Effect of Different Roughages on Milk Protein and Milk Fat Synthesis in Dairy Cows

December 2016

ScienceDirect

Vol. 23 No. 4 40-46

Journal of Northeast Agricultural University (English Edition)

Available online at www.sciencedirect.com

Effect of Different Roughages on Milk Protein and Milk Fat Synthesis in Dairy Cows Sha Shan-shan1, Zhang Na2, and Li Qing-zhang3* 1

College of Life Sciences, Northeast Agricultural University, Harbin 150030, China

2

Key Laboratory of Dairy Science of Education Ministry, Northeast Agricultural University, Harbin 150030, China

3

College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, China

Abstract: The main purpose of this study was to determine the effect of a corn straw or mixed diet on milk production, milk composition and the expression of genes associated with lactation in mid-lactation Chinese Holstein cows. In this study, 10 healthy Chinese Holstein cows were randomly assigned to two groups and fed with different diets respectively, corn straw (CS) or mixed forage (MF) diet. CS group was fed roughage consisting of 53.8% corn straw only and the forge to concentrate (F : C) ratio [dry matter (DM)] was about 40: 60. MF group was fed roughage consisting of 3.7% Chinese wildrye and 23.4% alfalfa hay, the forge to concentrate (F : C) ratio (DM) was 70: 30. All the cows were fed 8 weeks and body weight, dry matter intake, body condition score, fat, protein, lactose, milk yield, total solid and somatic cell count (SCC) were recorded. Quantitative real-time PCR (qRT-PCR) was used to analyze cow mammary gland samples representing two different diets. The results suggested that different diet types had significant effects on milk yield, lactose, milk fat, milk protein, dry matter intake and somatic cell count in dairy cows, and cows fed MF diet improved milk production and lactation performance clearly (P<0.05). In addition, mRNA expression of genes ACC, mTOR, STAT5, CSN2, PPARγ, FABP3 and PTEN in MF group was extremely significantly higher than that in CS group (P<0.05). mRNA expression of AKT1, FAS, SCD and SREBP1c in MF group was significantly higher than that in CS group (P<0.01). In summary, the milk yield and composition in mixed forage group were significantly improved than those in corn straw group. Key words: dairy cow, different roughages, milk production, milk composition CLC number: S823.9+1

Document code: A

Article ID: 1006-8104(2016)-04-0040-07

2012). Corn straws are widely used as main roughage

Introduction

sources for most dairy farms in China, but the amount

It has been known for many years that various dietary

livestock production. In recent years, Chinese wildrye

factors, such as roughage type and proportion can

and alfalfa hay as main mixed forage are used as basic

affect rumen fermentation, milk production and

components in feeding programs for dairy cows in

composition (Weng et al., 2012). The roughage is

most areas of China. It is well known that Chinese

critical to the cow general health, milk production and

wildrye and alfalfa hay provide highly nutritious

quality. Roughage type as a key factor is widely used

forage in terms of proteins, vitamins and minerals for

to improve milk production and milk fat and protein

ruminant animals. There are series of studies on the

to increase economic genetic efficiency (Peres et al.,

effects of different roughages on lactation performance

and nutrient quality of corn straws are not enough for

Received 18 June 2016 Supported by Fund of the National Basic Research Program of China (973) (2011CB100804) Sha Shan-shan (1991-), female, Master, engaged in the research of animal biochemistry and molecular biology. E-mail: [email protected] * Corresponding author. E-mail: [email protected] E-mail: [email protected]

·41·

Sha Shan-shan et al. Effect of Different Roughages on Milk Protein and Milk Fat Synthesis in Dairy Cows

and metabolic changes in dairy cows. The effect

　Throughout the experimental period, milk yield of

of a corn straw or mixed forage diet on endocrine,

each cow was recorded at each milking, and stored at

metabolism and lactation performance was reported

4℃ with a preservative until analyzed for fat, protein,

in periparturient Holstein cows (Qin et al., 2013). The

lactose, total solid and dry matter intake. Cows were

influence of roughage types on ruminal metabolite

slaughtered and mammary parenchymal tissues were

profile that correlated with feeding on different

aseptically excised 5 cm from the base of the nipple

roughage types was investigated (Zhao et al., 2014).

and 3 cm from the half line that divides the glandular

Some studies investigated the effects of dietary

quarters of each animal. The samples of mammary

replacement of grass silage (GS) with forage millet

tissues were aseptically excised and immediately

silages that were harvested at two stages of maturity

frozen in liquid nitrogen and stored at –80℃ until

on milk production, apparent total-tract digestibility

further analyses.

and ruminal fermentation characteristics of dairy cows (Brunette et al., 2015). 　The aim of this study was to evaluate the effects of

Table 1　Ingredient and nutrient composition of corn straw (CS) and mixed forage (MF) diet

two different forage quality diets on milk production, milk composition and expression of genes associated

Item

with lactation in dairy cows. This study was also

Ingredient (g • 100 g-1 of DM)

aimed at exploring a more suitable dietary type for lactation cows to improve milk production and quality.

Corn straw

Mixed forage

Chinese wildrye

–

3.70

Alfalfa hay

–

23.40

It is critical to the general health of cows and the

Corn straw

53.80

–

development of milk industry and nutrition research

Corn silage

24.60

24.60

Soybean meal

14.80

14.80

Cotton seed

5.10

5.10

CaHCO3

0.60

0.60

NaCl

0.50

0.50

Mixed feed

0.60

0.60

for the future.

Materials and Methods Animals and tissue samples Twelve healthy mid-lactating Holstein cows [(550±25) kg of body weight at the start of the experiment] were

mRNA level of genes by quantitative real-time

randomly divided into two groups: corn straw group

PCR

(CS) and mixed forage group (MF). Corn straw group

The total RNA extraction and cDNA synthesis. The

cows (n=5) were fed 53.8% corn straw only and F : C

total RNA was isolated from the mammary tissue

ratio [dry matter (DM)] was 40: 60; and mixed forage

samples by Trizol Reagent (Invitrogen, Carlsbad, CA).

group cows (n=5) were fed mixed forage consisting of

Con-centration and purity of the isolated RNA were

3.7% Chinese wildrye and 23.4% alfalfa hay, F : C ratio

mea-sured in Nanodrop spectrophotometer (Thermo

(DM) was 70: 30. Ingredient and nutrient composition

Scien-tific, USA). RNA integrity was evaluated by

of the diets used in this study are presented in Table 1.

the observation of 18S and 28S ribosomal bands after

They were fed twice at 6: 00 a.m. and 6: 00 p.m., and

electrophoresis on 1% agarose gel in the presence of

milked at 6: 00 a.m. and 6: 00 p.m. Other feeding

ethidium bromide. Complimentary DNA (cDNA) was

conditions were the same and nutrition was abundant

reverse transcribed from total RNA samples, using

for two group cows, according to the College of

oligo dT primers and cDNA synthesis premium kit

Animal Sciences, Northeast Agricultural University,

(TaKaRa, Tokyo, Japan) following the manufacturers'

Harbin, China.

instructions. http: //publish.neau.edu.cn

·42·

Journal of Northeast Agricultural University (English Edition)

Vol. 23　No. 4　2016

　Primer design and relative qRT-PCR. cDNA from healthy cow mammary tissues was subjected to qRT-

Statistical analysis

PCR. The specific primers of genes that were used for

All the data were presented as mean±SEM. For the

Power SYBR® Green QPCR master mix (Applied Bio-

expression levels of genes in lactating cows, and data

systems, USA) based on qRT-PCR analysis are shown in

were analyzed by ANOVA (GraphPad Prism 5, La

Table 2. β-actin gene was used as a reference control

Jolla, CA). Since a significant (P<0.01) effect of the

gene. To assess the specificity of amplified product,

roughage type was shown, the differences between two

dissociation curves were generated at temperatures

roughage types were tested using Duncan's test with a

between 55℃ and 95℃. All the qRT-PCR reactions

probability of 0.05.

were performed at 95℃ for 30 s, followed by 40 cycles at 95℃ for 5 s, 60℃ for 34 s. After 40 cycles of amplification, the threshold cycle (Ct) values were

Results

obtained automatically by the instrument and then

Milk production and composition of CS and

used for quantitative analyses. Amplifications were

MF groups

performed in triplicate for each sample. The data were

Milk production data are presented in Table 3. Cows

performed by 2

-ΔΔCT

method (Huang et al., 2012).

fed corn straw produced less milk yield, total solid and dry matter intake than cows fed mixed forage. Cows

Table 2　Primers for critical regulators associated with milk fat and protein synthesis

fed mixed forage diet tended to produce more milk fat and protein compared with cows fed corn straw diet. The proportion of milk fat, protein and lactose in MF

Primer

group were higher than those in CS group. The lactose

CSN2 GCF_000003055.6

F: GTACCTGGTGAGATTGTGG R: CTGTTTGCTGCTGTTCCT

There were no significant differences in proportions of

STAT5 NM_001012673.1

F: GTCCCTTCCCGTGGTTGT R: CGGCCTTGAATTTCATGTTG

Gene

mTOR

Accession No.

F: ATGCTGTCCCTGGTCCTTATG XM_001788228.1 R: GGGTCAGAGAGGTGGCCTTCAA

AKT1

NM_173986.2

F: TAAAGAAGGAGGTCATCGTGG R: CGGGACAGGTGGAAGAAAA

β-actin

AF_481159.1

F: AAGGACCTCTACGCCAACACG R: TTTGCGGTGGACGATGGAG

ACC

GCF_000003055.6

F: AGACAAACAGGGACCATT R: AGGGACTGCCGAAACAT

FAS

GCF_000003055.6

F: CCACGGCTGTCGGTAAT R: CGCTCCCACTCATCCTG

SCD

AF_188710.1

F: CTGTGGAGTCACCGAACC R: TAGCGTGGAACCCTTTT

SREBP1c NM_001113302 FABP3

DN_518905

F: CCAGCTGACAGCTCCATTGA R: TGCGCGCCACAAGGA F: GAACTCGACTCCCAGCTTGAA R: AAGCCTACCACAATCATCGAAG

PPARγ GCF_000003055.6

F: TCAAAGTGGAGCCTGTATC R: CATAGTGGAACCCTGACG

PTEN GCF_000003055.6

F: CACCTATTCCTCAGCCCTTAT R: AACCCTCATTCAGACCTTCAC

E-mail: [email protected]

did not differ between the two dietary treatments. milk fat and protein and lactose (%) between CS and MF groups. Table 3　Milk production and composition changes for cows fed two different diets Item

CS group

MF group

SEM

Milk yield

11.38

12.80

1.49

Fat

4.38

5.22

0.27

Protein

3.14

3.51

0.19

Lactose

4.51

4.78

0.06

Total solids

12.79

13.72

0.11

Dry matter intake

10.45

13.10

1.09

SCC

–4.92

–6.40

0.24

Fat

4.15

4.10

0.22

Protein

3.26

3.49

0.08

Lactose

4.68

4.33

0.03

Composition (%)

CS, Corn straw; MF, Chinese wildrye+alfalfa hay; SCC, Somatic cell counts; Somatic cell score=log2(SCC/10000)+3.

·43·

Sha Shan-shan et al. Effect of Different Roughages on Milk Protein and Milk Fat Synthesis in Dairy Cows

varied significantly (P<0.001). mRNA level of genes Expression of genes of milk fat and protein

associated with milk protein, normalized by the levels

synthesis in dairy cows

of β-actin mRNA, mTOR, STAT5, CSN2 and PTEN

qRT-PCR analyses detected the expression of genes

varied significantly (P<0.05); AKT1 gene extremely

associated with milk fat and protein synthesis in two

varied significantly (P<0.001). These results are

group cows. mRNA level of genes associated with

presented in Fig. 1. These results suggested the genes

milk fat, normalized by the level of β-actin mRNA,

were related to milk fat and protein synthesis and the

ACC, PPARγ and FABP3 genes varied significantly

expressions of genes were higher in mixed forage

(P<0.05); FAS, SCD and SREBP1c genes extremely

group than those in corn straw group. 1.5

*

1.5

mRNA expression relative to β-actin

mRNA expression relative to β-actin

2.0

1.0 0.5 0

CS

**

1.0 0.5 0 CS

MF

4

1.0 0.5 0

CS

3 2 1 0

MF

CS

1.5 1.0 0.5 CS

*

1.5 1.0 0.5 0 CS

CS

MF

*

2.0 1.5 1.0 0.5 0

MF

CS

MF

3 2 1 MF

2.5

PTEN

2.0 1.5 1.0 0.5 0

3

* mRNA expression relative to β-actin

*

mRNA expression relative to β-actin

mRNA expression relative to β-actin

0

STAT5

SREBP1c

CSN2

0.5

2.5

2.0

MF

CS

1.0

mTOR

mRNA expression relative to β-actin

2.0

0

1.5

MF

2.5

** mRNA expression relative to β-actin

mRNA expression relative to β-actin

2.5

4

*

2.0

SCD

FAS

0

2.5

** mRNA expression relative to β-actin

**

1.5

mRNA expression relative to β-actin

mRNA expression relative to β-actin

2.0

MF AKT1

ACC

CS

MF

*

2 1 0 CS

MF

FABP3

PPARγ

Fig. 1　Expression of genes associated with milk fat and protein synthesis between CS and MF groups Relative amount of mRNA of genes to β-actin mRNA is calculated as 2-△△CT. Means (±SE) with different superscripts differ significantly (P<0.05).

http: //publish.neau.edu.cn

·44·

Journal of Northeast Agricultural University (English Edition)

Vol. 23　No. 4　2016

the milk protein synthesis signaling pathway in dairy

Discussion

cows. Our results showed that STAT5, AKT1, mTOR, CSN2 and PTEN mRNA levels were expressed at

The experiment feeding different roughages in the

higher levels in MF group than those in CS group.

diet is often associated with ruminal pH which can

Some studies suggested that JAK2-STAT5 pathway

affect digestive effectiveness. Mixed forage group

and mTOR pathway played important roles in initia-

has a higher mean rumen pH compared with simplex

tion and maintaining of lactation in dairy cows.

corn straw group. The relationship between roughage

STAT5 activity is mostly regulated through tyrosine

type and change in milk yield and milk fat and protein

phosphorylation status, which leads to their dimeriza-

can be explained by changes in rumen fermentation

tion, nuclear translocation and further regulated the

patterns. The dietary nitrate addition had significant

expression of target genes associated to milk protein

effects on rumen fermentation, nutrient digestibility

synthesis. AKT1 can stimulate the translation of milk

and microbial protein synthesis in dairy cows (Olijhoek

proteins through its ability to phosphorylate eukaryotic

et al., 2016). It is indicated that mixed roughage is

translation initiation factor 4E binding protein 1

beneficial to ruminal function in dairy cows. More

(4EBP1). AKT1 is active in the form of phosphoryla-

researches are required to understand mechanisms

tion and regulates the proliferation and differentiation

of rumen microorganism's adaptation to different

of mammary epithelial cells and lactation performance.

roughage types and proportion. In this study, higher

PTEN can regulate the milk protein synthesis by down-

dry matter intake (DMI) was observed in mixed forage

regulating PI3K-AKT pathway (Dupont et al., 2002).

group which was due to a faster rate of digestion and

A recent study showed that PTEN-AKT pathway was

passage from the rumen. Response in milk yield also

required for the initiation of lactation through the

might be on account of significant difference in DMI

induction of autocrine PRL, providing a direct link

between two dietary treatments. Meanwhile, milk

between AKT and STAT5 pathways. The production

somatic cell count (SCC) is not only a measure of

of autocrine PRL was regulated by PTEN-PI3K-

herd udder healthy performance, it is also a standard

AKT pathway (Wang et al., 2014). β-casein (CSN2)

for milk quality. The milk SCC in CS group was

is the major milk protein in dairy cows, it is also an

significantly higher than that in MF group. Increased

indicator of lactation ability for mammary gland. The

SCC had been associated with decreased milk in

obvious changes in the expression levels of β-casein

the mid-lactation cows. The effect of a corn straw

are hallmarks of mammary gland development and

or mixed forage diet on endocrine, metabolism and

differentiation. β-casein mRNA level was higher in

lactation performance in periparturient Holstein cows.

MF group than that in CS group, which could promote

The higher milk SCC in this study for CS treatment

the milk protein synthesis in dairy cows. Our results

might imply an incidence of intramammary infection,

revealed that the higher expression levels of mTOR,

which negatively affected milk production and quality.

STAT5, AKT1, CSN2 and PTEN could stimulate milk

　In this study, different roughage types would affect

protein synthesis in dairy cows.

milk protein synthesis in dairy cows. It is known that

　In this study, two different roughages had significant

different roughage types can affect rumen microbial

effects on the milk fat synthesis. On one hand, mixed

fermentation, improve contents of free amino acid and

forage could alter rumen fermentation environment

increase the raw materials of milk protein synthesis.

and improve the amount of fatty acid, such as acetic

Our results suggested that the milk protein synthesis

acid and hydroxybutyric acid. On the other hand, long

was higher in MF group than that in CS group. mTOR,

chain unsaturated fatty acids in milk were obtained

STAT5, AKT1, CSN2 and PTEN are major factors in

from arterial blood, and these unsaturated fatty acids

E-mail: [email protected]

·45·

Sha Shan-shan et al. Effect of Different Roughages on Milk Protein and Milk Fat Synthesis in Dairy Cows

were mainly from diets. Our results clearly showed

acid related to milk fat synthesis. The contents of milk

that the levels of milk fat in MF group were higher

fat were higher in MF group than those in CS group.

than those in CS group. Many genes had been reported involved in the process of milk fat metabolism, such as ACC, FAS, SCD, FABP3, SREBP1c and PPARγ.

Conclusions

FABP3 was expressed mainly in dairy cow mammary

In summary, this study suggested that roughage

gland was reported to be a key transcription regulating

types could affect the milk fat and protein synthesis

factor in the milk fat synthesis signaling pathway

by regulating mRNA expression levels of genes

(Dubey et al., 2016). Recent studies indicated FABP3

involved in milk fat and protein synthesis in mammary

was the target gene of SREBP1c and PPARγ, FABP3

gland. We have gained new insights into the effects

upregulated the expression of SREBP1c and PPARγ

of roughage types on the production and quality of

to increase lipid droplet accumulation (Liang et al.,

milk in the dairy cow. Ongoing efforts are required to

2014). SREBP1c was considered a central hub in the

understand the exact mechanism by which different

transcriptional network controlling milk fat synthesis

roughages regulated lactation performance.

in dairy cows (Li et al., 2014). Compared with CS diet, SREBP1c had a significant increase in expression

References

of genes in MF diet. Overall, the results provided

Acosta D A V, Denicol A C, Tribulo P, et al. 2016. Effects of rumen-

strong supports for a central role of SREBP1c in the

protected methionine and choline supplementation on the preim-

regulation of milk fat synthesis in dairy mammary

plantation embryo in holstein cows. Theriogenology, 85(9): 1669-

gland (Xu et al., 2016). In addition, milk fat synthesis

1679.

appeared to be regulated by PPARγ, at least in bovines.

Ametaj B N, Zebeli Q, Saleem F, et al. 2010. Metabolomics reveals

Some studies found that the inhibition of PPARγ

unhealthy alterations in rumen metabolism with increased propor-

signaling was involved in decrease of lipid synthesis

tion of cereal grain in the diet of dairy cows. Metabolomics, 6(4): 583-

in murine mammary tissue (Kadegowda et al., 2013).

594.

PPARγ was expressed in dairy cow mammary gland, where it played a critical role in regulating energy

Bionaz M, Loor J J. 2008. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics, 9(1): 1-21.

balance and the metabolism of fatty acids and glucose

Brunette T, Baurhoo B, Mustafa A F, et al. 2015. Effects of replacing

(Parodi et al., 2016). Recently, a number of studies

grass silage with forage pearl millet silage on milk yield, nutrient

demonstrated that PPARγ could influence triacylgly-

digestion, and ruminal fermentation of lactating dairy cows. Journal of

cerol synthesis and secretion in dairy cow mammary

Dairy Science, 99(1): 269-279.

epithelial cells (Liu et al., 2016). qRT-PCR analysis

Chen Q, Wu Y, Zhang M, et al. 2016. Milk fat globule is an alternative to

revealed the expression of FABP3, SREBP1c and

mammary epithelial cells for gene expression analysis in buffalo.

PPARγ was higher in MF group than that in CS group.

Journal of Dairy Research, 83(2):1-7.

Our results revealed that the higher expression of

Dubey P K, Goyal S, Mishra S K, et al. 2016. Identification of poly-

FABP3, SREBP1c and PPARγ could stimulate milk fat

morphism in fatty acid binding protein 3 (FABP3) gene and its

synthesis in dairy cow mammary gland. ACC, FAS and

association with milk fat traits in riverine buffalo (Bubalus bubalis).

SCD were the limited enzymes in the process of milk

Tropical Animal Health & Production, 47(8): 1-5.

fat synthesis, which played crucial roles in fatty acid

Dupont J, Renou J P, Shani M, et al. 2002. Pten overexpression suppre-

synthesis and transport. Some studies revealed that

sses proliferation and differentiation and enhances apoptosis of the

these genes were involved in the regulation of milk

mouse mammary epithelium. Journal of Clinical Investigation,

fat metabolism. The expression of these genes in MF

110(6): 815-825.

group at higher level increased the expression of fatty

Huang J G, Gao X J, Li Q Z, et al. 2012. Proteomic analysis of the

http: //publish.neau.edu.cn

·46·

Journal of Northeast Agricultural University (English Edition)

Vol. 23　No. 4　2016

nuclear phosphorylated proteins in dairy cow mammary epithelial

supplementation. Revista Brasileira De Zootecnia, 41(3): 790-796.

cells treated with estrogen. In Vitro Cellular & Developmental Bio-

Pineda A, Drackley J K, Garrett J, et al. 2016. Effects of rumen-pro-

logy-Animal, 48(7): 449-457. Kadegowda A K, Khan M J, Piperova L S, et al. 2013. Trans-10, cis

tected niacin on milk production and body temperature of middle and late lactation holstein cows. Livestock Science, 187: 16-23.

12-conjugated linoleic acid-induced milk fat depression is associated

Qin T, Wang H, Bu D, et al. 2013. Effect of a corn straw or mixed

with inhibition of PPARγ signaling and inflammation in murine

forage diet on endocrine, metabolism and lactation performance in

mammary tissue. Journal of Lipids, 2013(9): 890343-890343.

periparturient cows. Journal of Animal & Veterinary Advances, 12(2):

Liang M Y, Hou X M, Qu B, et al. 2014. Functional analysis of FABP3 in

276-282.

the milk fat synthesis signaling pathway of dairy cow mammary

Seo M, Lee H J, Kim K, et al. 2016. Characterizing milk production

epithelial cells. In Vitro Cellular & Developmental Biology Animal,

related genes in holstein using RNA-seq. Asian Australasian Journal of

50(9): 865-873.

Animal Sciences, 29(3): 343-351.

Li N, Zhao F, Wei C, et al. 2014. Function of SREBP1c in the milk

Wang Z, Hou X, Qu B, et al. 2014. Pten regulates development and

fat synthesis of dairy cow mammary epithelial cells. International

lactation in the mammary glands of dairy cows. Plos One, 9(7): 1-13.

Journal of Molecular Sciences, 15(9): 16998-17013.

Weng X, Bu D, Li F, et al. 2012. Responses in milk yield, milk

Liu L, Lin Y, Liu L, et al. 2016. Regulation of peroxisome proliferator-

composition and rumen fermentation in lactating cows receiving a

activated receptor gamma on milk fat synthesis in dairy cow

corn straw or mixed forage diet. Journal of Animal & Veterinary

mammary epithelial cells. In Vitro Cellular & Developmental

Advances, 11(24): 4678-4683.

Biology-Animal, 16: 1-16.

Wright T C, Moscardini S, Luimes P H, et al. 1998. Effects of rumen-

Olijhoek D W, Hellwing A L, Brask M, et al. 2016. Effect of dietary

undegradable protein and feed intake on nitrogen balance and milk

nitrate level on enteric methane production, hydrogen emission,

protein production in dairy cows. Journal of Dairy Science, 81(3):

rumen fermentation, and nutrient digestibility in dairy cows. Journal

784-793.

of Dairy Science, 99(8): 6191-6205.

Xu H F, Luo J, Zhao W S, et al. 2016. Overexpression of SREBP1c

Parodi P W. 2016. Cooperative action of bioactive components in milk

(sterol regulatory element binding protein 1) promotes de novo fatty

fat with PPARs may explain its anti-diabetogenic properties. Medical

acid synthesis and triacylglycerol accumulation in goat mammary

Hypotheses, 89: 1-7.

epithelial cells. Journal of Dairy Science, 99(1): 783-795.

Peres A A D C, Vasquez H M, Silva J F C D, et al. 2012. Production

Zhao S, Zhao J, Bu D, et al. 2014. Metabolomics analysis reveals large

and quality of milk from mantiqueira dairy cows feeding on mom-

effect of roughage types on rumen microbial metabolic profile in

basa grass pasture and receiving different sources of roughage

dairy cows. Letters in Applied Microbiology, 59(1): 79-85.

E-mail: [email protected]