.07 8.42 10.77 27.97 20.73 36.40 31.50 13.56 10.78 0.39 0.29 13.95 11.07 0.56 0.65 0.04 2.71 0.10 1.12 0.07 2.53 0.77 7.00 14.71 18.07
289
3.3. Th genes expression On day 70, the expression of IL-12b, IL-12Rβ2, IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes in spleens of weaned piglets (4 from each group) were assayed by semi-quantitative RT-PCR, and the results are shown in Table 5. Lactation fish oil feeding significantly increased splenic Th1 genes, IL-12b (P = 0.01), IL-12Rβ (P b 0.01), IL-2 (P b 0.05), and IFN-γ (P b 0.01) expression at the end of this experiment, while piglets with fish oil supplemented diet during postweaning period have higher IFN-γ (P = 0.08), IL-12b (P = 0.06), and IL-2 (P b 0.01) genes expression in spleen than piglets fed the lard diet. A significant lactation × post-weaning interaction for IL-2 gene expression was observed (P b 0.05). The GATA-3 gene expression of spleen did not differ between groups and IL-6 and IL-10 genes expression of weaned piglets in spleen were not affected by lactation effect (P N 0.05). The gene expression of IL-4 (P = 0.01) in spleen was lower in weaned piglets from fish oil fed sows than in piglets from lard fed sows. However, piglets fed fish oil diet have higher splenic IL-4 (P = 0.06), IL-6 (P b 0.01) and IL-10 (P = 0.05) mRNA abundances than piglets fed lard diet during post-weaning. A significant lactation × post-weaning interaction for IL-10 gene expression was observed (P b 0.01).
a Milk samples were collected at 21 d of lactation. Values are means ± pooled SEM, lard diet group n = 9, fish oil diet group n = 6.
SEM and analyzed by general linear model (GLM) of SAS 8.01 (SAS, 1989). Main effects of L and PW and their interaction were analyzed. Differences were considered significant at P b 0.05 and a tendency was recognized at P b 0.10. 3. Results
4. Discussion 3.1. Fatty acids composition of diets and milk In the present study, 7% of fish oil addition to late gestation and lactating sow markedly increased the (n-3) PUFA content of sow milk. Fish oil supplementation to sow diet and/or piglet diet significantly increased the (n-3) PUFA ingestion of piglets. Although serum IFN-γ and IL-10 levels were not affect by lactation or post-weaning fish oil administration, we observed a tendency for higher IFN-γ/IL-10 ratio in sera after 7% fish oil addition during post-weaning period. It was supported by the genes expression in spleen. In which IFN-γ mRNA abundance was markedly increased by dietary (n-3) PUFA supplementation, while the differences of IL-10 expression did not reach statistical significances for lactation or post-weaning (n-3) PUFA supplementation effects.
Fatty acid composition of sow and piglet diets and sow milk were shown in Tables 1 and 3, respectively. Fish oil diets and lard diets had the same levels of lipids; while the eicosapentaenoic acid (EPA, C20:5n-3), docosahexaenoic acid (DHA, C22:5n-3), and total (n-3) PUFA were 8–9 times higher in fish oil supplemented diets than in lard supplemented diets. Fish oil administration significantly increased the EPA, DHA, and total (n-3) PUFA levels in sows' milk (P b 0.01). Noteworthy, the EPA, DHA, and total (n-3) PUFA contents in milk were lower than those in sows' diets (2.7% vs. 6.6%, 2.5% vs. 3.9%, and 7.0% vs. 12.0%, respectively). 3.2. Serum concentrations of IFN-γ and IL-10
4.1. The effect of fish oil supplementation on Th1 polarization Serum IFN-γ and IL-10 concentrations and IFN-γ/IL-10 ratio of weaned piglets are shown in Table 4. Serum IFN-γ and IL-10 levels of weaned piglets were not affected by lactation
Results from the current study showed that fish oil addition promoted splenic IL-12b, IL-12Rβ2, IFN-γ and IL-2 genes
Table 4 IFN-γ and IL-10 concentrations, and IFN-γ/IL-10 ratio of sera in weaned piglets at the end of the experiment. a Lactation diet effect
IFNγ, pg/mL IL-10, pg/mL IFNγ/IL-10 a
P-value
7% lard
7% fish oil
20.54 ± 5.28 (27) 37.10 ± 10.00 (18) 0.92 ± 0.11 (18)
28.21 ± 7.05 (23) 46.50 ± 11.49 (18) 1.00 ± 0.10 (18)
Values are means ± SE (n).
0.52 0.72 0.69
Post-weaning diet effect
P-value
7% lard
7% fish oil
27.16 ± 7.00 (23) 50.81 ± 10.60 (17) 0.79 ± 0.09 (17)
21.44 ± 5.37 (27) 33.73 ± 9.76 (19) 1.11 ± 0.11 (19)
0.29 0.18 0.09
290
J. Luo et al. / Livestock Science 126 (2009) 286–291
Table 5 Splenic Th1/Th2 characteristic genes expression in weaned piglets at the end of the experiment. a Diet b CC
SEM CT
TC
TT
Th1 genes expression IL-12b 0.59 0.83 IL-12Rβ2 0.20 0.41 IL-2 0.12 0.34 IFN-γ 0.56 1.01
0.88 0.88 0.78 1.24
1.23 0.91 1.79 1.27
Th2 genes expression GATA-3 0.97 1.03 IL-4 0.79 1.16 IL-6 0.63 1.59 IL-10 0.43 0.31
0.92 0.33 0.79 0.22
1.08 0.65 1.66 0.62
P-value c L
PW
L × PW
0.12 0.08 0.10 0.14
0.01 b 0.01 b 0.01 0.02
0.06 0.28 b 0.01 0.08
0.66 0.40 0.02 0.11
0.12 0.15 0.05 0.08
0.98 0.01 0.11 0.61
0.10 0.06 b 0.01 0.05
0.41 0.89 0.42 b0.01
a Genes signal were measured as optical density and were divided by the β-actin signal. Values are means ± pooled SEM, n = 4. b CC = lactation lard diet and post-weaning lard diet; CT = lactation lard diet and post-weaning fish oil diet; TC = lactation fish oil diet and postweaning lard diet; TT = lactation fish oil diet and post-weaning fish oil diet. c L = lactation effect; PW = post-weaning effect; L × PW = interaction between lactation effect and post-weaning effect.
expression in piglets. The cytokine IL-12 mediates Th1 differentiation (Glimcher, 2001; O'Shea and Paul, 2002). Normal Th1 differentiation requires IL-12Rβ2 expression and the expression of IL-12Rβ2 is considered a marker for Th1 differentiation (Szabo et al., 1997; Rogge et al., 1997). The signature cytokine of Th1 is IFN-γ. This cytokine also can induce a potential positive feedback loop to promote the expression of IL-12Rβ2 and IFN-γ (Lighvani et al., 2001; Szabo et al., 2003). The cytokine IL-2 is also a Th1 cytokine and has the ability to induce T-lymphocyte proliferation (Smith, 1988). Collectively, the increases of IL-12b, IL-12Rβ2, IFN-γ and IL-2 genes expression in spleen of piglets after fish oil feeding indicated that (n-3) PUFA supplementation for piglets could promote Th1 differentiation and polarization. Previous researches showed inconsistent results of fish oil influenced Th1 cytokines expression and secretion (Fritsche et al., 1997, 1999; Kleemann et al., 1998; Sijben et al., 2001; Switzer et al., 2004; Khan et al., 2006). There are several reasons for these apparent discrepancies. One of potential reason for these apparent discrepancies was the physical condition of experimental animals. Investigations in healthy subjects exhibited higher Th1 cytokine production after (n-3) PUFA administration (Fritsche et al., 1997; Sijben et al., 2001; Lauritzen et al., 2005). Whereas, opposite results were shown in pathological animals, especially in the conditions primarily inducing cellular immunity (Kleemann et al., 1998; Fritsche et al., 1999; Khan et al., 2006). Other factors that interfered the effect of (n-3) PUFA on T cells cytokine production maybe the time when cytokine was determined and the difference between cultured conditions of splenocytes. Fish oil enhanced IFN-γ production when samples were assayed directly from (n3) PUFA fed animals (Fritsche et al., 1997; Oarada et al., 2003). In contrast, IFN-γ secretion was decreased in splenocytes from fish oil fed mice and cultured in fetal bovine serum (Fritsche et al., 1999; Wallace et al., 2001). However, fish oil increased IFN-γ in splenocytes cultured in the homologous mouse serum (Switzer et al., 2004). It was speculated that diet-induced
changes in T cell cytokine production could be masked by culture conditions (Switzer et al., 2004). 4.2. The effect of fish oil supplementation on Th2 cytokines production Results showed that lactation fish oil supplementation suppressed IL-4 gene expression in spleen from weaned piglets at the end of this experiment. However, the splenic IL-4 and IL6 mRNA abundances were higher in piglets fed with fish oil diet during post-weaning period and there was a lactation × postweaning increasing of splenic IL-10 gene expression in fish oil supplemented piglets. Calder (1998) suggested that the immunomodulatory effects of (n-3) PUFA are dependent on the content polyunsaturated fat in the diet. The results also showed that the EPA, DHA, and (n-3) PUFA contents in milk were lower than those in sows' diets (2.7% vs. 6.6%, 2.5% vs. 3.9%, and 7.0% vs. 12.0%, respectively). Thus, piglets suckling milk from 7% fish oil fed dams received fewer (n-3) PUFA than weaned piglets fed with 7% fish oil diet directly. The distinct effects on IL-4 expression between lactation fish oil supplementation and post-weaning fish oil addition to diets maybe due to the unequal levels (n-3) PUFA which piglets received during the two stages. Low level of (n-3) PUFA could decrease Th2 cytokines expression, whereas high levels of fish oil supplementation to diets of post-weaning piglets was likely to increase Th2 cytokines production in spleens of piglets. 4.3. The effect of (n-3) PUFA on immune maturation Immune maturation seems to be characterized by a Th1polarization and an improvement in the capacity to produce cytokines such as INF-γ and IL-2 (Field et al., 2001). Immune maturation primarily assessed by the production of IFN-γ (Damsgaard et al., 2007). The results showed that INF-γ and IL2 expression in spleen were higher and serum IFN-γ/IL-10 ratio was tended to increase in piglets supplemented with fish oil. These results indicated that (n-3) PUFA supplementation given rise to a Th1 polarization and a faster immune maturation. There were no investigations reported about the effect of (n-3) PUFA on Th cytokines production and polarization in young piglets, but studies in rodents agreed with the current study. The secretion of IFN-γ in splenocytes separated from (n-3) PUFA fed 145 ± 2 g female Fischer 344 rats was increased (Robinson et al., 2001). Infant fish oil supplementation could increase IFN-γ and IFN-γ/IL-10 in peripheral blood, polarize the immune response to Th1 and give rise to faster immune maturation (Lauritzen et al., 2005; Damsgaard et al., 2007). The mechanism behind the immune-modulating effect of (n-3) PUFA could be mediated through changes in prostaglandin E2 (PGE2) synthesis (Prescott and Calder, 2004). PGE2 enhances Th2 differentiation and suppresses the differentiation of Th1 cells (Betz and Fox, 1991). In vitro studies have shown that all PGE subtypes equipotently inhibit Th1 cytokine production (Miles et al., 2003; Dooper et al., 2002). Long chain (n-3) PUFA could either effectively raise EPA and DHA concentration in membrane lipids, decrease arachidonic acid content and the production of pro-inflammatory eicosanoids (Caughey et al., 1996; Yaqoob et al., 2000; Calder, 2002), or suppress cyclooxygenase-2 expression (Curtis et al., 2000; Lee et al., 2003), and then decreased PGE2 synthesis.
J. Luo et al. / Livestock Science 126 (2009) 286–291
5. Conclusion In the present study we found that (n-3) PUFA can regulate Th polarization and immune maturation in young piglets. Dietary fish oil supplementation increase Th1 special genes expression and cytokines production, shift the Th1/Th2 to Th1 polarization, and acquire a faster immune maturation in piglets. Whereas, high levels of fish oil supplementation to diets of postweaning piglets might increase splenic expression of Th2 cytokines. It is suggested that appropriate levels of fish oil supplementation to young piglets' diets may promote Th1 differentiation and accelerate immune maturation. However, excessive (n-3) PUFA administration also might delay the maturation of immunity. Further studies are required to explore the proper fish oil supplementation level and the immunomodulating effects of long chain (n-3) PUFA in young piglets. Acknowledgment This research was supported by the National High Technology R & D Program of China (No. 2006AA10Z140), National Science Foundation of China (No. 30871779) and Major Science & Technology Industrialization Projects in Wuhan City of China (No. 2007201120363). References Agnello, D., Lankford, C.S.R., Bream, J., Morinobu, A., Gadina, M., O shea, J.J., Frucht, D.M., 2003. Cytokines and transcription factors that regulate T helper cell differentiation: new players and new insights. J. Clin. Immunol. 23, 147–161. Betz, M., Fox, B.S., 1991. Prostaglandin E2 inhibits production of Th1 lymphokines but not of Th2 lymphokines. J. Immunol. 146, 108–113. Calder, P.C., 1998. Dietary fatty acids and the immune system. Nutr. Rev. 56, S70–S83. Calder, P.C., 2002. Fatty acids and gene expression related to inflammation. Nestle Nutr. Workshop Ser. Clin. Perform. Progr. 7, 19–40. Caughey, G.E., Mantzioris, E., Gibson, R.A., Cleland, L.G., James, M.J., 1996. The effect on human tumor necrosis factor alpha and interleukin 1 beta production of diets enriched in (n-3) fatty acids from vegetable oil or fish oil. Am. J. Clin. Nutr. 63, 116–122. Curtis, C.L., Hughes, C.E., Flannery, C.R., Little, C.B., Harwood, J.L., Caterson, B., 2000. n-3 fatty acids specifically modulate catabolic factors involved in articular cartilage degradation. J. Biol. Chem. 275, 721–724. Damsgaard, C.T., Lauritzen, L., Kjær, T.M.R., Holm, P.M.I., Fruekilde, M., Michaelsen, K.F., Frøkiær, H., 2007. Fish oil supplementation modulates immune function in healthy infants. J. Nutr. 137, 1031–1036. Dooper, M.M.B.W., Wassink, L., M Rabet, L., Graus, Y.M.F., 2002. The modulatory effects of prostaglandin-E on cytokine production by human peripheral blood mononuclear cells are independent of the prostaglandin subtype. Immunol. 107, 152–159. Endres, S., Ghorbani, R., Kelley, V.E., Georgilis, K., Lonnemann, G., van der Meer, J.W., Cannon, J.G., Rogers, T.S., Klempner, M.S., Weber, P.C., Schaefer, E.J., Wolff, S.M., Dinarello, C.A., 1989. The effect of dietary supplementation with (n-3) polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N. Engl. J. Med. 320, 265–271. Field, C.J., 2005. The immunological components of human milk and their effect on immune development in infants. J. Nutr. 135, 1–4. Field, C.J., Clandinin, M.T., van Aerde, J.E., 2001. Polyunsaturated fatty acids and T-cell function: implications for the neonate. Lipids 36, 1025–1032. Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Fritsche, K.L., Feng, C., Berg, J.N., 1997. Dietary fish oil enhances circulating interferon-gamma in mice during listeriosis without altering in vitro production of this cytokine. J. Interferon Cytokine Res. 17, 271–277. Fritsche, K.L., Byrge, M., Feng, C., 1999. Dietary omega-3 polyunsaturated fatty acids from fish oil reduce interleukin-12 and interferon-gamma production in mice. Immunol. Lett. 65, 167–173. Glimcher, L.H., 2001. Lineage commitment in lymphocytes: controlling the immune response. J. Clin. Invest. 108, S25–S30.
291
Kew, S., Banerjee, T., Minihane, A.M., Finnegan, Y.E., Williams, C.M., Calder, P.C., 2003. Relation between the fatty acid composition of peripheral blood mononuclear cells and measures of immune cell function in healthy, freeliving subjects aged 25–72 y. Am. J. Clin. Nutr. 77, 1278–1286. Kleemann, R., Scott, F.W., Worz-Pagenstert, U., Nimal Ratnayake, W.M., Kolb, H., 1998. Impact of dietary fat on Th1/Th2 cytokine gene expression in the pancreas and gut of diabetes-prone BB rats. J. Autoimmun. 11, 97–103. Khan, N.A., Yessoufou, A., Kim, M., Hichami, A., 2006. N-3 fatty acids modulate Th1 and Th2 dichotomy in diabetic pregnancy and macrosomia. J. Autoimmun. 26, 268–277. Lauritzen, L., Kjær, T.M.R., Fruekilde, M., Michaelsen, K.F., Frøkiær, H., 2005. Fish oil supplementation of lactating mothers affects cytokine production in 21/2-year-old children. Lipids 40, 669–676. Liblau, R.S., Singer, S.M., McDevitt, H., 1995. Thl and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16, 34–38. Lee, J.Y., Plakidas, A., Lee, W.H., Heikkinen, A., Chanmugam, P., Bray, G., Hwang, D.H., 2003. Differential modulation of Toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J. Lipid Res. 44, 479–486. Lighvani, A.A., Frucht, D.M., Jankovic, D., Yamane, H., Aliberti, J., Hissong, B.D., Nguyen, B.V., Gadina, M., Sher, A., Paul, W.E., O Shea, J.J., 2001. T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 98, 15137–15142. Meydani, S.N., Endres, S., Woods, M.M., Goldin, B.R., Soo, C., Morrill-Labrode, A., Dinarello, C.A., Gorbach, S.L., 1991. Oral (n-3) fatty acid supplementation suppresses cytokine production and lymphocyte proliferation: comparison between young and older women. J. Nutr. 121, 547–555. Miles, E.A., Aston, L., Calder, P.C., 2003. In vitro effects of eicosanoids derived from different 20-carbon fatty acids on T helper type 1 and T helper type 2 cytokine production in human whole-blood cultures. Clin. Exp. Allergy 33, 624–632. National Research Council, 1998. Nutrient Requirements of Swine, 10th edn. National Academy Press, Washington, DC, USA. Oarada, M., Tsuduki, T., Suzuki, T., Miyazawa, T., Nikawa, T., Hong-quan, G., Kurita, N., 2003. Dietary supplementation with docosahexaenoic acid, but not with eicosapentaenoic acid, reduces host resistance to fungal infection in mice. Biochim. Biophys. Acta 1622, 151–160. Okazaki, K., Kondo, M., Kato, M., Kakinuma, R., Nishida, A., Noda, M., Taniguchi, K., Kimura, H., 2008. Serum cytokine and chemokine profiles in neonates with meconium aspiration syndrome. Pediatrics 121, e748–e753. O Shea, J.J., Paul, W.E., 2002. Regulation of T(H)1 differentiation—controlling the controllers. Nat. Immunol. 3, 506–508. Prescott, S.L., Calder, P.C., 2004. N-3 polyunsaturated fatty acids and allergic disease. Curr. Opin. Clin. Nutr. Metab. Care. 7, 123–129. Robinson, L.E., Clandinin, M.T., Field, C.J., 2001. R3230 AC rat mammary tumor and dietary long-chain (n-3) fatty acids change immune cell composition and function during mitogen activation. J. Nutr. 131, 2021–2027. Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D.H., Gubler, U., Sinigaglia, F., 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185, 825–831. SAS Institute Inc, 1989. SAS/STAT User's Guide: Version 6, 4th edn. SAS Institute Inc., Cary, North Carolina, USA. Sijben, J.W., Schrama, J.W., Parmentier, H.K., van der Poel, J.J., Klasing, K.C., 2001. Effects of dietary polyunsaturated fatty acids on in vivo splenic cytokine mRNA expression in layer chicks immunized with Salmonella typhimurium lipopolysaccharide. Poult. Sci. 80, 1164–1170. Smith, K.A., 1988. Interleukin-2: inception, impact, and implications. Science 240, 1169–1176. Switzer, K.C., Fan, Y.Y., Wang, N., McMurray, D.N., Chapkin, R.S., 2004. Dietary n-3 polyunsaturated fatty acids promote activation-induced cell death in Th1-polarized murine CD4+ T-cells. J. Lipid Res. 45, 1482–1492. Szabo, S.J., Dighe, A.S., Gubler, U., Murphy, K.M., 1997. Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185, 817–824. Szabo, S.J., Sullivan, B.M., Peng, S.L., Glimcher, L.H., 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21, 713–758. Venkatraman, J.T., Chandrasekar, B., Kim, J.D., Fernandes, G., 1994. Effects of n-3 and n-6 fatty acids on the activities and expression of hepatic antioxidant enzymes in autoimmune-prone NZB × NZW F1 mice. Lipids 29, 561–568. Wallace, F.A., Miles, E.A., Evans, C., Stock, T.E., Yaqoob, P., Calder, P.C., 2001. Dietary fatty acids influence the production of Th1- but not Th2-type cytokines. J. Leukoc. Biol. 69, 449–457. Yaqoob, P., Pala, H.S., Cortina-Borja, M., Newsholme, E.A., Calder, P.C., 2000. Encapsulated fish oil enriched in [alpha]-tocopherol alters plasma phospholipid and mononuclear cell fatty acid compositions but not mononuclear cell functions. Eur. J. Clin. Invest. 30, 260–274.
Contents lists available at ScienceDirect
Livestock Science j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / l i v s c i
Effect of dietary supplementation of fish oil for lactating sows and weaned piglets on piglet Th polarization J. Luo a, F.R. Huang a, C.L. Xiao a, W. Chen a, S.W. Jiang b,⁎, J. Peng a,⁎ a
Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China Key Laboratory of Swine Breeding and Genetics of the Agricultural Ministry, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China
b
a r t i c l e
i n f o
Article history: Received 28 April 2009 Received in revised form 30 July 2009 Accepted 8 August 2009 Keywords: Fish oil IFN-γ IL-10 Th polarization Piglets
a b s t r a c t The present study was designed to investigate the effect of dietary fish oil supplementation on piglet T helper cells (Th) polarization in relation to its impact on piglet serum interferon γ (IFN-γ) and interleukin 10 (IL-10) concentrations and splenic expression of Th1/Th2 characteristic genes. The diets of 18 gestating sows were supplemented with 7% lard (C) (n = 10) or 7% fish oil (T) (n = 8) from 10 d before parturition to weaning. At weaning, a split plot experiment was designed, 56 piglets, 28 each from sows fed with fish oil diet or lard diet, were divided into four groups of 7 replicates (one female and one castrated male per replicate) based on both sow diet during lactation and post-weaning piglet diet (C had 7% lard and T had 7% fish oil): CC, CT, TC, TT, and were fed the 7% fish oil or lard diet from day 35 to day 70. Serum concentrations of IFN-γ and IL-10, and Th1/Th2 related genes expression levels in spleen were measured and analyzed. The results showed that piglets fed with fish oil diet during postweaning tended to have higher serum IFN-γ/IL-10 ratio (P = 0.09) than lard diet fed piglets. Lactation fish oil feeding increased splenic IL-12b, IL-12 receptor β2 (IL-12Rβ2), IL-2 and IFN-γ genes expression (P b 0.05 or P b 0.01) and post-weaning fish oil feeding increased splenic IL12b (P = 0.06), IL-2 (P b 0.01) and IFN-γ (P = 0.08) mRNA expression than that in lard diet fed piglets at the end of this experiment. On the other hand, IL-4 gene expression (P = 0.01) in spleen was lower in weaned piglet from fish oil diet fed sows than that from lard diet fed sows. However, post-weaning piglets fed fish oil diet had higher splenic IL-4 (P = 0.06), IL-6 (P b 0.01) and IL-10 (P = 0.05) mRNA abundances than that fed with lard diet. These results indicated that dietary fish oil during lactation could increase Th1 polarization and accelerate immune maturation; while 7% fish oil in weaned piglets' diet was likely to increase Th2 cytokines expression. © 2009 Published by Elsevier B.V.
1. Introduction The T-lymphocyte exerts its modulatory properties by proliferating in response to stimulation and producing various cytokines. Cytokines derived from the T helper lymphocytes (Th) are categorized as Th1 or Th2. The Th1 cytokines including
⁎ Corresponding authors. Peng is to be contacted Tel.: +86 27 87280122; fax: +86 27 87280408. Jiang, Tel.: +86 27 87284241; fax: +86 27 87280408. E-mail addresses: [email protected] (S.W. Jiang), [email protected] (J. Peng). 1871-1413/$ – see front matter © 2009 Published by Elsevier B.V. doi:10.1016/j.livsci.2009.08.002
interleukin-2 (IL-2), interferon-γ (IFN-γ), and tumor necrosis factor (TNF) influence cell-mediated immunity; while the Th2 cytokines, IL-4, IL-5, IL-6, and IL-10, regulate humoral or antibody-mediated immunity (Liblau et al., 1995). The differentiations of Th1/Th2 are regulated by some cytokines. IL-12 binds to the IL-12 receptor on naïve CD4+ T cells and induces them differentiate into Th1, leading to cytokines secretion such as IFN-γ and IL-2 (Reviewed by Agnello et al., 2003)., whereas, IL-4 regulates Th2 cytokines (such as IL-4 and IL-10) via inducing GATA-3 (GATA binding transcription factor 3) expression, which leads to Th2 differentiation (Reviewed by Agnello et al., 2003).
J. Luo et al. / Livestock Science 126 (2009) 286–291
Neonates are born with an immature immune system, characterized by a reduced ability to produce a number of cytokines (Field et al., 2001) and likely a Th2-polarization (Field, 2005). Immune maturation seems to be characterized by a Th1-polarization and an improvement in the capacity to produce cytokines such as INF-γ and IL-2 (Field et al., 2001). A faster immune maturation and Th1 polarization could result in better immune functioning (Lauritzen et al., 2005). Modulating Th1/Th2 balance may impact the immune maturation and the ability to defend against infections in young animal. (n-3) polyunsaturated fatty acids (PUFA) have antiinflammatory and immunomodulatory effect. Dietary fish oil, rich in (n-3) PUFA, possesses potent anti-inflammatory properties in human and rodent autoimmune disease models (Endres et al., 1989; Venkatraman et al., 1994; Kew et al., 2003). Most trials have shown a suppression of cytokine production with fish oil supplementation, especially TNF-α, IL-6, and IL-1β from peripheral immune cells (Endres et al., 1989; Meydani et al., 1991). However, an anti-inflammatory effect of (n-3) PUFA in early life may impair neonate protection and defense against infections (Damsgaard et al., 2007). Thus, the possible effects of (n-3) PUFA on innate immunity and the capacity to polarize Th toward a Th1response or a Th2-response are key points of interest. The (n-3) PUFA are thought to have immunosuppressive effects, but their immunomodulatory potential in young piglet has not been elucidated. To date, there were merely few randomized trials which investigated the effects of fish oil supplementation in infancy on immune function, and only measured the cytokines concentrations in whole-blood cultures challenged with antigens (Lauritzen et al., 2005; Damsgaard et al., 2007). Therefore, 7% of fish oil or lard were added to late gestation–lactating sow's diet and/or postweaning piglet's diet to study the effect of (n-3) PUFA supplementation on Th polarization and immune maturation in healthy piglets via determined serum IFN-γ and IL-10 concentrations and splenic IL-12b, IL-12 receptor β2 (IL12Rβ2), IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes expression. 2. Materials and methods 2.1. Animals and diets The study was approved by the Animal Care Committee at the Huazhong Agricultural University. Landrace × Large White sows (n = 20) at 10 d before parturition were assigned to 2 groups matched for parity and body weight. The test group (T) received a diet supplemented with 7% fish oil, while control group (C) received an isoenergetic, isonitrogenous and isolipidic diet with 7% lard. Fish oil and lard were purchased from China National Cereals, Oils & Foodstuffs Corp. (COFCO Limited). The oil and fat were for food or feedquality grade. And 500 mg/kg ethoxyquin was added to fish oil and lard as anti-oxidative. The two diets were formulated to meet NRC requirements of nutrient standards for lactation sow (NRC, 1998). All diets were prepared weekly to keep them fresh. Two sows in the test group gave birth to less than 3 piglets, and thus were dropped from the study. Upon farrowing, sows were fed their respective fish oil or lard diet
287
twice daily (0800 and 1600). Sows were initially fed 2.0 kg/ day after delivery, and the feed amount was increased daily by ∼ 0.5 kg until day 4 postpartum after which sows had free access to their diets until weaning at day 28. The fatty acids composition, ingredients and composition of the sow diets are shown in Table 1. At farrowing, litters were equalized within dietary treatments to the same number of piglets per litter (∼ 10). Pre-starter feed was freely available to the nursing piglets from 7 d of age until weaning. At 28 d of age, 56 piglets, 28 (half females and half castrated males) each from the fish oil diet sow group and the control diet sow group were moved to cages and reared in nursery rooms. Experimental animals were assigned to different treatments in a split plot experiment design. Pen was the experimental unit. The piglets were subdivided into 4 groups of 14 piglets (7 pens, one female and one castrated male per pen). Piglets were assigned randomly by animal weight and litter. Piglets from CT and TT groups were fed with a starter diet supplemented with 7% fish oil, and an isoenergetic, isonitrogenous and isolipidic diet supplemented with 7% lard was used as the starter diet for the CC and TC piglets. The two diets were formulated to meet NRC requirements of nutrient standards for piglets (NRC, 1998). All diets were prepared weekly to keep them fresh. The fatty acids composition, ingredients and composition of the piglet diets are shown in Table 1. Weaned piglets were fed with experimental diets from 35 d to 70 d. Table 1 Fatty acid composition, ingredients and composition of the experimental diets. Item
Sow diet a
7% lard
7% fish oil
Fatty acid composition, % total fatty acids C14:0 1.13 4.37 C16:0 23.32 22.29 C18:0 11.77 4.92 SFA 36.22 31.58 C16:1n-7 1.72 6.14 C18:1n-9 35.48 26.49 MUFA 37.20 32.63 C18:2n-6 20.09 14.00 C20:4n-6 0.20 0.30 (n-6) PUFA 20.30 14.30 C18:3n-3 0.92 0.97 C20:5n-3 0.13 6.55 C22:5n-3 0.10 0.62 C22:6n-3 0.22 3.87 (n-3) PUFA 1.37 12.01 PUFA 21.67 26.31
1.38 24.07 9.53 34.98 1.73 31.79 33.52 20.76 0.31 21.07 1.05 0.04 0.06 0.05 1.20 22.27
4.56 22.21 4.02 30.78 6.22 22.90 29.12 15.80 0.14 15.94 0.97 5.90 0.47 2.94 10.28 26.22
Chemical composition, % Digestible energy, Mcal/kg Crude protein Crude fat Calcium Total phosphorus Available phosphorus
3.36 19.38 9.72 0.79 0.65 0.39
3.35 19.38 9.69 0.79 0.65 0.38
7% lard
3.45 17.28 11.57 0.80 0.65 0.42
7% fish oil
Piglet diet b
3.44 17.32 11.32 0.79 0.63 0.42
a Ingredients (g/kg diet): corn 575, wheat bran 70, lard or fish oil 70, fish meal 30, soybean meal 215, sodium chloride 3.5, dicalcium phosphate 11.5, calcium carbonate 8, L-Lysine hydrochloride 2, vitamin mineral premix 15. b Ingredients (g/kg diet): corn 480, wheat bran 40, dried whey 80, lard or fish oil 70, fish meal 50, soybean meal 240, sodium chloride 3.5, dicalcium phosphate 10.5, calcium carbonate 5, L-Lysine hydrochloride 2.5, methione 1, vitamin mineral premix 17.5.
288
J. Luo et al. / Livestock Science 126 (2009) 286–291
2.2. Collection of samples At day 21 of lactation, 30–40 mL of milk was collected from the functional glands of each sow after injection of 2 mL of oxytocin (Inter-Chemical Ltd. China). The milk samples were immediately frozen at −20 °C for later analysis. Blood samples from precaval vein of each piglet were collected into 5 mL heparinized vacutainer tubes and centrifuged (3500 ×g for 5 min) to collect serum at day 70 of the experiment. Serum samples were stored at − 20 °C until measurement for cytokines concentrations. Sixteen piglets (4 from each group, 2 females and 2 castrated males) were slaughtered based on the same body weight across groups at the end of the experiment (day 70). The pigs were deprived of feed for 12 h before being humanely slaughtered via electric stun and exsanguination. The samples of spleen (∼5 g) were collected from the cacumen. All the collected samples were snap frozen in liquid nitrogen and stored at −80 °C for subsequent RNA isolation. 2.3. Fatty acid analysis Fatty acids composition of diets and milk was analyzed by gas chromatography. Lipids were extracted by chloroform: methanol (1:1) as described by Folch et al. (1957). Fatty acid methyl esters were prepared for gas chromatography determination using KOH/methanol (0.4 mol·L− 1). The CP-3800 gas chromatography (Varian, InC. USA) equipped with a 1177 injector, a flame ionization detector and a capillary chromatographic column CPSil88 (Varian, InC. USA) (50 m× 0.25 mm × 0.20 µm) for fatty acid methyl esters was used in this experiment. The injector and detector temperature were kept at 250 °C and 270 °C, respectively. Nitrogen was used as carrier gas with a flow rate of 1.0 mL·min− 1, and split ratio was 1:100. The column temperature was programmed as follows: 100 °C at first, increased to 200 °C (5 °C·min− 1) and held constant for 5 min; then, the temperature was increased to 225 °C (2 °C·min− 1) and kept constant for 2 min. The total analysis time was 39.5 min. The fatty acids were identified by comparing the retention times of the peaks with those of known standards (Sigma Chemical Co., St. Louis, Mo). Fatty acid results are presented as g/100 g fatty acids. Saturated fatty acids are the sum of C14:0, C16:0, and C18:0. The monounsaturated fatty acids are the sum of C16:1n-7 and C18:1n-9. The (n-3) PUFA are the sum of C18:3n-3, C20:5n-3, C22:5n-3, and C22:6n-3. The (n6) PUFA are the sum of C18:2n-6 and C20:4n-6. The sum of the PUFA was calculated as the sum of (n-3) PUFA and (n-6) PUFA.
(Toyobo, Osaka, Japan) was used as the primer in the first step of cDNA synthesis. Reverse transcription reaction solution (20 µL) consisted of 2 µg of total RNA, 1 µL of MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (Toyobo, Osaka, Japan), 0.5 µL of an RNAse inhibitor (Toyobo, Osaka, Japan), 0.5 mmol/L of dNTP (Toyobo, Osaka, Japan), and 2 µL oligo-dT primers. Primer sequences and optimal PCR annealing temperatures are listed in Table 2. Polymerase chain reactions were performed on a 2720 Thermal Cycler (Applied Biosystems, USA). The PCR program began with a 94 °C denaturation for 5 min, followed by 25–35 cycles denatured at 94 °C for 30 s, annealing for 45 s, and extension for 30 s at 72 °C, with a final extension at 72 °C for 10 min. The PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide (10 µg/mL). The gel images were digitally captured with G:BOX (Syngene, Cambridge, UK) and densitometry values were measured using the Gene Tool software (Syngene, Cambridge, UK). Values are presented as a ratio of the specified gene signal in the selected linear amplification cycle divided by the β-actin signal. Data for each replicate represented the mean of three individual RT-PCRs. 2.6. Statistical analysis Fatty acids composition of milk were presented as means ± pooled SEM and analyzed by t-test. Cytokines concentrations and IFNγ/IL-10 ratio of sera were presented as means ± SE (n). Statistical analysis of the serum parameters were performed using the Kruskal–Wallis and Bonferroni methods of SAS 8.01 (SAS, 1989). The serum cytokines data were not normal distribution, and must be analyzed by a nonparametric test using the Kruskal–Wallis and Bonferroni methods of SAS 8.01 (SAS, 1989) according to Okazaki et al. (2008). The interaction cannot be analyzed using the Kruskal–Wallis and only the main effects of lactation (L) and post-weaning (PW) were analyzed. The gene expression data were presented as means ± pooled Table 2 Oligonucleotide polymerase chain reaction primers of genes. Genes a
Primer sequences (5′→3′)
Product size
Ta b (°C)
IL-12b
F: GTCGCAAAGGAGGCGCAGTT R: GCAGATTCTTGGGAGGGT F: CAGATTTCCTCTAAGCCACA R: CCACTCCACCACATACTCC F: CTGCTGGATTTACAGTTGCT R: ATATTTGCTGAGTCAGAGTT F: AAGATAACCAGGCCATTC R: GTCATTCAGTTTCCCAGA F: CCGGCTTCGGATGCAAGT R: AGTCCTCCAGCGTGTCGTG F: CCTCCTGAGCGGACTTGA R: CATAATCGTCTTTAGCCTTT F: GCATTCCCTCCTCTGGTC R: ATAGTGTCCTAACGCTCAT F: ATCCACTTCCCAACCAGC R: TCGGCATTACGTCTTCCAG F: CCAGGTCATCACCATCGG R: CCGTGTTGGCGTAGAGGT F: GGACTTCGAGCAGGAGATGG R: GCACCGTGTTGGCGTAGAGG
444
59.5
498
56
197
47
92
49
423
60
115
46.5
IL-12Rβ2 IL-2 IFN-γ
2.4. Cytokines determination Serum concentrations of IFN-γ and IL-10 were determined using a porcine specific ELISA kit as per the instructions of the manufacturer (ADL, USA).
GATA-3 IL-4 IL-6 IL-10
2.5. Relative reverse transcription (RT)-PCR β-actin
Total RNA was extracted using the TRIzol reagent (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA samples were quantified spectrophotometrically at 260 and 280 nm. A two-step semi-quantitative RTPCR method was used to measure IL-12b, IL-12Rβ2, IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes expression. Oligo-(dT)20n
β-actin
93
58
199
50
158
–
233
–
a IL-12b = Interleukin 12B, IL-12Rβ2 = Interleukin 12 receptor β2, IL2 = Interleukin 2, IFN-γ = Interferon γ, GATA-3 = GATA binding protein 3, IL-4 = Interleukin 4, IL-6 = Interleukin 6, IL-10 = Interleukin 10. b Ta: optimal PCR annealing temperature.
J. Luo et al. / Livestock Science 126 (2009) 286–291
diets or post-weaning diets, and IFN-γ/IL-10 ratio also was not affected by lactation diets added with 7% fish oil or 7% lard (P N 0.05). However, post-weaning fish oil diet tended to increase serum IFN-γ/IL-10 ratio (P = 0.093).
Table 3 Lipid concentration and fatty acid composition of milk of sows fed with and without fish oil. a Item
7% lard
7% fish oil
SEM
P-value
Lipid, % milk solid
5.69
5.81
0.27
0.77
0.20 0.68 0.18 0.73 0.23 0.72 0.72 0.44 0.03 0.45 0.04 0.07 0.04 0.06 0.11 0.49
b0.01 0.22 0.55 0.04 b0.01 b0.01 b0.01 b0.01 b0.01 b0.01 0.10 b0.01 b0.01 b0.01 b0.01 b0.01
Fatty acid composition, C14:0 C16:0 C18:0 SFA C16:1n-7 C18:1n-9 MUFA C18:2n-6 C20:4n-6 (n-6) PUFA C18:3n-3 C20:5n-3 C22:5n-3 C22:6n-3 (n-3) PUFA PUFA
% total fatty acid 3.43 4.47 32.44 33.69 3.76 3.91 39.63 42.07 8.42 10.77 27.97 20.73 36.40 31.50 13.56 10.78 0.39 0.29 13.95 11.07 0.56 0.65 0.04 2.71 0.10 1.12 0.07 2.53 0.77 7.00 14.71 18.07
289
3.3. Th genes expression On day 70, the expression of IL-12b, IL-12Rβ2, IL-2, IFN-γ, GATA-3, IL-4, IL-6, and IL-10 genes in spleens of weaned piglets (4 from each group) were assayed by semi-quantitative RT-PCR, and the results are shown in Table 5. Lactation fish oil feeding significantly increased splenic Th1 genes, IL-12b (P = 0.01), IL-12Rβ (P b 0.01), IL-2 (P b 0.05), and IFN-γ (P b 0.01) expression at the end of this experiment, while piglets with fish oil supplemented diet during postweaning period have higher IFN-γ (P = 0.08), IL-12b (P = 0.06), and IL-2 (P b 0.01) genes expression in spleen than piglets fed the lard diet. A significant lactation × post-weaning interaction for IL-2 gene expression was observed (P b 0.05). The GATA-3 gene expression of spleen did not differ between groups and IL-6 and IL-10 genes expression of weaned piglets in spleen were not affected by lactation effect (P N 0.05). The gene expression of IL-4 (P = 0.01) in spleen was lower in weaned piglets from fish oil fed sows than in piglets from lard fed sows. However, piglets fed fish oil diet have higher splenic IL-4 (P = 0.06), IL-6 (P b 0.01) and IL-10 (P = 0.05) mRNA abundances than piglets fed lard diet during post-weaning. A significant lactation × post-weaning interaction for IL-10 gene expression was observed (P b 0.01).
a Milk samples were collected at 21 d of lactation. Values are means ± pooled SEM, lard diet group n = 9, fish oil diet group n = 6.
SEM and analyzed by general linear model (GLM) of SAS 8.01 (SAS, 1989). Main effects of L and PW and their interaction were analyzed. Differences were considered significant at P b 0.05 and a tendency was recognized at P b 0.10. 3. Results
4. Discussion 3.1. Fatty acids composition of diets and milk In the present study, 7% of fish oil addition to late gestation and lactating sow markedly increased the (n-3) PUFA content of sow milk. Fish oil supplementation to sow diet and/or piglet diet significantly increased the (n-3) PUFA ingestion of piglets. Although serum IFN-γ and IL-10 levels were not affect by lactation or post-weaning fish oil administration, we observed a tendency for higher IFN-γ/IL-10 ratio in sera after 7% fish oil addition during post-weaning period. It was supported by the genes expression in spleen. In which IFN-γ mRNA abundance was markedly increased by dietary (n-3) PUFA supplementation, while the differences of IL-10 expression did not reach statistical significances for lactation or post-weaning (n-3) PUFA supplementation effects.
Fatty acid composition of sow and piglet diets and sow milk were shown in Tables 1 and 3, respectively. Fish oil diets and lard diets had the same levels of lipids; while the eicosapentaenoic acid (EPA, C20:5n-3), docosahexaenoic acid (DHA, C22:5n-3), and total (n-3) PUFA were 8–9 times higher in fish oil supplemented diets than in lard supplemented diets. Fish oil administration significantly increased the EPA, DHA, and total (n-3) PUFA levels in sows' milk (P b 0.01). Noteworthy, the EPA, DHA, and total (n-3) PUFA contents in milk were lower than those in sows' diets (2.7% vs. 6.6%, 2.5% vs. 3.9%, and 7.0% vs. 12.0%, respectively). 3.2. Serum concentrations of IFN-γ and IL-10
4.1. The effect of fish oil supplementation on Th1 polarization Serum IFN-γ and IL-10 concentrations and IFN-γ/IL-10 ratio of weaned piglets are shown in Table 4. Serum IFN-γ and IL-10 levels of weaned piglets were not affected by lactation
Results from the current study showed that fish oil addition promoted splenic IL-12b, IL-12Rβ2, IFN-γ and IL-2 genes
Table 4 IFN-γ and IL-10 concentrations, and IFN-γ/IL-10 ratio of sera in weaned piglets at the end of the experiment. a Lactation diet effect
IFNγ, pg/mL IL-10, pg/mL IFNγ/IL-10 a
P-value
7% lard
7% fish oil
20.54 ± 5.28 (27) 37.10 ± 10.00 (18) 0.92 ± 0.11 (18)
28.21 ± 7.05 (23) 46.50 ± 11.49 (18) 1.00 ± 0.10 (18)
Values are means ± SE (n).
0.52 0.72 0.69
Post-weaning diet effect
P-value
7% lard
7% fish oil
27.16 ± 7.00 (23) 50.81 ± 10.60 (17) 0.79 ± 0.09 (17)
21.44 ± 5.37 (27) 33.73 ± 9.76 (19) 1.11 ± 0.11 (19)
0.29 0.18 0.09
290
J. Luo et al. / Livestock Science 126 (2009) 286–291
Table 5 Splenic Th1/Th2 characteristic genes expression in weaned piglets at the end of the experiment. a Diet b CC
SEM CT
TC
TT
Th1 genes expression IL-12b 0.59 0.83 IL-12Rβ2 0.20 0.41 IL-2 0.12 0.34 IFN-γ 0.56 1.01
0.88 0.88 0.78 1.24
1.23 0.91 1.79 1.27
Th2 genes expression GATA-3 0.97 1.03 IL-4 0.79 1.16 IL-6 0.63 1.59 IL-10 0.43 0.31
0.92 0.33 0.79 0.22
1.08 0.65 1.66 0.62
P-value c L
PW
L × PW
0.12 0.08 0.10 0.14
0.01 b 0.01 b 0.01 0.02
0.06 0.28 b 0.01 0.08
0.66 0.40 0.02 0.11
0.12 0.15 0.05 0.08
0.98 0.01 0.11 0.61
0.10 0.06 b 0.01 0.05
0.41 0.89 0.42 b0.01
a Genes signal were measured as optical density and were divided by the β-actin signal. Values are means ± pooled SEM, n = 4. b CC = lactation lard diet and post-weaning lard diet; CT = lactation lard diet and post-weaning fish oil diet; TC = lactation fish oil diet and postweaning lard diet; TT = lactation fish oil diet and post-weaning fish oil diet. c L = lactation effect; PW = post-weaning effect; L × PW = interaction between lactation effect and post-weaning effect.
expression in piglets. The cytokine IL-12 mediates Th1 differentiation (Glimcher, 2001; O'Shea and Paul, 2002). Normal Th1 differentiation requires IL-12Rβ2 expression and the expression of IL-12Rβ2 is considered a marker for Th1 differentiation (Szabo et al., 1997; Rogge et al., 1997). The signature cytokine of Th1 is IFN-γ. This cytokine also can induce a potential positive feedback loop to promote the expression of IL-12Rβ2 and IFN-γ (Lighvani et al., 2001; Szabo et al., 2003). The cytokine IL-2 is also a Th1 cytokine and has the ability to induce T-lymphocyte proliferation (Smith, 1988). Collectively, the increases of IL-12b, IL-12Rβ2, IFN-γ and IL-2 genes expression in spleen of piglets after fish oil feeding indicated that (n-3) PUFA supplementation for piglets could promote Th1 differentiation and polarization. Previous researches showed inconsistent results of fish oil influenced Th1 cytokines expression and secretion (Fritsche et al., 1997, 1999; Kleemann et al., 1998; Sijben et al., 2001; Switzer et al., 2004; Khan et al., 2006). There are several reasons for these apparent discrepancies. One of potential reason for these apparent discrepancies was the physical condition of experimental animals. Investigations in healthy subjects exhibited higher Th1 cytokine production after (n-3) PUFA administration (Fritsche et al., 1997; Sijben et al., 2001; Lauritzen et al., 2005). Whereas, opposite results were shown in pathological animals, especially in the conditions primarily inducing cellular immunity (Kleemann et al., 1998; Fritsche et al., 1999; Khan et al., 2006). Other factors that interfered the effect of (n-3) PUFA on T cells cytokine production maybe the time when cytokine was determined and the difference between cultured conditions of splenocytes. Fish oil enhanced IFN-γ production when samples were assayed directly from (n3) PUFA fed animals (Fritsche et al., 1997; Oarada et al., 2003). In contrast, IFN-γ secretion was decreased in splenocytes from fish oil fed mice and cultured in fetal bovine serum (Fritsche et al., 1999; Wallace et al., 2001). However, fish oil increased IFN-γ in splenocytes cultured in the homologous mouse serum (Switzer et al., 2004). It was speculated that diet-induced
changes in T cell cytokine production could be masked by culture conditions (Switzer et al., 2004). 4.2. The effect of fish oil supplementation on Th2 cytokines production Results showed that lactation fish oil supplementation suppressed IL-4 gene expression in spleen from weaned piglets at the end of this experiment. However, the splenic IL-4 and IL6 mRNA abundances were higher in piglets fed with fish oil diet during post-weaning period and there was a lactation × postweaning increasing of splenic IL-10 gene expression in fish oil supplemented piglets. Calder (1998) suggested that the immunomodulatory effects of (n-3) PUFA are dependent on the content polyunsaturated fat in the diet. The results also showed that the EPA, DHA, and (n-3) PUFA contents in milk were lower than those in sows' diets (2.7% vs. 6.6%, 2.5% vs. 3.9%, and 7.0% vs. 12.0%, respectively). Thus, piglets suckling milk from 7% fish oil fed dams received fewer (n-3) PUFA than weaned piglets fed with 7% fish oil diet directly. The distinct effects on IL-4 expression between lactation fish oil supplementation and post-weaning fish oil addition to diets maybe due to the unequal levels (n-3) PUFA which piglets received during the two stages. Low level of (n-3) PUFA could decrease Th2 cytokines expression, whereas high levels of fish oil supplementation to diets of post-weaning piglets was likely to increase Th2 cytokines production in spleens of piglets. 4.3. The effect of (n-3) PUFA on immune maturation Immune maturation seems to be characterized by a Th1polarization and an improvement in the capacity to produce cytokines such as INF-γ and IL-2 (Field et al., 2001). Immune maturation primarily assessed by the production of IFN-γ (Damsgaard et al., 2007). The results showed that INF-γ and IL2 expression in spleen were higher and serum IFN-γ/IL-10 ratio was tended to increase in piglets supplemented with fish oil. These results indicated that (n-3) PUFA supplementation given rise to a Th1 polarization and a faster immune maturation. There were no investigations reported about the effect of (n-3) PUFA on Th cytokines production and polarization in young piglets, but studies in rodents agreed with the current study. The secretion of IFN-γ in splenocytes separated from (n-3) PUFA fed 145 ± 2 g female Fischer 344 rats was increased (Robinson et al., 2001). Infant fish oil supplementation could increase IFN-γ and IFN-γ/IL-10 in peripheral blood, polarize the immune response to Th1 and give rise to faster immune maturation (Lauritzen et al., 2005; Damsgaard et al., 2007). The mechanism behind the immune-modulating effect of (n-3) PUFA could be mediated through changes in prostaglandin E2 (PGE2) synthesis (Prescott and Calder, 2004). PGE2 enhances Th2 differentiation and suppresses the differentiation of Th1 cells (Betz and Fox, 1991). In vitro studies have shown that all PGE subtypes equipotently inhibit Th1 cytokine production (Miles et al., 2003; Dooper et al., 2002). Long chain (n-3) PUFA could either effectively raise EPA and DHA concentration in membrane lipids, decrease arachidonic acid content and the production of pro-inflammatory eicosanoids (Caughey et al., 1996; Yaqoob et al., 2000; Calder, 2002), or suppress cyclooxygenase-2 expression (Curtis et al., 2000; Lee et al., 2003), and then decreased PGE2 synthesis.
J. Luo et al. / Livestock Science 126 (2009) 286–291
5. Conclusion In the present study we found that (n-3) PUFA can regulate Th polarization and immune maturation in young piglets. Dietary fish oil supplementation increase Th1 special genes expression and cytokines production, shift the Th1/Th2 to Th1 polarization, and acquire a faster immune maturation in piglets. Whereas, high levels of fish oil supplementation to diets of postweaning piglets might increase splenic expression of Th2 cytokines. It is suggested that appropriate levels of fish oil supplementation to young piglets' diets may promote Th1 differentiation and accelerate immune maturation. However, excessive (n-3) PUFA administration also might delay the maturation of immunity. Further studies are required to explore the proper fish oil supplementation level and the immunomodulating effects of long chain (n-3) PUFA in young piglets. Acknowledgment This research was supported by the National High Technology R & D Program of China (No. 2006AA10Z140), National Science Foundation of China (No. 30871779) and Major Science & Technology Industrialization Projects in Wuhan City of China (No. 2007201120363). References Agnello, D., Lankford, C.S.R., Bream, J., Morinobu, A., Gadina, M., O shea, J.J., Frucht, D.M., 2003. Cytokines and transcription factors that regulate T helper cell differentiation: new players and new insights. J. Clin. Immunol. 23, 147–161. Betz, M., Fox, B.S., 1991. Prostaglandin E2 inhibits production of Th1 lymphokines but not of Th2 lymphokines. J. Immunol. 146, 108–113. Calder, P.C., 1998. Dietary fatty acids and the immune system. Nutr. Rev. 56, S70–S83. Calder, P.C., 2002. Fatty acids and gene expression related to inflammation. Nestle Nutr. Workshop Ser. Clin. Perform. Progr. 7, 19–40. Caughey, G.E., Mantzioris, E., Gibson, R.A., Cleland, L.G., James, M.J., 1996. The effect on human tumor necrosis factor alpha and interleukin 1 beta production of diets enriched in (n-3) fatty acids from vegetable oil or fish oil. Am. J. Clin. Nutr. 63, 116–122. Curtis, C.L., Hughes, C.E., Flannery, C.R., Little, C.B., Harwood, J.L., Caterson, B., 2000. n-3 fatty acids specifically modulate catabolic factors involved in articular cartilage degradation. J. Biol. Chem. 275, 721–724. Damsgaard, C.T., Lauritzen, L., Kjær, T.M.R., Holm, P.M.I., Fruekilde, M., Michaelsen, K.F., Frøkiær, H., 2007. Fish oil supplementation modulates immune function in healthy infants. J. Nutr. 137, 1031–1036. Dooper, M.M.B.W., Wassink, L., M Rabet, L., Graus, Y.M.F., 2002. The modulatory effects of prostaglandin-E on cytokine production by human peripheral blood mononuclear cells are independent of the prostaglandin subtype. Immunol. 107, 152–159. Endres, S., Ghorbani, R., Kelley, V.E., Georgilis, K., Lonnemann, G., van der Meer, J.W., Cannon, J.G., Rogers, T.S., Klempner, M.S., Weber, P.C., Schaefer, E.J., Wolff, S.M., Dinarello, C.A., 1989. The effect of dietary supplementation with (n-3) polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N. Engl. J. Med. 320, 265–271. Field, C.J., 2005. The immunological components of human milk and their effect on immune development in infants. J. Nutr. 135, 1–4. Field, C.J., Clandinin, M.T., van Aerde, J.E., 2001. Polyunsaturated fatty acids and T-cell function: implications for the neonate. Lipids 36, 1025–1032. Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Fritsche, K.L., Feng, C., Berg, J.N., 1997. Dietary fish oil enhances circulating interferon-gamma in mice during listeriosis without altering in vitro production of this cytokine. J. Interferon Cytokine Res. 17, 271–277. Fritsche, K.L., Byrge, M., Feng, C., 1999. Dietary omega-3 polyunsaturated fatty acids from fish oil reduce interleukin-12 and interferon-gamma production in mice. Immunol. Lett. 65, 167–173. Glimcher, L.H., 2001. Lineage commitment in lymphocytes: controlling the immune response. J. Clin. Invest. 108, S25–S30.
291
Kew, S., Banerjee, T., Minihane, A.M., Finnegan, Y.E., Williams, C.M., Calder, P.C., 2003. Relation between the fatty acid composition of peripheral blood mononuclear cells and measures of immune cell function in healthy, freeliving subjects aged 25–72 y. Am. J. Clin. Nutr. 77, 1278–1286. Kleemann, R., Scott, F.W., Worz-Pagenstert, U., Nimal Ratnayake, W.M., Kolb, H., 1998. Impact of dietary fat on Th1/Th2 cytokine gene expression in the pancreas and gut of diabetes-prone BB rats. J. Autoimmun. 11, 97–103. Khan, N.A., Yessoufou, A., Kim, M., Hichami, A., 2006. N-3 fatty acids modulate Th1 and Th2 dichotomy in diabetic pregnancy and macrosomia. J. Autoimmun. 26, 268–277. Lauritzen, L., Kjær, T.M.R., Fruekilde, M., Michaelsen, K.F., Frøkiær, H., 2005. Fish oil supplementation of lactating mothers affects cytokine production in 21/2-year-old children. Lipids 40, 669–676. Liblau, R.S., Singer, S.M., McDevitt, H., 1995. Thl and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16, 34–38. Lee, J.Y., Plakidas, A., Lee, W.H., Heikkinen, A., Chanmugam, P., Bray, G., Hwang, D.H., 2003. Differential modulation of Toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J. Lipid Res. 44, 479–486. Lighvani, A.A., Frucht, D.M., Jankovic, D., Yamane, H., Aliberti, J., Hissong, B.D., Nguyen, B.V., Gadina, M., Sher, A., Paul, W.E., O Shea, J.J., 2001. T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 98, 15137–15142. Meydani, S.N., Endres, S., Woods, M.M., Goldin, B.R., Soo, C., Morrill-Labrode, A., Dinarello, C.A., Gorbach, S.L., 1991. Oral (n-3) fatty acid supplementation suppresses cytokine production and lymphocyte proliferation: comparison between young and older women. J. Nutr. 121, 547–555. Miles, E.A., Aston, L., Calder, P.C., 2003. In vitro effects of eicosanoids derived from different 20-carbon fatty acids on T helper type 1 and T helper type 2 cytokine production in human whole-blood cultures. Clin. Exp. Allergy 33, 624–632. National Research Council, 1998. Nutrient Requirements of Swine, 10th edn. National Academy Press, Washington, DC, USA. Oarada, M., Tsuduki, T., Suzuki, T., Miyazawa, T., Nikawa, T., Hong-quan, G., Kurita, N., 2003. Dietary supplementation with docosahexaenoic acid, but not with eicosapentaenoic acid, reduces host resistance to fungal infection in mice. Biochim. Biophys. Acta 1622, 151–160. Okazaki, K., Kondo, M., Kato, M., Kakinuma, R., Nishida, A., Noda, M., Taniguchi, K., Kimura, H., 2008. Serum cytokine and chemokine profiles in neonates with meconium aspiration syndrome. Pediatrics 121, e748–e753. O Shea, J.J., Paul, W.E., 2002. Regulation of T(H)1 differentiation—controlling the controllers. Nat. Immunol. 3, 506–508. Prescott, S.L., Calder, P.C., 2004. N-3 polyunsaturated fatty acids and allergic disease. Curr. Opin. Clin. Nutr. Metab. Care. 7, 123–129. Robinson, L.E., Clandinin, M.T., Field, C.J., 2001. R3230 AC rat mammary tumor and dietary long-chain (n-3) fatty acids change immune cell composition and function during mitogen activation. J. Nutr. 131, 2021–2027. Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D.H., Gubler, U., Sinigaglia, F., 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185, 825–831. SAS Institute Inc, 1989. SAS/STAT User's Guide: Version 6, 4th edn. SAS Institute Inc., Cary, North Carolina, USA. Sijben, J.W., Schrama, J.W., Parmentier, H.K., van der Poel, J.J., Klasing, K.C., 2001. Effects of dietary polyunsaturated fatty acids on in vivo splenic cytokine mRNA expression in layer chicks immunized with Salmonella typhimurium lipopolysaccharide. Poult. Sci. 80, 1164–1170. Smith, K.A., 1988. Interleukin-2: inception, impact, and implications. Science 240, 1169–1176. Switzer, K.C., Fan, Y.Y., Wang, N., McMurray, D.N., Chapkin, R.S., 2004. Dietary n-3 polyunsaturated fatty acids promote activation-induced cell death in Th1-polarized murine CD4+ T-cells. J. Lipid Res. 45, 1482–1492. Szabo, S.J., Dighe, A.S., Gubler, U., Murphy, K.M., 1997. Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185, 817–824. Szabo, S.J., Sullivan, B.M., Peng, S.L., Glimcher, L.H., 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21, 713–758. Venkatraman, J.T., Chandrasekar, B., Kim, J.D., Fernandes, G., 1994. Effects of n-3 and n-6 fatty acids on the activities and expression of hepatic antioxidant enzymes in autoimmune-prone NZB × NZW F1 mice. Lipids 29, 561–568. Wallace, F.A., Miles, E.A., Evans, C., Stock, T.E., Yaqoob, P., Calder, P.C., 2001. Dietary fatty acids influence the production of Th1- but not Th2-type cytokines. J. Leukoc. Biol. 69, 449–457. Yaqoob, P., Pala, H.S., Cortina-Borja, M., Newsholme, E.A., Calder, P.C., 2000. Encapsulated fish oil enriched in [alpha]-tocopherol alters plasma phospholipid and mononuclear cell fatty acid compositions but not mononuclear cell functions. Eur. J. Clin. Invest. 30, 260–274.