Effect of early pregnancy on the expression of progesterone receptor and progesterone-induced blocking factor in ovine lymph node

Theriogenology 93 (2017) 78e83

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Effect of early pregnancy on the expression of progesterone receptor and progesterone-induced blocking factor in ovine lymph node Ling Yang*, Shengqin Zang, Ying Bai, Xiaolei Yao, Leying Zhang Department of Animal Science, College of Life Science and Food Engineering, Hebei University of Engineering, Handan 056021, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 November 2016 Received in revised form 24 January 2017 Accepted 30 January 2017 Available online 1 February 2017

Lymph nodes are the sites where the immune reaction or suppression takes place. Progesterone (P4) exerts an essential effect of the immunomodulation on the maternal uterus during early pregnancy in ruminants. At present study, the inguinal lymph nodes were obtained at day 16 of non-pregnancy, days 13, 16 and 25 of pregnancy (n ¼ 3 for each group) in ewes, and RT-PCR assay, western blot and immunohistochemistry analysis were used to analyze to the effect of early pregnancy on the expression of P4 receptor (PGR) and progesterone-induced blocking factor (PIBF) in the lymph nodes. Our results showed that the PGR and PIBF mRNA were up-regulated in the lymph nodes in pregnant ewes, and the PGR isoform (60 kDa) and the PIBF variant (75 kDa) were expressed constantly in the lymph nodes. However, there was no expression of the PGR isoform (40 kDa) and the PIBF variant (48 kDa) at day 16 of the estrous cycle. The immunohistochemistry results confirmed that the PGR and PIBF proteins were limited to the subcapsular sinus and trabeculae in the cortex, medullary sinuses, and were localized in the cytoplasm of the specific cells. This paper reports for the first time that early pregnancy exerts its effect on the specific cells in the lymph nodes through P4, which results in the up-regulated expression of the PGR mRNA and 40 kDa isoform, the PIBF mRNA and 48 kDa variant, and is involved in the immunoregulation of the lymph nodes through a cytosolic pathway in ewes. © 2017 Elsevier Inc. All rights reserved.

Keywords: Ewe Lymph node Pregnancy Progesterone induced blocking factor Progesterone receptor

1. Introduction During early pregnancy in ruminants, the elongating periimplantation conceptus secretes the primary signal for maternal recognition of pregnancy, interferon tau (IFNT), which prolongs the lifespan of the corpus luteum (CL) [1e3]. Progesterone (P4) is an endogenous steroid, is primarily produced by the CL, and involved in the oestrous cycle, pregnancy, and mammal embryogenesis, and critical to the immunomodulation in mammals [4e6]. It is also reported that P4 regulates the blastocyst growth and conceptus elongation indirectly via the endometrium, which is essential for ovine conceptus survival and growth [7]. P4 regulates reproductive functions through binding to P4 receptors (PGR) which include nuclear PGR (PGR-A and PGR-B) and membrane PGR (mPGR) [8]. P4 binds to PGR, which results in the formation of new mRNA, and the mRNA is translated to the specific proteins by ribosomes. PGR is involved in the control of transcriptional network in the uterine endometrium [9]. Progesterone-induced blocking factor (PIBF) is a

* Corresponding author. Tel.: þ86 310 8676856; fax: þ86 310 8573119. E-mail address: [email protected] (L. Yang). http://dx.doi.org/10.1016/j.theriogenology.2017.01.042 0093-691X/© 2017 Elsevier Inc. All rights reserved.

protein that plays a role in the immunologic and proliferative actions, is induced by P4 through intracellular PGR in U373 cells [10]. A characteristic feature of normal pregnancy is high concentration of PIBF in the urine, and PIBF is mostly secreted by activated maternal lymphocytes, which exerts an immunomodulatory function and contributes to the maintenance of pregnancy in women [11]. Lymph nodes are located all over the body in mammals, and the sites where the immune reaction or suppression takes place. Immune reactions include immune response to pathogenic antigens, harmless antigens and tolerance [12]. It has been demonstrated that pregnancy exerts remarkable effect on the female immune system through an endocrine style [13], and the weights of lumbar and renal lymph nodes, inguinal lymph nodes increase during pregnancy in mice [14]. The large pyronionphilic cell is related to the cell-mediated immunological reactions in regional lymphoid tissue. The large pyronionphilic cell that counts from iliac lymph nodes rises significantly in early pregnant rat, falls in late pregnancy, returns to virgin levels after delivery [15], which suggests that lymph nodes are implicated in the immunoregulation in early pregnant animals. However, it is unclear that early pregnancy

L. Yang et al. / Theriogenology 93 (2017) 78e83

exerts its effect on the expression of PGR and PIBF in inguinal lymph nodes during early pregnancy in sheep. At present study, the inguinal lymph nodes from non-pregnant and early pregnant ewes were sampled to study the expression of PGR and PIBF, which may be beneficial to understand the effects of early pregnancy on the immunomodulation of the lymph node in sheep. 2. Materials and methods 2.1. Animals and experimental design Small Tail Han ewes approximately 18 months of age were housed at the farm of Handan Boyuan Animal Husbandry Co. Ltd. in China, and all procedures were approved by Hebei University of Engineering Animal Care and Use Committee. The ewes with normal oestrous cycles were observed daily for estrus using vasectomized rams, mated twice with intact rams at 12-h intervals after the detection of sexual receptivity. Twenty-four ewes were randomly divided into four groups (n ¼ 6 for each group), and each group was ensured at least three normal pregnant ewes or normal non-pregnant ewes (n ¼ 3 for each group) [16]. The day of coition was counted as day 0 of pregnancy or non-pregnancy. The ewes assigned to the non-pregnant group were not mated with intact ram. The inguinal lymph nodes were obtained from ewes on days 13, 16 and 25 of pregnancy, day 16 of non-pregnancy at the time of slaughter. Pregnancy was confirmed through observing the present of conceptus in the uterus, and the day 13 of pregnant ewes were identified through detecting the expression of interferonstimulated gene 15 in the endometrium by western blot [17]. The transverse pieces of lymph node (0.3 cm3) were fixed in fresh 4% (w/v) paraformaldehyde in PBS buffer (pH 7.4), and the remaining portions of lymph nodes were frozen in liquid nitrogen for subsequent quantitative Real Time PCR (qRT-PCR) and protein analysis. 2.2. RNA extraction and qRT-PCR assay Samples were crushed into fine powders in liquid nitrogen, and the powders were digested in TRIzol, and the total RNA was extracted according to the manufacturer's instructions (Invitrogen, California, USA). The cDNA was synthesized with the FastQuant RT Kit (Tiangen Biotech Co., Ltd., Beijing), and the SuperReal PreMix Plus Kit (Tiangen Biotech Co., Ltd., Beijing) was employed for qRTPCR. The primer sequences of PGR, PIBF and GAPDH were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. (Table 1). The 2DDCt analysis method was used to calculate the relative expression values for the qRT-PCR assay, with GAPDH as the endogenous control [18]. The relative expression value was set as 1 for the group of day 16 of non-pregnancy. 2.3. Western blot The total proteins of the lymph nodes were extracted by RIPA Lysis Buffer (Biosharp, BL504A). A BCA Protein Assay Kit (Tiangen Biotech Co., Ltd., Beijing) was used to measure the protein

Table 1 The primer sequence for quantitative Real Time PCR. Gene

Primer

Sequence

Product (bp)

PGR

Forward Reverse Forward Reverse Forward Reverse

CAACAGCAAACCTGATACCT CCATCCTAGTCCAAATACCATT CCAGGCAGCTAATTGAACGG GGGCTAGTACCTGCTTCTGG GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA

183

PIBF GAPDH

79

concentration with bovine serum albumin as the standard. Equal amounts of total proteins (10 mg/lane) were separated using 12% SDS-PAGE, and the proteins were transferred to 0.22 mm polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). PGR and PIBF were detected by western blot using the rabbit anti-PGR polyclonal antibody (Santa Cruz Biotechnology, Inc., sc-538, 1:1000) and rabbit anti-PIBF polyclonal antibody (Santa Cruz Biotechnology, Inc., sc-99129, 1:1000). Secondary goat anti-rabbit IgG-HRP (Biosharp, BL003A) was diluted to 1:2000. The Pro-light HRP chemiluminescence detection reagent (Tiangen Biotech Co., Ltd., Beijing) was used to detect the immunoreactive bands. Sample loading was monitored with the GAPDH antibody (Santa Cruz Biotechnology, Inc., sc-20357) at a dilution of 1:1000, and secondary goat anti-mouse IgG-HRP was diluted to 1:2000. The intensity of blots were quantified using Quantity One V452 (Bio-Rad Laboratories), and the relative levels were calculated using the internal control protein (GAPDH). 2.4. Immunohistochemistry analysis The fixed lymph samples were embedded in paraffin, and paraffin-embedded sections were deparaffinized in xylene and rehydrated in ethanol. The rehydrated sections were treated with 3% H2O2 to quench endogenous peroxidase activity, and reduced non-specific binding with 5% normal goat serum in PBS. Immunohistochemical localizations of PGR and PIBF in the lymph tissue were performed using the rabbit anti-PGR polyclonal antibody (1:100) and rabbit anti-PIBF polyclonal antibody (1:100), respectively. For a negative control, non-immune goat serum was used in place of primary antibody. DAB kit (Tiangen Biotech Co., Ltd., Beijing) was used to visualize the antibody binding sites in the tissue sections. Finally, the images were captured using a light microscope (Nikon Eclipse E800, Japan) and a digital camera AxioCam ERc 5s, and the intensity of staining and density of stained cells were analyzed through the images. 2.5. Statistical analyses The data were subjected to least-squares ANOVA using the general linear models procedures of the Statistical Analysis System Package version 9.1 for Windows (SAS Institute, Cary, NC, USA). Experimental sample groups consisted of at least three biological replicates. Groups were considered significantly different at P < 0.05. 3. Results 3.1. Relative expression levels of PGR and PIBF mRNA in lymph nodes The qRT-PCR assay revealed (Fig. 1) that the relative expression level of PGR mRNA was lower in the lymph nodes at day 16 of nonpregnancy than that at early pregnancy (P < 0.05), but there was no significant difference in the expression level of PGR mRNA among the lymph nodes from pregnant ewes (P > 0.05). Furthermore, the relative expression level of PIBF mRNA was almost similar to that of PGR mRNA. The relative expression level of PIBF mRNA was higher in the lymph nodes from early pregnant ewes compared to that from day 16 of non-pregnant ewes (P < 0.05). 3.2. Expression of PGR and PIBF proteins in lymph nodes

189 176

Western blot analysis revealed that the PGR proteins were expressed in the lymph nodes (Fig. 2), and the isoform of PGR with a molecular weight of approximately 60 kDa was expressed

80

L. Yang et al. / Theriogenology 93 (2017) 78e83

Fig. 1. Relative expression values of PGR and PIBF mRNA in non-pregnant and pregnant lymph nodes measured by quantitative real time PCR in ewes. Note: DN16 ¼ Day 16 of nonpregnant lymph node; DP13 ¼ Day 13 of pregnant lymph node; DP16 ¼ Day 16 of pregnant lymph node; DP25 ¼ Day 25 of pregnant lymph node. Significant differences (P < 0.05) are indicated by different letters within different column.

Fig. 2. Expression of PGR and PIBF proteins in non-pregnant and pregnant lymph nodes analyzed by western blot using specific anti-PGR and anti-PIBF antibodies in ewes. Note: DN16 ¼ Day 16 of non-pregnant lymph node; DP13 ¼ Day 13 of pregnant lymph node; DP16 ¼ Day 16 of pregnant lymph node; DP25 ¼ Day 25 of pregnant lymph node. PGR60 ¼ isoform of PGR with molecular weight of 60 kDa; PGR40 ¼ isoform of PGR with molecular weight of 40 kDa; PIBF75 ¼ isoform of PIBF with molecular weight of 75 kDa; PIBF48 ¼ isoform of PIBF with molecular weight of 48 kDa. Significant differences (P < 0.05) are indicated by different superscript letters within same color column.

constantly in the lymph nodes from pregnant and non-pregnant ewes. However, the isoform of PGR with a molecular weight of approximately 40 kDa was expressed in the lymph nodes at days 13, 16 and 25 of pregnancy, and there was no expression of the isoform with a molecular weight of 40 kDa at day 16 of the estrous cycle. It was shown in Fig. 2 that PIBF bioactive form with a molecular weight of 48 kDa was strongly expressed in the lymph nodes at days 13, 16 and 25 of pregnancy, but there was no expression of the PIBF bioactive form in the lymph nodes at day 16 of the estrous cycle. The isoform of PIBF with a molecular weight of 75 kDa was expressed in the lymph nodes from pregnant and non-pregnant ewes, but there was no significant difference between pregnant

and non-pregnant ewes. 3.3. The immunohistochemistry for PGR and PIBF proteins in lymph nodes The immunohistochemistry does not distinguish the different isoforms of PGR and PIBF in the tissue sections of lymph nodes, because the antibodies recognized the different isoforms of PGR and PIBF that existed in the tissue sections, so there was no significant difference in staining for PGR and PIBF in the lymph nodes from the estrous cycle and pregnancy. The immunohistochemistry for PGR and PIBF proteins were limited to the subcapsular sinus and

L. Yang et al. / Theriogenology 93 (2017) 78e83

trabeculae in the cortex, medullary sinuses, but there was almost no immunostained in the lymphoid nodules and medullary cords. Furthermore, the staining for PGR and PIBF proteins was localized in the cytoplasm of the cells in the subcapsular sinuses, trabeculaes and medullary sinuses (Fig. 3).

4. Discussion As an organ of the lymphatic system, lymph node is distributed all over the body, and is linked by lymphatic vessels. Lymph nodes are major sites of the immune cells, play a key role in the proper functioning of the immune system. Ovine conceptus in the maternal uterus must modify the maternal immune system to avoid the immune destruction to itself during early pregnancy [19]. It is known that P4 exerts an essential effect on the immunomodulation of the maternal uterus and the immune system through an endocrine style. It is reported that pregnancy affects the weights of lumbar and renal lymph nodes, inguinal lymph nodes, and the quantity of large pyronionphilic cell in iliac lymph nodes in mice [14,15]. In this study, it was the first time to report that the expression of PGR and PIBF was up-regulated in the lymph nodes, which indicated that the lymph nodes were involved in the systemic immunoregulation during early pregnancy in sheep. The biological actions of P4 are mediated through binding to PGR. There is a loss expression of PGR mRNA and protein between days 10 and 12 in the endometrial luminal epithelium and between days 12 and 14 to 16 in the glandular epithelium in cyclic ewes, but

81

PGR mRNA levels increase from day 11 to day 17, and decrease from day 17 to day 25 in pregnant ewes [20]. It is reported that the expression of PGR mRNA and protein are varied in the CL in cyclic cows, and suggest that P4 is an autocrine/paracrine regulator, and plays a role in regulating the luteal and endothelial cell function in bovine CL [21]. The levels of PGR mRNA are various in fetal membranes during early pregnancy in sheep [22]. Our previous study showed that there was a changed expression of PGR mRNA in nonpregnant and pregnant peripheral blood mononuclear cells in cattle [23]. The effects of P4 are mediated by functionally different isoforms of PGR, include nuclear PGR-A (81 kDa) and PGR-B (116 kDa) in cattle [24]. P4 bounding to PGR-A and PGR-B have different transcription activation properties [25,26]. It is reported that there is a third human PGR isoform, PGR-C, with a molecular weight of approximately 45e50 kDa, which is primarily restricted to the cytosolic fraction [27]. PGR gene contains additional putative downstream translational start sites which encode proteins of approximately 60e70 kDa and 39 kDa. The 60 kDa PGR variant is found in T47D cells, contains a ligand-binding domain, is lack of a DNA binding domain and restricted to the cytoplasm rather than the nucleus [28]. It is via inducing expression of different isoforms of PGR that P4 exerts its distinct effects with a change in the ratio of PGR-B to PGR-A and/or PGR-C in the various tissues [29e31]. Our qRT-PCR assay revealed (Fig. 1) that the relative expression level of PGR mRNA was lower in the lymph nodes from day 16 of nonpregnant ewes than that from early pregnant ewes, and western

Fig. 3. Immunohistochemical localization of PGR and PIBF proteins in non-pregnant and pregnant lymph nodes. Lymph node is divided into the cortex and the medulla. Lymph enters the convex through the subcapsular sinus (SS) and trabeculae (TR) around the lymphoid nodules (LN), and flows into the medulla through the lymph sinus (LS) around the medullary cord (MC). Note: DN16 ¼ Day 16 of non-pregnant lymph node; DP13 ¼ Day 13 of pregnant lymph node; DP16 ¼ Day 16 of pregnant lymph node; DP25 ¼ Day 25 of pregnant lymph node. Bar ¼ 20 mm.

82

L. Yang et al. / Theriogenology 93 (2017) 78e83

blot assay showed that there was no expression of PGR-A and PGRB in ovine lymph nodes, and no significant difference in expression of PGR-C, a 60 kDa variant of PGR, in ovine lymph nodes (Fig. 2). Furthermore, there was no significant difference in expression of PGR-D, an approximately 40 kDa variant of PGR, in ovine lymph nodes during early pregnancy, with no expression of PGR-D in the lymph nodes at day 16 of non-pregnancy, which was consistent with the expression of PGR mRNA. Therefore, it was suggested that P4 acted principally to regulate the immune function of the lymph node through up-regulated expression of PGR mRNA and PGR-D during early pregnancy in sheep. During pregnancy in women, the P4 receptor-positive T lymphocytes synthesize PIBF in response to P4. PIBF induces a shift of type 1 to type 2 cytokine in peripheral blood mononuclear cells through up-regulated the production of type 2 cytokines in women [32], which is beneficial for the successful pregnancy in cattle [33]. There are disturbed cell cycle regulation and dysregulated trophoblast invasion in pregnant Balb/c mice, which are induced by the low expression of N-terminal exons of PIBF and significantly decreased production of the full-length PIBF protein in the fetuses, placentae, and uterine tissue [34]. It is indicated that PIBF is a mediator of P4 in regulating decidual lymphocytes cytolytic activity at the maternal-foetal interface through down-regulated expression of perforin [35]. The marked rise of PIBF in the serum is not related to an allogeneic stimulus of embryo, which is merely related to the sufficient P4 in women [36]. It is through inhibiting prostaglandin synthesis and peripheral NK cells activity that PIBF controls the myometrial contractility and reduces the deleterious effect of the high natural killer (NK) cells activity during pregnancy [37]. PIBF is expressed in the first trimester and term placental tissues in the human and in the choriocarcinoma cell line JAR [38]. Full-length PIBF (89 kDa) is associated with the nucleus, and functions as a transcription factor. However, shorter form (48 kDa) of PIBF is the bioactive form, is induced by the activation of the cell, and acts as a cytokine [39]. There is a trend for high rates of miscarriage when PIBF is absent in lymphocytes in women [40]. There is significantly lower PIBF concentration in the urine and serum of the patients with threatened abortion than that in the healthy pregnant women, which may be used for the diagnosis and prognosis of the threatened abortion [41]. The lack of PIBF short form in the murine fetuses, placentae, and uterine tissue can lead to the loss of the local immunosuppression during pregnancy in mice [34]. Our results showed that there was a high level of PIBF mRNA and PIBF bioactive form in the lymph nodes from pregnant ewes (Figs. 1 and 2), which may be related with the up-regulation of 40 kDa variant of PGR, and propitious to the formation of pregnant immunosuppression in sheep. Lymph node is surrounded by a fibrous capsule, and fibrous capsule extends inside the lymph node to form the trabeculae, and divided into the cortex and the medulla. Lymph enters the convex through the subcapsular sinus and trabeculae around lymphoid nodules in which the B cells are tightly packed, and flows into the medulla through the lymph sinus around the medullary cord in which the T cells are tightly packed. Lymph nodes are the site where the immune reaction or suppression takes place. Dendritic cells and other immune cells in the lymph present antigens to T cells in the cortex, and the T cells proliferate and differentiate into the effector or helper T cells which migrate into the medulla to assist the B cells to proliferate and differentiate into the effector or plasma cells. All lymphocytes leave the lymph nodes via the efferent lymphatics or the blood system, which are implicated in the systemic immunoregulation [12]. Our immunohistochemistry results showed that the immunostaining for PGR and PIBF proteins were limited to the subcapsular sinus and trabeculae in the cortex, medullary sinuses, and localized in the cytoplasm of the specific cells (Fig. 3). The

lymph fluid contains lymphocytes, and lymph circulates to the lymph node via subcapsular sinus, trabecular sinuses and medullary sinuses. The expression of PGR and PIBF were limited to the subcapsular sinus, trabeculae and medullary sinuses, which suggested that P4 exerted its effects through the lymph circulation. Therefore, we suggested that P4 from the pregnant CL exerted its effect on the specific cells in the lymph nodes, which resulted in the up-regulated expression of PGR-D and PIBF bioactive form, and was involved in the immunoregulation of the lymph nodes through a cytosolic pathway rather than nuclear pathway. In conclusion, the PGR mRNA and 40 kDa isoform, PIBF mRNA and 48 kDa variant were up-regulated in the lymph nodes from pregnant ewes. The immunohistochemistry results confirmed that the PGR and PIBF proteins were limited to the subcapsular sinus and trabeculae in the cortex, medullary sinuses, and were localized in the cytoplasm of specific immune cells. Therefore, we suggested that early pregnancy exerted its effect on the specific immune cells in the lymph nodes through P4, which resulted in the up-regulated expression of PGR mRNA and 40 kDa isoform, PIBF mRNA and 48 kDa variant, and was involved in the immunoregulation of the lymph nodes through a cytosolic pathway in ewes. Competing interests The authors declare no conflict of interest associated with this article. Acknowledgments This work was supported by the Science and Technology R&D Project of Hebei Province, China (16236605D-2), the Natural Science Foundation of Hebei Province, China (C2014402015), and the Science Technology Research Project of Higher Education Institutions of Hebei Province, China (ZD2016069). References [1] Spencer TE, Burghardt RC, Johnson GA, Bazer FW. Conceptus signals for establishment and maintenance of pregnancy. Anim Reprod Sci 2004;82e83: 537e50. [2] Bazer FW, Burghardt RC, Johnson GA, Spencer TE, Wu G. Interferons and progesterone for establishment and maintenance of pregnancy: interactions among novel cell signaling pathways. Reprod Biol 2008;8:179e211. [3] Spencer TE, Hansen TR. Implantation and establishment of pregnancy in ruminants. Adv Anat Embryol Cell Biol 2015;216:105e35. [4] Spencer TE, Bazer FW. Biology of progesterone action during pregnancy recognition and maintenance of pregnancy. Front Biosci 2002;7:d1879e98. [5] Brooks K, Burns G, Spencer TE. Conceptus elongation in ruminants: roles of progesterone, prostaglandin, interferon tau and cortisol. J Anim Sci Biotechnol 2014;5:53. [6] Micks E, Raglan GB, Schulkin J. Bridging progestogens in pregnancy and pregnancy prevention. Endocr Connect 2015;4:R81e92. [7] Satterfield MC, Bazer FW, Spencer TE. Progesterone regulation of preimplantation conceptus growth and galectin 15 (LGALS15) in the ovine uterus. Biol Reprod 2006;75:289e96. [8] Kowalik MK, Slonina D, Rekawiecki R, Kotwica J. Expression of progesterone receptor membrane component (PGRMC) 1 and 2, serpine mRNA binding protein 1 (SERBP1) and nuclear progesterone receptor (PGR) in the bovine endometrium during the estrous cycle and the first trimester of pregnancy. Reprod Biol 2013;13:15e23. [9] Simmen RC, Simmen FA. Progesterone receptors and Sp/Krüppel-like family members in the uterine endometrium. Front Biosci 2002;7:d1556e65. nez-Arellano C, Lo pez-S [10] Gonz alez-Arenas A, Valadez-Cosmes P, Jime anchez M, Camacho-Arroyo I. Progesterone-induced blocking factor is hormonally regulated in human astrocytoma cells, and increases their growth through the IL-4R/JAK1/STAT6 pathway. J Steroid Biochem Mol Biol 2014;144(Pt B): 463e70.  E, Varga P, Szekeres-Bartho  J. Urinary progesterone[11] Polg ar B, Nagy E, Miko induced blocking factor concentration is related to pregnancy outcome. Biol Reprod 2004;71:1699e705. [12] Buettner M, Bode U. Lymph node dissectioneunderstanding the immunological function of lymph nodes. Clin Exp Immunol 2012;169:205e12. [13] Yang L, Zhang LY, Qiao HY, Liu N, Wang YX, Li SJ. Maternal immune regulation

L. Yang et al. / Theriogenology 93 (2017) 78e83

[14] [15] [16]

[17]

[18] [19]

[20]

[21]

[22]

[23]

[24]

[25] [26]

[27]

[28]

by conceptus during early pregnancy in the bovine. Asian J Anim Vet Adv 2014;9:610e20. Hetherington CM, Humber DP. The effect of pregnancy on lymph node weight in the mouse. J Immunogenet 1977;4:271e6. Mosley JG, McLean JM, Gibbs AC. The response of iliac lymph nodes to the fetal allograft. J Anat 1975;119:619e23. Oliveira JF, Henkes LE, Ashley RL, Purcell SH, Smirnova NP, Veeramachaneni DN, et al. Expression of interferon (IFN)-stimulated genes in extrauterine tissues during early pregnancy in sheep is the consequence of endocrine IFN-tau release from the uterine vein. Endocrinology 2008;149: 1252e9. Yang L, Wang XL, Wan PC, Zhang LY, Wu Y, Tang DW, et al. Up-regulation of expression of interferon-stimulated gene 15 in the bovine corpus luteum during early pregnancy. J Dairy Sci 2010;93:1000e11. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. Biotechniques 2005;39:75e85. Zhang L, Xia Y, Tang F, Li SJ, Yang L, Wang B. The regulation of intrauterine immune cytokines and chemokines during early pregnancy in the bovine. Large Anim Rev 2015;21:23e31. Spencer TE, Bazer FW. Temporal and spatial alterations in uterine estrogen receptor and progesterone receptor gene expression during the estrous cycle and early pregnancy in the ewe. Biol Reprod 1995;53:1527e43. Sakumoto R, Vermehren M, Kenngott RA, Okuda K, Sinowatz F. Changes in the levels of progesterone receptor mRNA and protein in the bovine corpus luteum during the estrous cycle. J Reprod Dev 2010;56:219e22. Reynolds LP, Haring JS, Johnson ML, Ashley RL, Redmer DA, Borowicz PP, et al. Placental development during early pregnancy in sheep: estrogen and progesterone receptor messenger RNA expression in pregnancies derived from in vivo-produced and in vitro-produced embryos. Domest Anim Endocrinol 2015;53:60e9. Yang L, Yao X, Li S, Chen K, Wang Y, Chen L, et al. Expression of genes associated with luteolysis in peripheral blood mononuclear cells during early pregnancy in cattle. Mol Reprod Dev 2016;83:509e15. Slonina D, Kowalik MK, Kotwica J. Expression of progesterone receptor membrane component 1, serpine mRNA binding protein 1 and nuclear progesterone receptor isoforms A and B in the bovine myometrium during the estrous cycle and early pregnancy. J Reprod Dev 2012;58:288e94. Lonard DM, O'Malley BW. Nuclear receptor coregulators: modulators of pathology and therapeutic targets. Nat Rev Endocrinol 2012;8:598e604. Giangrande PH, Kimbrel EA, Edwards DP, McDonnell DP. The opposing transcriptional activities of the two isoforms of the human progesterone receptor are due to differential cofactor binding. Mol Cell Biol 2000;20:3102e15. Wei LL, Gonzalez-Aller C, Wood WM, Miller LA, Horwitz KB. 5'-Heterogeneity in human progesterone receptor transcripts predicts a new amino-terminal truncated “C”-receptor and unique A-receptor messages. Mol Endocrinol 1990;4:1833e40. Condon JC, Hardy DB, Kovaric K, Mendelson CR. Up-regulation of the

[29]

[30]

[31] [32]

[33]

[34]

[35]

[36]

[37] [38]

[39]

[40]

[41]

83

progesterone receptor (PR)-C isoform in laboring myometrium by activation of nuclear factor-kappaB may contribute to the onset of labor through inhibition of PR function. Mol Endocrinol 2006;20:764e75. Pieber D, Allport VC, Hills F, Johnson M, Bennett PR. Interactions between progesterone receptor isoforms in myometrial cells in human labour. Mol Hum Reprod 2001;7:875e9. Merlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM, et al. Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. J Clin Endocrinol Metab 2007;92:1927e33. Zakar T, Mesiano S. How does progesterone relax the uterus in pregnancy? N Engl J Med 2011;364:972e3. Raghupathy R, Al-Mutawa E, Al-Azemi M, Makhseed M, Azizieh F, SzekeresBartho J. Progesterone-induced blocking factor (PIBF) modulates cytokine production by lymphocytes from women with recurrent miscarriage or preterm delivery. J Reprod Immunol 2009;80:91e9. Yang L, Wang Y, Ma X, Wang S, Zhang L. Changes in expression of Th1 and Th2 cytokines in bovine peripheral blood mononuclear cells during early pregnancy. Indian J Anim Res 2016;50:466e70. Bogdan A, Polgar B, Szekeres-Bartho J. Progesterone induced blocking factor isoforms in normal and failed murine pregnancies. Am J Reprod Immunol 2014;71:131e6. Laskarin G, Tokmadzi c VS, Strbo N, Bogovi c T, Szekeres-Bartho J, Randi c L, et al. Progesterone induced blocking factor (PIBF) mediates progesterone induced suppression of decidual lymphocyte cytotoxicity. Am J Reprod Immunol 2002;48:201e9. Cohen RA, Check JH, Dougherty MP. Evidence that exposure to progesterone alone is a sufficient stimulus to cause a precipitous rise in the immunomodulatory protein the progesterone induced blocking factor (PIBF). J Assist Reprod Genet 2016;33:221e9. Szekeres-Bartho J, Polgar B. PIBF: the double edged sword. Pregnancy and tumor. Am J Reprod Immunol 2010;64:77e86. r B, Hartmann M, Wintersteiger R, Blaschitz A, Anderle C, Hammer A, Polga et al. Human trophoblast cells express the immunomodulator progesteroneinduced blocking factor. J Reprod Immunol 2008;79:26e36. Polgar B, Kispal G, Lachmann M, Paar C, Nagy E, Csere P, et al. Molecular cloning and immunologic characterization of a novel cDNA coding for progesterone-induced blocking factor. J Immunol 2003;171:5956e63. Check JH, Levin E, Bollendorf A, Locuniak J. Miscarriage in the first trimester according to the presence or absence of the progesterone-induced blocking factor at three to five weeks from conception in progesterone supplemented women. Clin Exp Obstet Gynecol 2005;32:131e4. Hudi c I, Fatusi c Z. Progesterone - induced blocking factor (PIBF) and Th(1)/ Th(2) cytokine in women with threatened spontaneous abortion. J Perinat Med 2009;37:338e42.