Effect of ferulic acid from Hibiscus mutabilis on filarial parasite Setaria cervi: Molecular and biochemical approaches

Parasitology International 61 (2012) 520–531

Contents lists available at SciVerse ScienceDirect

Parasitology International journal homepage: www.elsevier.com/locate/parint

Effect of ferulic acid from Hibiscus mutabilis on filarial parasite Setaria cervi: Molecular and biochemical approaches Prasanta Saini a, Prajna Gayen a, Ananya Nayak a, Deepak Kumar b, Niladri Mukherjee a, Bikas C. Pal b, Santi P. Sinha Babu a,⁎ a b

Parasitology Laboratory, Department of Zoology, School of Life Sciences, Visva-Bharati University, Santiniketan-731235, West Bengal, India National Institute of Pharmaceutical Education and Research (NIPER), 4, Raja S.C. Mullick Road, Jadavpur, Kolkata-700032, West Bengal, India

a r t i c l e

i n f o

Article history: Received 8 January 2012 Received in revised form 13 April 2012 Accepted 19 April 2012 Available online 26 April 2012 Keywords: Apoptosis Ferulic acid Hibiscus mutabilis Lymphatic filariasis Reactive oxygen species Setaria cervi

a b s t r a c t In the reported work the in vitro activity of a methanolic extract of leaves of Hibiscus mutabilis (Malvaceae) against bovine Setaria cervi worms has been investigated. Bioassay-guided fractionation led to isolation of ferulic acid from ethyl acetate fraction. The crude extract and ferulic acid, the active molecule, showed significant microfilaricidal as well as macrofilaricidal activities against the microfilaria (L1) and adult of S. cervi by both a worm motility and MTT reduction assay. The findings thus provide a new lead for development of a filaricidal drug from natural products. To examine the possible mechanism of action of ferulic acid, the involvement of apoptosis in adult worms of S. cervi was investigated. We found extreme cellular disturbances in ferulic acid-treated adult worms characterized by chromatin condensation, in situ DNA fragmentation and nucleosomal DNA laddering. In this work we are reporting for the first time that ferulic acid exerts its antifilarial effect through induction of apoptosis and by downregulating and altering the level of some key antioxidants (GSH, GST and SOD) of the filarial nematode S. cervi. Our results have provided experimental evidence supporting that ferulic acid causes an increased proapoptotic gene expression and decreased expression of anti-apoptotic genes simultaneously with an elevated level of ROS and gradual dose dependent decline of parasitic GSH level. We also observed a gradual dose dependent elevation of GST and SOD activity in the ferulic acid treated worms. © 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Lymphatic filariasis is a major cause of clinical morbidity and is an impediment to socio-economic development [1]. It is a vector-borne disease caused by three lymphatic dwelling nematode parasites — Wuchereria bancrofti, Brugia malayi and Brugia timori. An estimated 120 million people in 81 tropical countries are infected and is classified as the second most common cause of long-term disability after mental illness [2]. The global program to interrupt transmission is through mass drug administration in human population. The first line choice of drugs are diethylcarbamazine (DEC), ivermectin and albendazole. These drugs are only microfilaricidal and the adult worms show longevity hence the treatment programs may have to be sustained for a long period. Moreover, these drugs are associated with systemic and inflammatory adverse reactions. Threat of resistance to existing drugs is looming large as the evidence is already revealed in various veterinary diseases. Thus present day requirement for filarial chemotherapy is a cheap, non-toxic and novel antifilarial drug with long term antimicrofilarial or macrofilaricidal activity. The

⁎ Corresponding author. Tel.: + 91 3463 261268; fax: + 91 3463 261176. E-mail address: [email protected] (S.P. Sinha Babu). 1383-5769/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.parint.2012.04.002

majority of drugs active against infectious agents are derived from natural products or from structures suggested by natural products. So our efforts have been made to screen medicinal plants for antifilarial activities. Setaria cervi is a filarial nematode parasite inhabiting in the peritoneal cavity of cattle and show cosmopolitan distribution. The bovine filarial parasite S. cervi, which resembles the human bancroftian parasite in its nocturnal periodicity and antigenic patterns [3], was used as a model organism for drug development research. The easy availability of the adult worms makes them more convenient for preliminary screening of antifilarials and molecular studies. Several natural products had earlier proved themselves against many species of filarial infections like Andrographis paniculata, Zingiber officinale, Streblus asper, Carapa procera, Polyalthia suaveolens and Pachypodanthium staudtii [4]. We have observed filaricidal properties of two triterpenoid saponins acaciaside A and acaciaside B isolated from the funicles of Acacia auriculiformis. The saponins when tested on S. cervi transplanted in rats were found effective against both microfilaria and adult worm [5]. An ethanolic extract obtained from the funicles of the plant, which contains saponins, when administered orally to pariah dogs naturally infected with Dirofilaria immitis proved effective against both microfilaria and adult worm [6]. Hibiscus belongs to the order Malvales of the family Malvaceae. It is locally

P. Saini et al. / Parasitology International 61 (2012) 520–531

referred as “confederate rose”, and in folklore, this plant has been used to treat swellings and skin infections [7]. Hibiscus mutabilis, a native of China, is widely cultivated as an ornamental shrub in Peninsular India. The plant is reported to contain flavones, flavone glycosides, anthocyanins and lectins in different parts. The reported bioactivities of the plant extract and isolated constituents of the genus Hibiscus include antibacterial [8] and antiparasitic [9] activities. Our preliminary observations reveal that the leaves of H. mutabilis possess strong antifilarial activity. This has prompted us to evaluate antifilarial activity in the crude extract and the active principle obtained from the leaves of H. mutabilis using adult and microfilaria (mf) of S. cervi. Here we are reporting for the first time that the crude extract and the active principle isolated from the leaves of H. mutabilis show strong antifilarial effect on adults and mf of S. cervi. In this paper we have gathered several molecular evidences that suggest the macrofilaricidal activity by the active principle is mediated through induction of apoptosis by ROS (reactive oxygen species).

521

methanol 80:20 (200 mL, Fraction 4.7), chloroform:methanol 75:25 (200 mL, Fraction 4.8) and chloroform:methanol 70:30 (200 mL, Fraction 4.9) using the aforementioned chromatographic technique (Fig. 1). Among these fractions, Fraction 4.4 (635 mg) showed maximum inhibition of the parasite. The active fraction was further purified with HPLC (XTerra™ Prep RP C18, 7.8 × 300 mm, 10 μm, methanol: water:acetic acid-34:65:1 v/v/v, 2.5 mL/min, 254 nm). The major peak was collected from this fraction and evaporated under reduced pressure to yield an amorphous solid, which was characterized as ferulic acid by comparison of their spectroscopic data with those of reported [10,11]. 2.4. Sample preparation The crude extract and the active principle obtained from the leaves of H. mutabilis, and the standard drug ivermectin were dissolved in DMSO to make a stock solution and diluted in RPMI-1640 to obtain the desired concentrations.

2. Materials and methods 2.5. Collection of parasites 2.1. Plant materials Plant leaves were collected from the coastal region of South 24Parganas district of West Bengal, Kolkata, India and authenticated by a botanist from Botanical Gardens, Howrah, India. A voucher specimen has been deposited at the herbarium of the National Institute of Pharmaceutical Education and Research, Kolkata for future studies (NIP-K/BCP/002). 2.2. Chemicals and reagents HPLC grade methanol, acetic acid, other chemicals and solvents of highest purity grade were purchased from Merck India. Milli-Q water (Milli-Q Academic with 0.22 μm Millipak R-40) was used for the assays and HPLC analysis. FBS (Foetal Bovine Serum), HEPES buffer, streptomycin, penicillin, amphotericin-B and Hoechst 33258 were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). RPMI-1640, MTT (3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl-tetrazolium bromide), NBT (nitroblue tetrazolium) and reagents required for GST, GSH assay were obtained from Hi-Media Laboratories, Mumbai, India. SOD assay kit was procured from Cayman Chemical, Ann Arbor, USA. Primary antibodies (Ced-3, Ced-9) and horseradish peroxidase (HRP) conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). 2.3. Preparation of herbal extracts The air-dried leaves (2 kg) were ground to a coarse powder using mechanical grinder and extracted with methanol. The whole extract was filtered and evaporated under reduced pressure at 40–45 °C using a rotary evaporator and lyophilized to yield crude methanolic extract (142.48 g). The methanolic extract was suspended in water and fractionated successively with ethyl acetate and n-butanol. All the three fractions were evaporated under reduced pressure and lyophilized. A part (5 g) of the ethyl acetate fraction was chromatographed over a bed of silica gel (50 g, 100–200 mesh, Merck India) with increasing polarity of solvents in the order of petroleum ether (500 mL, Fraction 1), petroleum ether:chloroform 1:1 (500 mL, Fraction 2), chloroform (500 mL, Fraction 3), chloroform: methanol 90:10 (500 mL, Fraction 4) and chloroform:methanol 80:20 (500 mL, Fraction 5). The most active fraction, Fraction 4 (1.796 g), was eluted subsequently with petroleum ether:chloroform 1:1 (200 mL, Fraction 4.1), petroleum ether: chloroform 1:3 (200 mL, Fraction 4.2), chloroform (200 mL, Fraction 4.3), chloroform: methanol 95:5 (200 mL, Fraction 4.4), chloroform:methanol 90:10 (200 mL, Fraction 4.5), chloroform:methanol 85:15 (200 mL, Fraction 4.6), chloroform:

Adult worms and microfilariae of S. cervi, the bovine filarial parasite, were used as the model organism for screening the antifilarial activity of the crude extract and the active principle. Adult worms were collected from the peritoneal cavity of freshly slaughtered cattle at local abattoirs, washed several times with Kreb's Ringer Bicarbonate buffer (Sigma), and kept in Ringer's solution at 37 °C. Mf (L1), early and late embryonic stages were obtained by dissecting gravid females, then the suspension passed through a 5.0 μm filter membrane (Millipore) and finally the pelleted mf was kept in Ringer's solution at 37 °C for 1 h. All the specific stages studied were identified under a binocular microscope (Dewinter, Victory, Italy). 2.6. In vitro screening of the crude extract and the active principle for antifilarial activity Adult worms of S. cervi (1 male and 1 female) were incubated in 5 mL of complete media, CM (RPMI-1640 supplemented with 25 mM HEPES buffer, 2 mM glutamine, 100 U/mL streptomycin, 100 μg/mL penicillin, 0.25 μg/mL of amphotericin B and 10% foetal bovine serum), alone and in combination with the crude extract at 50, 100 and 500 μg/mL and the active principle at 25, 50, 100, 200 and 400 μg/mL in a 24-well flat-bottomed culture plate (Tarson, India). Mf (n = 0.11 × 10 3) obtained from gravid adult females, were incubated in 200 μL of CM alone and in CM with the crude extract at 50, 100 and 500 μg/mL and the active compound at 25, 50, 100, 200 and 400 μg/mL, in a 96-well flat-bottomed microtiter plate (Tarson, India). Cultures were maintained for 48 h at 37 °C in a humidified atmosphere of 5% CO2 [12]. The cultures for adult worms were carried out in duplicate and for mf in quadruplicate and repeated at least three times. Ivermectin (25 and 400 μg/mL) was used as a standard filaricide for in vitro screen. 2.7. Assessment of parasite viability by MTT assay The crude extract and the pure compound of H. mutabilis, assessed from the motility assay, were further screened for MTT reduction assay, following the method of Comley et al. [13] with slight modifications. After a brief microscopic assessment of parasite viability, mf (n = 0.14 × 10 5) were suspended in 0.1 mL of PBS containing 0.5 mg of MTT mL − 1 and then incubated for 2 h at 37 °C at dark. The dark crystals of formazan thus formed then solubilized using 100 μL of DMSO in a 96-well microtiter plate. Adult worms were incubated in 0.5 mL of PBS containing 0.5 mg of MTT and formazan crystals were solubilized in 200 μL of DMSO. The absorbance intensity of each sample was read with an automatic microtiter reader (Beckman, USA).

522

P. Saini et al. / Parasitology International 61 (2012) 520–531

Fig. 1. Flow chart of isolation of ferulic acid (FA) from the leaves of H. mutabilis. Structure of FA is provided in the lower panel.

The cultures for adult worms were carried out in duplicate and for mf in quadruplicate and repeated at least three times. Twelve adult worms were used for each treatment group and control.

fluorescence microscope (BX 41, Japan), using an excitation wave length of 495 nm. 2.11. In situ TUNEL assay

2.8. Parasite preparation for histology After 48 h, the pure compound-treated adult worms were fixed in 4% paraformaldehyde at 4 °C overnight, embedded in paraffin and cut into 3-μm thick sections. 2.9. PI staining of developmental stages of S. cervi Briefly, developmental stages (early and late embryonic) were incubated at selective concentrations (50 and 400 μg/mL) of the active compound for 24 h. The samples were permeabilized with a mixture of acetone:methanol (1:1) at − 20 °C for 10 min according to the method of Sarker et al. [14], with slight modifications. Following incubation, the samples were rinsed carefully with Hanks Balanced Salt Solution (HBSS), stained with 100 μL of propidium iodide (50 μg/mL) solution and incubated for 15–30 min at dark. Morphological changes were analyzed by visualizing control and treated samples using an inverted fluorescence microscope with green filter (Dewinter, Victory, Italy). 2.10. Hoechst 33258 staining To study nuclear morphology, the treated and control sections were stained with 8 μg/mL bisbenzimide (Hoechst 33258) as mentioned previously [15]. The stained sections were visualized under

To detect apoptotic cells, in situ end labeling of the 3′OH end of the DNA fragments generated by apoptosis-associated endonucleases was performed using a TUNEL kit (DeadEnd™ Colorimetric TUNEL System, Promega, USA). Briefly, the paraffin sections were first stuck to a polyL-lysine (Sigma, USA) coated slide, dewaxed with xylene, and rehydrated through a series of graded ethanol. Following digestion with proteinase K (20 μg/mL) for 15 min at room temperature, the sections were equilibrated in buffer and labeled by biotinylated nucleotide mix in presence of recombinant deoxynucleotidyl transferase (rTdT) for 60 min in a humidified chamber. After termination of the reaction, the labeled fragments were incubated with streptavidin horseradish peroxidase and visualized after diaminobenzidine color development in which a dark brown staining indicated apoptosis. A light microscope (Dewinter, Victory, Italy) was used for observations and photographs. 2.12. DNA fragmentation detection After 24 h of incubation, the treated and untreated adult worms were digested in 500 μL of lysis buffer containing Tris–HCl 20 mM, pH 8.0, EDTA 50 mM, SDS 0.5%, NaCl 100 mM, β-mercaptoethanol 1%, v/v, proteinase K (0.1 mg/mL) and incubated in a water bath at 37 °C for 2 h. RNA contamination was removed by adding RNase (Fermentas, USA) and being incubated at 56 °C for 2 h. After phenol-chloroform-

P. Saini et al. / Parasitology International 61 (2012) 520–531

isoamyl alcohol extraction, the mixture was centrifuged and the upper aqueous layer was carefully transferred to a fresh tube. DNA were precipitated by adding two volumes of ethanol, 1/10 volume of 3 M sodium acetate, and 1/100 volume of 1 M sodium acetate and being incubated at −20 °C overnight. DNA pellet was washed with 70% ethanol and dissolved in TE buffer. The purified DNA samples from control and treated worms were analyzed by electrophoresis on a 2% agarose gel (1.5 h at 80 V/30 mA) and after staining with ethidium bromide, visualized under gel documentation system (Bio-Rad, USA). 2.13. Expression study of apoptotic genes by Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Total RNA was isolated using TRI Reagent (Sigma, USA) according to the manufacturer's protocol and residual DNA contamination was removed by DNaseI (Fermentas, USA) treatment. ß-Tubulin served as a control. Briefly, 5 μg of total RNA was reverse-transcribed into single stranded cDNA with Moloney murine leukemia virus-reverse transcriptase and oligo (dT) primer (Fermentas, USA). The upstream and downstream primer sets used for each gene of interest (ced-3, ced-4 and ced-9) were provided in Table 1. The following conditions were used for the PCR reaction: 1× PCR buffer, 10 mM dNTPs, 1 μmol of each primer, 4 mM MgCl2, and 1 unit of Taq DNA polymerase (Fermentas, USA) in a total volume of 50 μL. cDNA was denatured at 95 °C for 3 min, annealed (according to the primer sets melting temperature) for 1 min, and elongated at 72 °C for 1 min for 35 cycles. PCR products were separated on a 1.5% agarose gel, stained with ethidium bromide and photographed under gel documentation system (Bio-Rad, USA). An RNase-free environment was maintained during RNA isolation and amplification reaction. 2.14. Preparation of extract from control and treated worms After incubation, the control and treated adult worms were rinsed extensively with PBS (pH 7.2) and were lysed by sonication in buffer containing 50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, 1 mM EGTA, 1 mM PMSF, 1 μg/mL leupeptin, and aprotinin. The resultant extract was then centrifuged, first at 5000 g and finally at 15,000 g for 30 min. The clear supernatant thus obtained was used for Western blotting and enzyme assays. 2.15. Western blot analysis The protein (60 μg) was normalized by Bradford Reagent (Bangalore Genei, India), resolved by 8% to 12% SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, USA). The membrane was blocked at room temperature with 10% (w/v) nonfat dry milk in Tris buffered saline (TBS) containing 0.3% (v/v) Tween (TBS-T). Then the membrane was washed thrice with TBS-T and incubated overnight at 4 °C with the primary antibody (Santa Cruz, USA), goat polyclonal anti-Ced-3 (1:500, v/v), anti-Ced-9 (1:500, v/v). After washing, the membranes were incubated with the HRP (horseradish peroxidase) conjugated secondary antibody (donkey anti-goat IgG-HRP) with a 1:2000 (v/v) dilution. Following incubation, the membrane was washed and the antigen–antibody complexes were detected in presence of the

523

specific substrate 3,3′,5,5′-tetramethylbenzidine (TMB)/H2O2 (Bangalore GeNei, India). 2.16. Estimation of glutathione level To estimate GSH level, an equal volume of 5% perchloric acid was added to the enzyme extract (100 μL) and centrifuged at 805 g for 10 min at 4 °C. 1.88 mL of 0.1 mol/L potassium phosphate buffer (pH 8.0) and 0.02 mL 4% DTNB [5,5′-dithiobis(2-nitrobenzoate)] were added to the supernatant. Incubation of the reaction mixture was carried out at room temperature for 3 min, and color absorbance was recorded at 412 nm [16]. 2.17. Estimation of GST activity GST activity in fresh worm extract was assessed spectrophotometrically according to the method of Habig et al. [17], with slight modifications, using GSH (2.4 mM/L) and CDNB (1-chloro-2,4-ditnitrobenzene) (1 mM/L) as substrates. For each assay, 1 mL of assay cocktail (980 μL of PBS, pH 6.5, 100 mM CDNB and 100 mM GSH) was prepared. Assay was initiated by adding 100 μL of enzyme extract in 900 μL of assay cocktail. PBS (pH 6.5) was used as a negative control. The mixture was incubated at 30 °C for 5 min and absorbance was measured at 340 nm at regular interval of 30 s for 3 min. The protein content in the extract was determined by Bradford Reagent (Bangalore GeNei, India) using bovine serum albumin as standard protein. 2.18. SOD assay After 24 h of incubation, at selective concentrations (50, 100, 200 and 400 μg/mL) of the active molecule, the control and treated adult worms were washed several times with PBS (pH 7.2) and were homogenized in 20 mM HEPES buffer (pH 7.2), containing 1 mM EGTA, 210 mM mannitol and 70 mM sucrose. Following centrifugation at 10,000 g for 15 min, the supernatant was collected for enzyme assay. SOD activity of worm homogenate was measured by the formation of superoxide radicals by xanthine oxidase using Superoxide Dismutase Assay Kit (Cayman Chemical, USA). The absorbance intensity was measured at 495 nm using the linear regression equation from the standard curve provided by the manufacturer. One unit of SOD is defined as the amount of enzyme needed to exhibit 50% dismutation of the superoxide radical. The total protein concentration in collected supernatant (both control and treated) was determined colorimetrically using Bradford method [18]. 2.19. ROS measurement In order to confirm that the pure compound stimulates ROS production, our study utilized colorimetric NBT assay, one of the most frequently used assays for superoxide detection. The method relies on the superoxide anion mediated conversion of NBT into blue formazan crystals. The assay was performed in treated and untreated worms by following the method as described by Choi et al. [19], with slight modifications. Briefly, the worms were incubated with 2% NBT solution for 1 h at room temperature. After incubation, worms were washed twice with PBS followed by single wash with methanol. Then, the worms were dissolved by adding 360 μL of KOH (2 M)

Table 1 The synthetic primers used for RT-PCR. Genes

Sense primer (5′–3′)

Anti‐sense primer (5′‐3′)

Annealing temperature in °C

Amplicon size (bp)

ced-3 ced-4 ced-9 β-Tubulin

TCAGCAGCTCAACAACATCC CGAAAGAGCTTGTGATGCAA GTTACTCCAGCGCCAATCAT TGCGCACGATGGTCGCACAC

GCAAGTTCAGCAAGTGTGGA CAATTTTCCCGACAAATGCT CAAGTGCGAAACCTCTTCGT GCAGGCGATCACTGGCGGAA

47 49 47 55

176 198 200 183

524

P. Saini et al. / Parasitology International 61 (2012) 520–531

and 420 μL of DMSO with gentle shaking for 10 min at room temperature. The absorbance was read on a microplate reader (Beckman Coulter, USA) at 620 nm.

of incubation (Fig. 3A). Maximum reduction (97.2%) was recorded after 48 h of incubation with pure molecule at 400 μg/mL. In the positive control (ivermectin), values are in agreement with previous report [20].

2.20. Statistical analysis All experiments were repeated at least three times and all data were compiled from a minimum of triplicate experiments. Data used for statistical analysis were expressed as the mean ± S.E. The results from treated and untreated control cells were analyzed by Student's t-test using MS Excel software and a P-value of b0.05 was considered as statistically significant. For MTT assay, we have entered 12 observations in excel worksheet and have obtained the error bar. 3. Results 3.1. Effect of the crude extract and the active principle on Mf viability The effects of the crude extract and the active principle on mf viability (MTT assay) were represented graphically (Fig. 2A). A diminished mf motility (results not shown) was consistent with the reduction of mf viability. After incubation with ethyl acetate extract and Fraction 4 at 500 μg/mL for 48 h, the viability of mf was significantly decreased to 78.7% and 85.3% (P b 0.05), respectively. At 50 μg/mL, the active principle reduced mf viability by 50% after 48 h

3.2. Effect of the crude extract and the active principle on adult worm viability The effects of the crude extract and the active principle on viability (MTT assay) of adult worms were also studied (Fig. 2B). The gradual reduction in worm viability with increasing drug concentrations was very compatible with gradual decrease in worm motility (results not shown). Viability of the treated worms was significantly decreased (P b 0.05) to 38.3% and 52.4% after 48 h of incubation with ethyl acetate extract and Fraction 4 at 100 μg/mL, respectively, and at higher dose i.e. 500 μg/mL the reduction reached up to 69.7% and 81.9%. At 50 μg/mL, the active principle reduced adult worm viability by 51.6% after 48 h of incubation (Fig. 3B). Maximum reduction (90%) was recorded after 48 h of incubation with pure molecule at 400 μg/mL. Thus, the crude extract and pure molecule produced strong microfilaricidal as well as macrofilaricidal effects on S. cervi in a dose- and time-dependent manner. However, normal untreated mf and adult worms did not show any MTT reduction. In the

Fig. 2. Effect of the crude extract/fraction of H. mutabilis on S. cervi viability. Mf: A, adult worms: B. Parasites were incubated with the crude extract/fraction for 24 and 48 h and viability was measured by the MTT reduction assay. Results were analyzed as percent reduction in formazan production by treated parasites, values were contrasted with untreated parasites and expressed as percent reduction in viability. AqX, nBF and EAX correspond to aqueous, n-butanol and ethyl acetate extract, respectively; whereas Fr 1, Fr 2, Fr 3, Fr 4 and Fr 5 are for the EAX fractions (1 to 5, respectively). Data were shown in triplicate. The bar indicates significant difference which was expressed as mean ± S.E. of three independent experiments (P b 0.05) relative to the untreated control parasites.

P. Saini et al. / Parasitology International 61 (2012) 520–531

525

filarial worm S. cervi and the active principle responsible for this has been identified as ferulic acid (FA). For a clear understanding of the compounds present in Fraction 4, an HPLC chromatogram has been provided (Fig. 4). The chromatogram reveals that it contains two major peaks, which were subsequently isolated and indentified as caffeic acid (retention time 15.4 min) and ferulic acid (retention time 35.2 min), and were evaluated for their antifilarial activity. At 400 μg/mL, caffeic acid reduced mf and adult viability by 59.6% and 57.1% after 48 h of incubation, respectively (data not shown). Thus, ferulic acid was found to be much more effective than caffeic acid, hence the study was performed with ferulic acid. Increased activity in Fraction 4 as compared with ethyl acetate extract may be due to the combined effect of ferulic acid and caffeic acid; this effect might be additive or synergistic. 3.3. PI staining Staining with propidium iodide, an impressive marker of apoptosis, shows degradation in the nuclear DNA. Fig. 5B and C clearly illustrates the fragmented nuclear morphology in the treated oocytes of S. cervi gravid females; no such fragmentation was observed in control oocytes (Fig. 5A). 3.4. Hoechst staining

Fig. 3. Effect of FA on parasite viability. A. Mf, and B. Adult female worms were exposed to the indicated concentrations of FA for 24 and 48 h. Viability was measured by the MTT method, and percent inhibition in parasite viability was calculated. Results were analyzed as percent reduction in formazan production compared with control worms and expressed as percent reduction in viability. Ivermectin (25 and 400 µg/mL) was used as a standard filaricide. Data were shown in triplicate (mean ± S.E.) and P b 0.05.

positive control (ivermectin), values are in agreement with previous report [20]. The in vitro screening was carried out using adults and mf of S. cervi with the crude extract as well as the fractions. The worm motility assay and MTT reduction assay have confirmed the micro- and macrofilaricidal potential of the leaves of H. mutabilis and the fraction obtained after chromatographic purification. Out of five fractions, Fraction 4 was found to contain the active principle. Others fractions were inactive. Thus, the methanolic extract of H. mutabilis has shown promising microfilaricidal and macrofilaricidal activity against bovine

Hoechst staining revealed condensed chromatin (Fig. 5E), a morphological feature of apoptosis, in the treated oocytes of gravid S. cervi female, following incubation at different concentrations of FA for 24 h, which did not occur in cell nuclei of untreated worms (Fig. 5D). 3.5. TUNEL staining The results of TUNEL assay clearly reveal presence of in situ DNA fragmentation in the nuclei of FA-treated tissue (Fig. 6B). Clusters of numerous dark brown apoptotic nuclei were found in the cells of developing embryos within uterus as observed in the TUNEL stained transverse sections of 24 h FA-treated adult worms. Cells from the control sections (Fig. 6A), showed less or few number of apoptotic nuclei. 3.6. DNA fragmentation detection The profile of genomic DNA in 2% agarose gel electrophoresis from 24 h FA-treated adult worms showed a typical dose-dependent

Fig. 4. HPLC chromatogram obtained for Fraction 4 using the isocratic mobile phase 1% acetic acid in methanol:water (30:70 v/v) at a flow rate of 1 mL/min and eluate monitoring at 254 nm. Arrows indicate peaks for ferulic acid (retention time 35.2 min) and caffeic acid (retention time 15.4 min).

526

P. Saini et al. / Parasitology International 61 (2012) 520–531

Fig. 5. (1st panel) Apoptotic features in developmental stages of S. cervi treated with FA for 24 h were investigated by PI staining. Control (A), FA at 50 μg/mL (B) and FA at 400 μg/mL (C). (2nd panel) For confirmation of apoptosis in FA-treated adult females, Hoechst staining was done. The chromatin condensation in developing stages of FA-treated sections of parasites was clearly observed (E), both of which were not found in cell nuclei of untreated parasites (D). Experiments were done in duplicate and photographs were taken at 400× magnification, scale bar = 100 μm.

nucleosomal DNA laddering (Fig. 7A). Interestingly, with this assay, no significant laddering was detected in the control lane. 3.7. RT- PCR The mRNA level expression of nematode specific anti-apoptotic (ced-9) and pro-apoptotic (ced-3 and ced-4) genes (Fig. 7B), were analyzed by RT-PCR. At transcriptional level, remarkable differences were evident in the expression of these apoptotic genes between control and treated worms. The treatment with FA resulted in an increased expression of ced-3 and ced-4, and significantly decreased in the expression of ced-9 in a dose-dependent manner. However, the

control worms showed the opposite results i.e. increased expression of ced-9 and reduced expression of ced-3 and ced-4. All primers (apoptosis genes and the housekeeping gene) were designed and were confirmed with the help of National Center for Biotechnology Information database (http://blast.ncbi.nlm.nih.gov/) and Primer3 Software Input (version 0.4.0). The expression of the target genes compared with ß-tubulin gene was shown in Fig. 7B. 3.8. Western blot To determine whether FA can induce cell death through downregulation of Ced-9 and up-regulation of Ced-3 in the treated adult

Fig. 6. TUNEL stained light micrographs of S. cervi adult worms. The TUNEL assay showed lack of apoptotic death in cells of the control sections (A), compared to FA‐treated (400 μg/mL) sections containing a very high number of dark brown nuclei (B). Scale bars have been incorporated using Dewinter Biowizard 4.2 (Scale bar = 100 μm).

P. Saini et al. / Parasitology International 61 (2012) 520–531

527

Fig. 7. (A) Genomic DNA was isolated from control and treated (25, 50, 100, 200 and 400 μg/mL) adult worms and was separated by agarose 2% gel electrophoresis. A DNA fragmentation was clearly observed from the genomic DNA of treated parasites. The lane M denoted molecular weight marker (100 bp). (B) FA treatment enhances downregulation of ced-9 and elevates expression of ced-3 and ced-4. RT-PCR analysis of ced-3, ced-4 and ced-9 before (Control) and after treatment with FA (50, 100, 200 μg/mL ). βTubulin was used as an loading control. (C) Effect of FA on protein expressions of ced-9 and ced-3. Western blot analysis was carried out to determine the expression level of anti-apoptotic (ced-9) and pro-apoptotic (ced-3) proteins in untreated (control) and treated (50, 100 and 200 μg/mL) worm using specific antibodies. β-Tubulin was used as protein loading control.

worm, we studied the protein expression by Western blotting. We observed a FA-dependent Ced-9 down-regulation in adult worms treated with a dose of 50 μg which appeared further decreased by the use of higher dose (200 μg). The results also show that FA treatment resulted in significant up-regulation of the level of Ced-3, a caspase-3 homologue and one of the key pro-apoptotic members of the nematode apoptotic pathway (Fig. 7C), both these changes were not found in case of the control worms.

3.9. Biochemical findings In the initial phase of apoptosis, the cells extrude glutathione (GSH, a cysteine-containing tripeptide) in the reduced form, which plays a key role in cell death. In our study, the data clearly reveal that FA reduces glutathione level in a dose-dependent manner. The results presented in Fig. 8A, illustrate a significant decrease (20.9%, P b 0.05) in GSH level in adult worm treated with FA at 50 μg for 24 h, compared to control. The higher concentrations of FA (200 and 400 μg/mL) showed a significant gradual lowering in GSH level (39.6% and 41.7%). Glutathione S-transferases are a family of enzymes with a crucial role in the detoxification of various xenobiotics, primarily by catalysing GSH-dependent conjugation and redox reactions. Here the enzyme activity was assessed in adult worm exposed to FA at different concentrations for 24 h. An elevated level of GST was observed (Fig. 8B). The upregulation of GST was evident with increasing concentrations of the test compound; upon exposure to FA at 200 and 400 μg/mL the GST activity was increased by more than 100% in both cases. Fig. 8C showed a linear increase in SOD activity with increasing concentrations of FA in comparison to control worm. At 50 μg, SOD generation was enhanced moderately but increased substantially with the gradual increase of drug concentration. At the highest concentration i.e., 400 μg/mL, the SOD activity was increased by 72.5%

in comparison to control worm. FA is inducing a redox stress. Parasite is responding by increasing the endogenous antioxidant system. Changes in intracellular ROS levels were evaluated, after 24 h of worms exposure to the indicated concentrations of FA, by measuring the oxidative conversion of NBT to chromogenic formazan crystals (Fig. 8D). We found a statistically significant increment in the worm ROS level upon treatment with FA. ROS production was found to be maximal after 24-h treatment with FA, but diminished toward normal level of untreated worms after 24-h treatment (data not shown). 400 μg/mL of FA was sufficient to elevate the ROS accumulation up to a significantly higher level leading to an increase of 19.4% over the untreated worms. ROS production by FA treated worms increased in a dose dependent manner. 4. Discussion Recent treatment regimens for bancroftian filariasis have limitations, as the currently used antifilarial drugs are mainly antimicrofilarial, with little effect on the adult worms and thus new drugs are urgently required. In this respect, natural products have made and continue to make valuable contributions [21,22] to this area of drug development [23]. Based on results obtained from in vitro experiments, bioassay-guided fractionation was carried-out in order to elucidate antifilarial activity in the active fraction and pure compound. The ferulic acid, of the EAX, was found to possess significant microfilaricidal and macrofilaricidal activity in vitro. Ferulic acid is a known compound, however till date, no report is available on its antifilarial activity. The findings thus provide a new lead for development of antifilarial drug from natural products. To examine the possible mechanism of action of FA, the involvement of apoptosis in adult worms of S. cervi was investigated. Here we are reporting for the first time that FA induces apoptosis through the production of ROS in S. cervi, and thus acts as a very good antifilarial agent. These molecular findings may provide important information for FA, which could, therefore, be considered as novel antifilarial drug.

528

P. Saini et al. / Parasitology International 61 (2012) 520–531

Fig. 8. GSH (A) (nmol/mg protein) level, GST(B) (U/mg protein) activity, SOD (C)activity (U/mg protein), and superoxide anion (D) production in adult S. cervi worms treated with FA (50, 100, 200 and 400 μg/mL) for 24 h and untreated adult worms were determined, respectively. The data in the figures are representative of three different experiments (expressed as mean ± S.E.), P b 0.05 was considered significant.

In recent years, naturally occurring antioxidant compounds commonly found in human diet have gained considerable attention as cancer chemopreventive agents. FA, a major constituent of fruits, some vegetables and sweet corn, is a potent antioxidant with multiple pharmacological activity [24]. The antimicrobial activity of Hibiscus sabdariffa on Escherichia coli O157:H7 isolates from food, veterinary, and clinical samples was studied [8]; plant extract at lowest concentration (2.5%) and highest concentration (10%) produced inhibition; 7.00 ± 0.04 mm being the lowest and 15.37 ± 0.61 mm the highest, respectively. In an in vitro experiment, the antifilarial activity of crude extract of the leaves of H. sabdariffa was tested against human filarial parasite, B. malayi. The n-butanol fraction at 250 μg/mL killed 100% mf. In B. malayi-jird model, the leaf extract at 500 mg/kg (administered for 5 days) produced macrofilaricidal (about 30%) activity in vivo [9]. For comparison, the ethyl acetate extract of H. mutabilis at 500 μg/mL reduced mf and adult worm viability of S. cervi by 78.7% and 69.7%, respectively. At 50 μg/mL, FA reduced mf and adult worm viability by 49.5% and 51.6%, respectively. Tasdemir et al. [25] have studied the antileishmanial activity of cinnamic acid and its derivatives and ferulic acid on Leishmania donovani in vitro. Cinnamic acid did not show any appreciable antileishmanial activity (Ic50, >30 μg/mL), however its derivatives like 3-methoxycinnamic acid ( Ic50, 9.2 μg/mL) and 4-methoxycinnamic acid (Ic50, 9.6 μg/mL) displayed moderate activity. Noteworthy was the finding that ferulic acid exhibited more potency (Ic50, 5.6 μg/mL) than cinnamic acid and its derivatives. Cinnamic acid at 741 mg/L and 1000 mg/L has shown to have antimicrobial properties against both E. coli and Salmonella sp., respectively. The minimum reported concentration at which cinnamic acid has shown inhibitory effects against E. coli is

388 mg/L [26]. FA is a ubiquitous plant constituent that arises from the metabolism of phenylalanine and tyrosine. It possesses three distinctive structural motifs that can possibly contribute to the free radical scavenging capability of this compound. The presence of electron donating groups on the benzene ring (3 methoxy and especially 4hydroxyl) of FA gives the additional property of terminating free radical chain reactions. The next functionality the carboxylic acid group in FA with an adjacent unsaturated C-C double bond can provide additional attack sites for free radicals and thus prevent them from attacking the membrane. In addition, this carboxylic acid group also acts as an anchor of FA, by which it binds to the lipid bilayer, providing some protection against lipid peroxidation. Certainly, the presence of electron donating substituents enhances the antioxidant properties of FA [27]. Dietary components with antioxidant activity have been receiving particular attention as potential inhibitors in several cancers [28]. Phytochemicals can interfere with intracellular signaling pathways, such as that, which regulate proliferation, induction of apoptosis and response to oxidative stress [29]. Studies have shown that FA exhibits anticarcinogenic effects against azoxymethane-induced colon carcinogenesis in F344 rats [30]. It has also been reported to depress 12-O-tetradecanoylphorbol-13-acetate (TPA)-promotion of skin tumorigenesis as well as to inhibit pulmonary cancers in mice [31]. Stich et al. [32] have reported that there was a significant decrease in urinary N-nitrosoproline levels in humans on treatment with FA. The mechanism suggests that inhibition of nitrosation and endogenous formation of carcinogenic nitrosamines. Cells undergoing apoptosis express phosphatidyl serine on their surface, which aids in their recognition and phagocytosis by macrophages, thereby limiting inflammation [33]. Externalization of phosphatidyl serine by H2O2

P. Saini et al. / Parasitology International 61 (2012) 520–531

indicates pre-apoptotic stage of the peripheral blood mononuclear cells (PBMCS). The inhibition of externalization of phosphatidyl serine by FA indicates anti-apoptotic activities of FA in human PBMCS. Khanduja et al. [34] have reported that phenolic compound like FA significantly exhibits anti-apoptotic activity in normal PBMCS exposed to H2O2 induced oxidative stress. It is also described as a specific inhibitor of the anti-apoptotic proteins Bcl-XL and Bcl2, thereby inducing apoptosis [35]. There are several reports on FA mediated apoptosis in different cancer cell lines, but this is the first report supporting an apoptotic effect of FA in a filarial worm. Genetic analysis performed in the nematode Caenorhabditis elegans have contributed to the identification of pro- and anti-apoptotic genes required for programmed cell death during its development [36]. The gene ced-9 is an antiapoptotic member that encodes a protein structurally and functionally similar to the mammalian cell death inhibitor Bcl-2 which belongs to the family of Bcl-2 like molecules that act as regulators of cell death in mammals [37]. The gene ced-3 is one of the proapoptotic key players of programmed cell death in C. elegans, encodes a protein resembling mammalian interleukin-1β converting enzyme which is a cysteine protease regulating programmed cell death in worms [37]. The mammalian counterpart of the ced-4 is Apaf-1, which is responsible for the activation of caspase-3 for programmed cell death, is also a proapoptotic gene that acts upstream of ced-3 [38]. In order to understand the role of these three genes in FA mediated apoptosis, we have studied the RT-PCR and Western blotting techniques and delve into their expression pattern in the treated parasite. Our results support that FA causes elevation in the expression level of ced-3 and ced-4 and downregulates the expression of nematode ced-9 level. It is therefore possible that true functional homologs of ced-9, ced-4 and ced-3 exist in S. cervi and they play a key role in FA induced apoptosis. PCD (programmed cell death) involves the activation of catabolic enzymes specially protease- in signalling cascades, which leads to the rapid demolition of cellular structures and organelles [39]. Some of the morphological hallmarks of apoptosis are nuclear condensation, membrane convolution, blebbing, nucleosomal fragmentation and apoptotic body formation which are usually absent in normal cells [40]. The data obtained in the MTT assay showed that FA causes significant reduction in worm viability both in mf and adults. FA showed increased effect at higher concentrations, and effects increased over time. The evidence presented above by Hoechst staining and TUNEL assay suggest that FA causes chromatin condensation and in situ DNA fragmentation in developing embryos in

529

gravid female. One of the hallmarks of apoptosis is degradation of nucleosomal DNA by endogenous endonuclease activation or caspase-activated DNase [41]. The results of DNA fragmentation assay provide evidence that FA promotes DNA fragmentation in the adult worms. Various chemotherapeutic agents have profound effects on the cellular redox status [42] and alteration of redox status plays an important role in the induction of apoptosis [43]. GSH, which, has been suggested as an attractive chemotherapeutic target against the filarial nematodes; either GSH alone or in combination with enzymes like glutathione peroxidase (GPx), glutathione-S-transferase (GST), and glutathione reductase (GR), protect the filarial worms from oxidative damage [44–47]. Therefore, the inhibition of enzymes involved in GSH synthesis and metabolism thus deprives the parasite of its major defense against oxidative stress and makes them unable to survive. GSH, GST and SOD are some of the paramount antioxidant parameters in filarial nematodes and are involved in removing the oxidative stress and thus potentiating their survival in the host [48–50]. In this present work we are reporting for the first time that FA exerts its antifilarial effect through induction of apoptosis and by downregulating and altering the level of some key antioxidants of the filarial nematode S. cervi. Our results have provided experimental evidence supporting that FA causes an increased proapoptotic gene expression and decreased expression of anti-apoptotic genes simultaneously with an elevated level of ROS and gradual dose dependent decline of parasitic GSH level which were insignificant or could not be detected in control worms. FA, a naturally occurring phenolic acid has been reported to have free radical producing properties [51]. Prooxidant activity by hydroxycinnamic acids in different experimental models has been previously reported [52]. ROS production is enhanced by effect of FA, and changes of biochemical parameters of parasites are registered, a decreased level of GSH and increased activity of antioxidant enzymes. Antioxidant system is unbalanced and apoptosis is induced. We are suggesting that the enhanced activity of these two antioxidant enzymes is due to increased ROS generation. There are reports which deal with targeting some of these antioxidant components (e.g. GST) of filarial nematodes for the development and designing of anti-filarial drugs [53,54]. ROS in excess are harmful to cells which cause oxidative modification of cellular macromolecules, alter normal protein function and promote cell death. Thus apoptosis can be a consequence of elevated ROS level in the cells which may be induced by a wide range of chemicals or natural compounds [55]. A schematic model showing the key effects of FA on adult S. cervi is shown in Fig. 9.

Fig. 9. Schematic representation of the mechanism by which FA (isolated from the leaves of H. mutabilis) induces apoptosis in S. cervi. FA causes elevation in the expression of ced-3 and ced-4 and downregulates the expression of ced-9. An elevated level of ROS, GST, SOD and gradual dose dependent decline of parasitic GSH level were induced by FA treatment.

530

P. Saini et al. / Parasitology International 61 (2012) 520–531

5. Conclusions In this paper we have gathered several molecular evidences that suggest the macrofilaricidal activity by FA is mediated through induction of apoptosis by ROS. To sum up, down-regulation of ced-9 and up-regulation of ced-3 induced by FA treatment contribute to apoptosis in adult worms of S. cervi. Obviously, to describe the mechanism underlying the induction of apoptosis in S. cervi, it is clearly not sufficient to pick up two proteins that are somehow involved in apoptosis and show changes in expression by Western blotting. Further analysis of upstream causes and downstream pathways is currently under investigation in filarial parasites affecting human(s). This would help us developing FA as a new antifilarial drug for the next generation filariasis control strategies. Conflicts of interest The authors have nothing to disclose. Acknowledgments We thank the Department of Biotechnology, Ministry of Science and Technology, Govt. of India, New Delhi for supporting this work by a grant (Grant No. BT/PR8779/Med/14/1282/2007). The authors, Ananya Nayak and Prajna Gayen were supported by a fellowship from the Council of Scientific and Industrial Research (CSIR), India. We are indebted to Dr. Amrit Sen, Associate Professor, Department of English and Other Modern European Languages, Visva-Bharati for performing a critical review of the manuscript. References [1] Evans DB, Gelband H, Vlassoff C. Social and economic factors and the control of lymphatic filariasis: a review. Acta Tropica 1993;53:1–26. [2] WHO. Global programme to eliminate lymphatic filariasis progress report on mass drug administration in 2009. Weekly Epidemiological Record 2010;85:365–72. [3] Kaushal NA, Kaushal DC, Ghatak S. Identification of antigenic proteins of Setaria cervi by immunoblotting technique. Immunological Investigations 1987;16: 139–49. [4] Misra S, Verma M, Mishra SK, Srivastava S, Lakshmi V, Misra-Bhattacharya S. Gedunin and photogedunin of Xylocarpus granatum possess antifilarial activity against human lymphatic filarial parasite Brugia malayi in experimental rodent host. Parasitology Research 2011;109:1351–60. [5] Ghosh M, Sinha Babu SP, Sukul NC, Mahato SB. Antifilarial effect of two triterpenoid saponins isolated from Acacia auriculiformis. Indian Journal of Experimental Biology 1993;31:604–6. [6] Chakraborty T, Sinha Babu SP, Sukul NC. Antifilarial effects of a plant Acacia auriculiformis on canine dirofilariasis. Tropical Medicine 1995;37:31–44. [7] Dasuki UA. Hibiscus. In: van Valkenburg JLCH, Bunyapraphatsara N, editors. Plant resources of South-East Asia no. 12(2): medicinal and poisonous plants 2. Leiden, Netherlands: Backhuys Publisher; 2001. p. 297–303. [8] Fullerton M, Khatiwada J, Johnson JU, Davis S, Williams LL. Determination of antimicrobial activity of sorrel (Hibiscus sabdariffa) on Escherichia coli O157:H7 isolated from food, veterinary, and clinical samples. Journal of Medicinal Food 2011;14: 950–6. [9] Saxena K, Dube V, Kushwaha V, Gupta V, Lakshmi M, Mishra S, et al. Antifilarial efficacy of Hibiscus sabdariffa on lymphatic filarial parasite Brugia malayi. Medicinal Chemistry Research 2010;20:1594–602. [10] Tan J, Bednarek P, Liu J, Schneider B, Svatos A, Hahlbrock K. Universally occurring phenylpropanoid and species specific indolic metabolites in infected and uninfected Arabidopsis thaliana roots and leaves. Phytochemistry 2004;65:691–9. [11] Lee HS, Beon MS, Kim MK. Selective growth inhibitor toward human intestinal bacteria derived from Pulsatilla cernua root. Journal of Agricultural and Food Chemistry 2001;49:4656–61. [12] Rao R, Weil GJ. In vitro effects of antibiotics on Brugia malayi worm survival and reproduction. Journal of Parasitology 2002;88:605–11. [13] Comley JCW, Rees MJ, Turner CH, Jenkins DC. Colorimetric quantitation of filarial viability. International Journal of Parasitology 1989;19:77–83. [14] Sarker KP, Obara S, Nakata M, Kitajima I, Maruyama I. Anandamide induces apoptosis of PC-12 cells: involvement of superoxide and caspase-3. FEBS Letters 2000;472:39–44. [15] Nayak A, Gayen P, Saini P, Maitra S, Sinha Babu SP. Albendazole induces apoptosis in adults and microfilariae of Setaria cervi. Experimental Parasitology 2011;128: 236–42. [16] Singh A, Rathaur S. Combination of DEC plus aspirin induced mitochondrial mediated apoptosis in filarial parasite Setaria cervi. Biochimie 2010;92:894–900.

[17] Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases: the first enzymatic step in mercapturic acid formation. Journal of Biological Chemistry 1974;249:7130–9. [18] Bradford M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 1976;72:248–54. [19] Choi HS, Kim JW, Cha YN, Kim C. A quantitative nitroblue tetrazolium assay for determining intracellular superoxide anion production in phagocytic cells. Journal of Immunoassay & Immunochemistry 2006;27:31–44. [20] Ottesen EA, Duke BOL, Karan M, Bebehani K. Strategies and tools for control/elimination of lymphatic filariasis. Bulletin of the World Health Organization 1997;75:491–503. [21] Lakshmi V, Joseph SK, Srivastava S, Verma SK, Sahoo MK, Dube V, et al. Antifilarial activity in vitro and in vivo of some flavonoids tested against Brugia malayi. Acta Tropica 2010;116:127–33. [22] Gupta J, Misra S, Mishra SK, Srivastava S, Srivastava MN, Lakshmi V, et al. Antifilarial activity of marine sponge Haliclona oculata against experimental Brugia malayi infection. Experimental Parasitology 2012;130:449–55. [23] Sashidhara KV, Singh SP, Misra S, Gupta J, Misra-Bhattacharya S. Galactolipids from Bauhinia racemosa as a new class of antifilarial agents against human lymphatic filarial parasite, Brugia malayi. European Journal of Medicinal Chemistry 2012;50:230–5. [24] Srinivasan M, Sudheer AR, Menon VP. Ferulic acid: therapeutic potential through its antioxidant property. Journal of Clinical Biochemistry and Nutrition 2007;40: 92–100. [25] Tasdemir D, Kaiser M, Brun R, Yardley V, Schmidt TJ, Tosun F, et al. Antitrypanosomal and antileishmanial activities of flavonoids and their analogues: in vitro, in vivo, structure–activity relationship, and quantitative structure-activity relationship studies. Antimicrobial Agents and Chemotherapy 2006;5:1352–64. [26] Narasimhan B, Belsare D, Pharande D, Mourya V, Dhake A. Esters, amides and substituted derivatives of cinnamic acid: synthesis, antimicrobial activity and QSAR investigations. European Journal of Medicinal Chemistry 2004;39:827–34. [27] Kanaski J, Aksenova M, Stoyanova A, Butter field DA. Ferulic acid antioxidant protection against hydroxyl and peroxyl radical oxidation in synaptosomal and neuronal cell culture systems in vitro: structure activity studies. The Journal of Nutritional Biochemistry 2002;13:273–81. [28] Dedoussis GVZ, Kaliora AC, Andrikopoulos NK. Effect of phenols on natural killer (NK) cell mediated death in the K562 human leukemic cell line. Cell Biology International 2005;29:884–9. [29] Loo G. Redox-sensitive mechanisms of phytochemical mediated inhibition of cancer cell proliferation. The Journal of Nutritional Biochemistry 2003;14:64–73. [30] Kawabata K, Yamamoto T, Hara A, Shimizu M, Yamada Y, Matsunga K, et al. Modifying effect of ferulic acid on azoxymethane induced colon carcinogenesis in F344 rats. Cancer Letters 2000;157:15–21. [31] Asanoma M, Takahashi K, Miyabe M, Yamamoto K, Yoshimi N, Mori H, et al. Inhibitory effect of tropical application of polymerized ferulic acid, a synthetic lignin, on tumor promotion in mouse skin two stage tumorigenesis. Carcinogenesis 1993;14:1321–5. [32] Stich HF, Ohshima H, Pignatelli B, Michelon J, Bartisch H. Inhibitory effect of betel nut extracts on endogenous nitrosation in human. Journal of the National Cancer Institute 1983;70:1047–50. [33] Martin SJ, Reutelingsperger CP, McGahon AJ, Radar JA, Van Schie RC, La Face DM, et al. Early redistribution of plasma membrane phosphatidyl serine is a general feature of apoptosis regardless of initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. The Journal of Experimental Medicine 1995;182:1545–56. [34] Khanduja KL, Avti PK, Kumar S, Mittal N, Sohi KK, Pathak CM. Anti-apoptotic activity of caffeic acid, ellagic acid and ferulic acid in normal human peripheral blood mononuclear cells: a Bcl-2 independent mechanism. Biochimica et Biophysica Acta 2006;1760:283–9. [35] Jayaprakasam BL, Vanisree M, Zhang Y, Dewitt DL, Nair MG. Impact of alkyl esters of caffeic and FAs on tumor cell proliferation, cyclooxygenase enzyme, and lipid peroxidation. Journal of Agricultural and Food Chemistry 2006;54:5375–81. [36] Conradt B. Genetic control of programmed cell death during animal development. Annual Review of Genetics 2009;43:493–523. [37] Yuan J, Horvitz HR. A first insight into the molecular mechanisms of apoptosis. Cell 2004;116:53–6. [38] Conradt B, Horvitz HR. The C. elegans protein EGL-1 is required for programmed cell death and interacts with the Bcl-2-like protein CED-9. Cell 1998;93:519–29. [39] Danial NN, Korsmeyer SJ. Cell death: critical control points. Cell 2004;116:205–19. [40] Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide ranging implications in tissue kinetics. British Journal of Cancer 1972;26: 239–57. [41] Wyllie A. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 1980;284:555–6. [42] Alemany M, Levin J. The effects of arsenic trioxide (As2O3) on human megakaryocytic leukemia cell lines, with a comparison of its effects on other cell lineages. Leukemia & Lymphoma 2000;38:153–63. [43] Green DR, Reed JC. Mitochondria and apoptosis. Science 1998;281:1309–12. [44] Carlberg I, Mannervik B. Glutathione reductase. Methods in Enzymology 1985;13: 484–90. [45] Schirmer RH, Schollhammer T, Elsenbrand G, Krauth Siegel RL. Oxidative stress as a defense mechanism against parasitic infections. Free Radical Research Communications 1987;3:3–12. [46] Zhang LP, Maiorino M, Roveri A, Ursini F. Phospholipid hydroperoxide glutathione peroxidase: specific activity in tissues of rats of different age and comparison with other glutathione peroxidases. Biochemistry and Biophysics Acta 1989;1006: 140–3.

P. Saini et al. / Parasitology International 61 (2012) 520–531 [47] Lomaestro BM, Malone M. Glutathione in health and disease: pharmacotherapeutic issues. The Annals of Pharmacotherapy 1995;29:1263–73. [48] Chiumiento L, Bruschi F. Enzymatic antioxidant systems in helminth parasites. Parasitology Research 2009;105:593–603. [49] Henkle-Duhrsen K, Kampkotter A. Antioxidant enzyme families in parasitic nematodes. Molecular and Biochemical Parasitology 2001;114:129–42. [50] Selkirk ME, Smith VP, Thomas GR, Gounaris K. Resistance of filarial nematode parasites to oxidative stress. International Journal of Parasitology 1998;28: 1315–32. [51] Karthikeyan S, Kanimozhi G, Prasad NR, Mahalakshmi R. Radiosensitizing effect of ferulic acid on human cervical carcinoma cells in vitro. Toxicology In Vitro 2011;25:1366–75.

531

[52] Zheng LF, Dai F, Zhou B. Prooxidant activity of hydroxy cinnamic acids on DNA damage in the presence of Cu(II) ions: mechanism and structure activity relationship. Food and Chemical Toxicology 2008;46:149–56. [53] Yadav VR, Prasad S, Kannappan R, Ravindran J, Chaturvedi MM, Vaahtera L, et al. Cyclodextrin-complexed curcumin exhibits anti-inflammatory and antiproliferative activities superior to those of curcumin through higher cellular uptake. Biochemical Pharmacology 2010;80:1021–32. [54] Rao UR, Salinas G, Mehta K, Klei TR. Identification and localization of glutathione S-transferase as a potential target enzyme in Brugia species. Parasitology Research 2000;86:908–15. [55] Circu ML, Aw TY. Reactive oxygen species, cellular redox systems and apoptosis. Free Radical Biology & Medicine 2010;48:749–62.