Effect of freezing on the metabolic status of L3 larvae of Anisakis simplex s. s.

Infection, Genetics and Evolution 82 (2020) 104312

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Research paper

Effect of freezing on the metabolic status of L3 larvae of Anisakis simplex s. s. a,⁎

Elżbieta Łopieńska-Biernat , Robert Stryiński , Iwona Polak , Bogusław Pawlikowski , Joanna Pawlakb, Magdalena Podolskab a b

a

a

T

b

Department of Biochemistry, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, Oczapowskiego 1A, 10-719 Olsztyn, Poland Department of Fisheries Resources, National Marine Fisheries Research Institute, Kołłątaja 1, 81-332 Gdynia, Poland

A R T I C LE I N FO

A B S T R A C T

Keywords: Anisakis Food-borne disease Freezing HPLC Real-time PCR Metabolism

The fish-borne parasite, Anisakis simplex s. s., triggers a disease called anisakiasis, that is associated with a gastrointestinal infection. The Anisakis is also associated with allergic response which may lead to anaphylactic shock. The A. simplex s. s. L3 larvae may be freeze tolerant despite when the nematodes will be cooled rapidly to −20 °C according to the sanitary authorities of the USA and the EU. The aim of this work was to study the metabolic status of A. simplex s. s. L3 larvae when frozen in terms of viability, expression of genes involved in the nematodes' survival of freezing, as well content of carbohydrates which play a cryoprotective role in thermal stress and are the main source of energy. The levels of trehalose were significantly higher after slow freezing treatment (p < .0001), than the fast freezing (p < .002). The lower temperatures induce changes, especially in trehalose synthesis gene expression, genes responsible for oxidative metabolism, and chaperone proteins, but we cannot state clearly whether these changes occur during freezing, or because they are already prevalent during cold acclimation. The induction of mentioned genes seems to be a common trait of both cold- and dehydration tolerance.

1. Introduction Human fishery product-borne parasitic diseases primarily include those caused by cestodes, trematodes and nematodes (Chai et al., 2005). The only parasite in fishery products that is implicated in allergic reaction, except an infection following ingestion of viable parasites, is cosmopolitan nematode Anisakis simplex. The hypersensitivity episodes can not only be elicited by infection but also by exposure to allergens remaining in food with no live larvae (Audicana and Kennedy, 2008; KruseFæste et al., 2014; Carrera et al., 2016; Sánchez-Alonso et al., 2018). Anisakiasis is associated with gastrointestinal infection which may lead to epigastralgia, nausea, abdominal pain and diarrhea (Shimamura et al., 2016; Lalchandani et al., 2018). The Anisakis-associated allergic response is mainly characterized by production of specific IgE, tissue eosinophilia, angioedema, utricaria and may lead to life threatening anaphylactic shock (Audicana et al., 2002; Nieuwenhuizen and Lopata, 2014; Nieuwenhuizen, 2016; Mattiucci et al., 2018). Over 20,000 cases of anisakiasis had been reported worldwide prior to 2010 (EFSA-BIOHAZ, 2010). Recent research has revealed that the total number of worldwide anisakidosis (almost all anisakiasis) cases up to December 2017 may be over 76,000. According to the quantitative

⁎

risk assessment model (QRA), the prevalence of anisakiasis in Spain, as in the whole of Europe increase from 500 to 7700–8320 cases per year (Bao et al., 2017, 2019). This might be due in a part to improper application of the regulation by the consumers or small business operators since Anisakis L3 are moderately freezing-tolerant (Wharton and Aalders, 2002). According to the sanitary authorities of the USA and the EU, fish products should be cooked at 60 °C for 10 min or longer to prevent infection. Fish products that are not intended for cooking or processing at temperatures higher than 60 °C the freezing treatment must consist of lowering the temperature in all parts of the product to at least −20 °C for not less than 24 h, or to −35 °C for not less than 15 h. Decapitation and evisceration of freshly caught fish and storage at low temperature until consumption are recommended (Audicana et al., 2002; Wharton and Aalders, 2002; Garcia et al., 2001; Nieuwenhuizen and Lopata, 2014). The regulations issued by the US and EU sanitary authorities can be found online at http://www.fda.gov/ and http:// europa.eu.int/eur-lex/en/index.html. The survival of Anisakis invasive larvae after freezing is usually measured in terms of their viability. It is assumed that any larvae which move spontaneously or in response to stimulation with tweezers is able to infect human (European Food Safety Authority, EFSA, 2010). But non-viable larvae may be infective, the pathogenicity of the larvae

Corresponding author. E-mail address: [email protected] (E. Łopieńska-Biernat).

https://doi.org/10.1016/j.meegid.2020.104312 Received 30 December 2019; Received in revised form 24 March 2020; Accepted 31 March 2020 Available online 02 April 2020 1567-1348/ © 2020 Published by Elsevier B.V.

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

specific primers to identify each of the following parasite species, as well as PCR reaction mixture containing primers specific for whole Anisakidae family. To determine the species of the parasite, with isolated DNA, 7 PCR reactions were performed in parallel (with each of the specific mixtures). The results of the study are observed in real time. The study also allows detection of hybrid individuals. Spreadsheet provided by the manufacturer after filling with Ct values obtained during real-time PCR shows which of the species DNA was in the tested sample.

might be preserved after freezing and may explain why some patients develop symptoms after ingestion of infested frozen fish (RodríguezMahillo et al., 2007; Sánchez-Alonso et al., 2019). It was observed that experimentally frozen A. simplex s. s. larvae remained colorless after staining with malachite green despite being motionless. The majority of these were intact and without apparent damage to the body structure, and therefore clearly these individuals were viable (Podolska et al., 2019). A. simplex allergens are highly resistant to heat and freezing (Falcao et al., 2008; Carrera et al., 2016) therefore treatments which kill Anisakis in fishery products may not protect the consumers against allergic hazards due to the ingestion. Gene expression levels of immunogenic proteins such as A.peg-1 and A.peg-13 of Anisakis pegreffii larvae indicated that temperature conditions do regulate the gene expression (Palomba et al., 2019). Also, in many organisms, including A. simplex, presence of genes playing a role in the process of cryoprotective dehydration during the freezing was noted. Among them are those involved in the sugar biosynthesis pathways (trehalose), chaperone proteins (such as the heat shock proteins), enzymes involved in antioxidant metabolism, and ice-active proteins (IAP) (Wharton et al., 2005; Łopieńska-Biernat et al., 2007, 2014; Duman, 2015; Thorne et al., 2017). Due that nematode larvae, if non-viable directly after freezing, may survive the whole process, and show mobility after acclimation in above 0 °C temperatures (Thorne et al., 2017). With the assumption that the A. simplex L3 larvae may be freeze tolerant we have tested the expression of genes important during oxidative and temperature stress: trehalose-6-phosphate synthase (tps), trehalose-6-phosphate phosphatase (tpp), trehalase (tre), heat shock cognate protein 70 (hsc 70), heat shock protein 90 (hsp 90), superoxide dismutase Cu-Zn (sod), glutathione s-transferase (gst), aquaporin-10 (aqp-10), leucine-rich repeat protein (lrr), neprylisin-1 (nep-1) and actin (act) in that parasite, when the nematodes have been cooled rapidly and slowly to −20 °C according to the sanitary authorities of the USA and the EU. The aim of this work was to study metabolic status of A. simplex L3 larvae when frozen in terms of viability, expression of genes involved in the nematodes' survival of freezing, as well content of carbohydrates which play a cryoprotective role in thermal stress and are the main source of energy.

2.2. Freezing experiment The larvae were then placed in 40 Eppendorf tubes containing 1.5 ml of 0.9% NaCl (5–10 individuals per sample/tube) where half of the samples were exposed to low temperatures in the single-compressor freezer set at −20 °C (model LGT-4725, Liebherr, Germany) and second half, in the double-compressor freezer set at −35 °C (model MDF-U443PE, Panasonic, Japan). These two types of freezers have had different rates of temperature change: slow freezing rate and fast freezing rate, respectively. The freezing rate was defined according to the following equation: Freezing rate (FR) [°C/min] = (T2 − T1)/(t2 − t1), where T1 = 0.0 °C and T2 = −5,0 °C, t2 − t1 is the time taken to change from 0.0 °C to −5.0 °C. During the entire freezing process temperature was recorded with 16 thermocouples (TM-9616, ELLAB, Denmark). In each freezer was 1 external (outside the box with parasites) and 7 internal thermocouples (inside the box with parasites) (TC 1–8 or TC 9–16) inserted in the eppendorf tubes with NaCl solution to check the homogeneity of temperature. The freezing process was completed when the temperature inside all Eppendorf tubes reached/were close to −20 °C. After freezing larvae were incubated in a thermoblock (Bio TDB-100, Biosan, Latvia) at 37 °C for 15 min (Fig. 1A; Supplementary File, Table S1).

2.3. Viability Parasites were analyzed twice for viability: immediately after thawing and after incubation in a thermoblock at 37 °C for 15 min. Movement of the larvae was observed according to the EFSA (2010). Those larvae that moved spontaneously or after stimulation with tweezers were considered alive. Finally, the larvae were observed under a microscope (Axio Zoom V16, Carl Zeiss, Germany) to assess the degree of damage after freezing (Fig. 1A). The three-stage scale was adopted: intact active, intact motionless, damaged motionless. Then samples from each freezer were divided into 2 groups. The first group (2 × 10 samples; 50 individuals) was stored separately for RNA extraction and qReal-time PCR analysis and the second group (2 × 5 samples; 50 individuals) was used for extracts preparation for HPLC analysis (Fig. 1A). The Eppendorf's with nematodes were subsequently plunged into liquid nitrogen and stored at −80 °C until analyzes. The control for mentioned treatments were larvae only cold acclimated for 24 h at 4 °C in 0.9% NaCl solution, then plunged into liquid nitrogen and stored at −80 °C.

2. Methods 2.1. Sample collection Live A. simplex s.s L3 larvae were obtained from herring Clupea harengus membras caught in the coastal waters of the southern Baltic Sea (Pomeranian Bay, ICES Subdivision 24) (Fig. 1). Larvae collected from the body cavities of herring were maintained for 24 h at 4 °C in 0.9% NaCl solution for acclimation. All larvae (394) were assessed under stereo microscope as belonging to the A. simplex species type I. 36 of all larvae used in the experiment were subjected to taxonomic identification based on highly specific amplification of the genomic DNA (isolated with use of Xpure ™ Cell & Tissue micro, A&ABiotechnology, Poland) fragment from the ITS1/ITS2 region with use of Anis Sensitive Sniper Real-Time PCR kit according to the manufacturer's protocol (A&ABiotechnology, Poland). The kit is used to identify representatives of nematodes from the Anisakidae family found in the Baltic and North Atlantic (Anisakis simplex s. s., A. pegreffii, Pseudoterranova decipiens, P. krabbei, Contracaecum osculatum and Hysterothylacium aduncum (a species of the Raphidascarididae family)). A new method of identifying nematode species was introduced into routine tests at A&A Biotechnology and National Veterinary Research Institute and reported for proficiency tests organized by the Instituto Superiori di Sanita, European Reference Laboratory for Parasites in Rome, to confirm the laboratory's competence and the possibility of accrediting the method. The kit contains ready-to-use PCR reaction mixtures containing

2.4. Preparation of extracts for a quantitative determination of saccharides by HPLC A. simplex s. s. L3 larvae were rinsed several times in 0.9% NaCl, dried on filter paper and weighed. They were homogenized manually with Omni TH-02 homogenizer (OMNI International, USA) with 0.9% NaCl (1/10 w/v). The larvae were centrifuged at 800 ×g for 15 min at 4 °C. The supernatant was used to determine the content of glucose (G8270 Sigma), glycerol (G6279 Sigma) and trehalose (T5251 Sigma). 2

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

Fig. 1. A) Analytical scheme for the experiment of the effect of freezing rate on the metabolic status of Anisakis simplex s. s. L3 larvae. *-see part B. B) Schematic arrangement of samples and thermocouples in the box. TC - thermocouple.

filtered with nylon Micro-Spin Filter Tubes (Alltech Associates, USA). 40 μl of each specimen was injected into the SCL-10A system (Shimadzu, Japan) with the RID 10A refractive detector (Shimadzu, Japan). A high-performance carbohydrate cartridge column (4.6 × 250 mm; Waters, Holland) was eluted with a mixture of acetonitrile/degassed and deionized water (75/25%, 1 ml × min−1) and kept at 35 °C during analysis. The concentrations of glucose, glycerol and trehalose were

2.5. High-performance liquid chromatography analysis (HPLC) Saccharides content was determined by high-performance liquid chromatography (HPLC) (Fig. 1A). The samples supernatants for HPLC were first boiled for 5 min, diluted with about twice their volume of cold 96% ethanol and centrifuged. The supernatants were desiccated at 50 °C, dissolved in acetonitrile/deionized water solution (3:2, v/v) and 3

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

analyzed using Chromax 2005 software (POL – LAB, Poland). The content of the studied sugars was expressed in mg per 100 mg of wet tissue. Each assay was performed in triplicate.

software (7500 v2.0). All gene-specific and housekeeping primers used for qReal-time PCR analyses were designed in Primer3-web (primer3. ut.ee) and listed in Table 1. Each assay was performed in six plicate.

2.6. RNA extraction and analysis

2.9. Statistical analysis

RNA was obtained with the Total RNA Mini Kit (A&A Biotechnology, Poland) (Fig. 1A). RNA samples were treated with DNase before use according to the manufacturer's protocol (A&A Biotechnology, Poland). The concentrations and quality of the isolated total RNA samples were assayed spectrophotometrically using a NanoDrop 1000 system (Thermo Fisher Scientific, USA) by measuring their absorbance at 230, 260, and 280 nm. Contamination of the samples by protein and polysaccharides/phenolic compounds was measured as the ratio of the A260/A280 and A260/A230 absorbance's, respectively. The integrity of total RNA samples was assayed using electrophoresis on 1.5% agarose gels with 0.01% ethidium bromide.

Data were expressed as means ± standard deviation by two-way ANOVA in the Prism 7 software (GraphPad Software Inc., USA). Differences between means were assessed by Dunnett's multiple comparisons test. P-values below 0.1234 (non-significant) were considered statistically significant, where 0.0332 (*), 0.0021 (**), 0.0002 (***) and < 0.0001 (****). Pearson's correlation analysis was performed to compare viability of larvae with freezing rate and the degree of cuticle damage after freezing with freezing rate. 3. Results and discussion 3.1. The genetic identification of the Anisakis spp. larvae

2.7. Reverse transcription polymerase chain reaction (RT-PCR) The taxonomic identification was based on highly specific amplification of the genomic DNA fragment from the ITS1 / ITS2 region. The analysis of 36 individuals with use of Anis Sensitive Sniper Real-Time PCR kit (A&ABiotechnology, Poland) showed that all the larvae belong to the species A. simplex s. s. (Supplementary File, Table S2).

First-strand cDNA templates were synthesized using 1 μg total RNA, oligo(dT)18 primer, and the MMLV-RT reverse transcriptase (20 U/μl) (TranScriba Kit, A&A Biotechnology, Poland) according to the manufacturer's instructions. To demonstrate that the RNA was suitable for downstream applications, PCR reactions were carried out using the gene-specific primers designed in Primer3-web (primer3.ut.ee) and listed in Table 1.

3.2. Viability of L3 A. simplex s. s. after freezing and effect of freezing rate The ability of Anisakis to survive freezing can be considered a risk factor in households, because not all freezers can reach −20 °C. There is a couple of surveys of domestic freezers that have been done, showing that there is a significant percentage of them in which the minimal temperature recommended by food control authorities cannot be attained (Giannakourou and Taoukis, 2003; McIntyre et al., 2007; Taoukis et al., 2011; Evans et al., 2014; Podolska et al., 2019). In our study Fig. 2 shows a representative time and temperature profiles of fast (Fig. 2 A, B) and slow (Fig. 2C, D) freezing. Freezing rate (FR) during 30 min and 35 min of freezing in a double compressor freezer was 0.9 °C/min and 0.7 °C/min, respectively, when during 1 h 30′ and 2 h of freezing in a single compressor freezer, FR was 0.175 °C/ min, and 0.17 °C/min, respectively. The larvae viability was assessed after freezing followed by thawing and after incubation in a thermoblock (Table S1). Viability after freezing at −20 °C, followed by thawing was 0% in both slow and fast freezing experiment when after 15 min incubation was 1.8% in overall, where still 0% only for FR = 0.7 °C/min. The rest of the larvae did not show any movement at that time. Some larvae were damaged (Fig. 3), so the internal content was protruding from the worm. Pearson's correlation test shows dependence between the viability of larvae with FR (r = −0,53) but did not show any relation between the degree of body damage after

2.8. Quantitative real-time PCR analysis (qReal-time PCR) qReal-time PCR was performed using RT PCR MIX SYBR B (A&A Biotechnology, Poland) according to the manufacturer's protocol (Fig. 1A). A quantity of 10 μl of the reaction solution contained 1 μl of the template (1:10 dilution of cDNA product), 5 μl of RT PCR MIX SYBR B (2×), 0.25 μl (10 μM) of each primer, 3.25 μl of water, and 0.25 μl of ROX Reference dye II. qReal-time PCR was performed in the Applied Biosystems 7500 Fast Real Time PCR System (Life Technologies, USA). The following thermal cycling conditions were applied: 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 1 min at 60 °C, and 30 s at 72 °C. Fluorescence measurements were collected after each extension step. At the end of each program, specificity of the primer sets was confirmed by melting curve analysis. Relative transcript levels at each time point were analyzed based on mean values and standard deviation with the use of the 2–ΔΔCT accounting for differences in primer efficiencies proposed by Pfaffl (2001). The data were presented as the fold change in gene expression normalized to an endogenous reference genes ef1-α and ryb and relative to the untreated control (nematodes directly taken from the fish and stored at 4 °C for 24 h; relative quantification RQ = 1). Transcript levels were determined in Applied Biosystems analytical Table 1 The primer sequences used for PCR and qReal- time PCR assays. Gene

Sense primer

Antysense primer

tps tpp tre sod gst hsp90 hsc70 aqp-10 nep-1 lrr actin ef-1α ryb 18S

GAAGTTACGTCAATCAATATGAGAAGG GTTTTCGCTTGTCTGCTCACG TGCCGTTGAAATATGATCCA AACAAAACGCATGCTGGTCC GCTCAAACCAACCACTCCAT AATAATTTGG GTACGATCGC ACCACCGGTTGAATTGGATA TTCGCGAAAT AATAAGTGAA TGAAATCACCACGTTGGAAA AGCTGTCGATAGTGGGCATC TGGAGTGGTGCTTGACTCAG TCCTCAAGCGTTGTTATCTGTT ACCAGTAACGAAAGCGTGTG

TTCAGGTCCACCCACCCATC TCGTTAGCGGCATTTCCTG ATATGCGATGCAAATGCAAG ACATGCACAACCAACGAACG TTGTCCCCTTCTTGCATACC TCC TTC TCT CGC TCT TTC T TCGTTCTTCGTTCGCTTTTT ACGAACCGAAAGAAGCTCAA TTTGCTCATCCATCCAATCA ATTCGATTCTTCGCCAACAC TCACGAACAATCTCACGCTC AGTTTTGCCACTAGCGGTTCC GCTGTTGGAAGGAAGAACGA

4

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

Fig. 2. Temperature homogeneity profiles of each freezing treatment. High freezing rates A) 0 h 30′, and B) 0 h 35′. Low freezing rates C) 1 h 30′, and D) 2 h. TC thermocouple. To see arrangement of samples and thermocouples in the box during the experiment see Supplementary File, Table S1.

freezing with FR (r = −0,2). The above results show also high variation in damage for a given freezing time recorded during the experiment (Table S1). The largest percent of the damage was noticed for extreme freezing time values, where after 30 min, 13% of larvae were damaged, and after 2 h - 18%. According to our study and literature data fast freezing is preferred in order to safety of fish products in terms of larvae mortality (coldtreated larvae had impaired survival ability) (Adams et al., 2005; Sánchez-Alonso et al., 2018; Podolska et al., 2019). Although, Kono et al. (2017) results showed that the freezing rate markedly affected the surface color of fish fillet resulting in color loss, with a marked difference in behavior of color in the surface layer between fast freezing and normal freezing samples. The color loss phenomenon was found to occur during industrial fast freezing comparing with normal freezing. Also, freezing process may disrupt L3 cuticle, what would imply a higher amount of allergens released to the surrounding, and thus even in the absence of ingestion of viable larvae, parasite allergens might

cause allergic anisakiasis (Tejada et al., 2006; Solas et al., 2008; Solas and García, 2009; Sánchez-Alonso et al., 2018). The moment at which a worm can be defined as dead is not a simple matter; cessation of motility is currently the most commonly used parameter for this but it is not always a robust indicator and better indicators are needed. In this study, nematodes with motility and without cuticle damages were observed under the microscope and compared to nematodes showing no motility. Similar parameters of the viablity of Anisakis larave assessment were used by Giarratana et al. (2014). As the authors (Mackenzie, 2017) examining filarial nematodes indicate, should be checked in vitro, but the changes in the similary of cultivation under the influence of freezing stress could not be obtained. However, arguably the most important challenge with using this technique is a lack of definition concerning the relationship between motility and the actual death of the worm. Our observation and understanding the genesis and form of subtle anatomic changes in such worms were therefore very important.

Fig. 3. Damaged A. simplex s. s. L3 larvae after freezing (−20 °C) and thawing A) 1 h 30′, B) 2 h. 5

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

in both treatments (fast and slow freezing rates) compared to the control (Fig. 5A) what suggests that the trehalose metabolism is playing a vital role during the freezing process. The research was shown by Thorne et al. (2017) where trehalose biosynthetic genes do not seem to be actively expressed when Panagrolaimus sp. DAW1 nematodes were frozen (−10 °C, FR = 0.5 °C/min). Although, using low concentration of intracellular trehalose cells are efficiently cryopreserved (Eroglu et al., 2000) what might be the reason why the expression of trehalose synthesis genes is decreasing in slow freezing. Surprisingly, in relation to cold acclimation (5 °C, without the freezing step) trehalose pathway genes were significantly up-regulated (Seybold et al., 2017). The process of andhydrobiosis is accompanied by increase in the level of trehalose, which is presumed to also act as a cryoprotectant in many organisms including nematodes (Stryiński and Łopieńska-Biernat, 2019). Our research might point for this process (Fig. 5A). Three genes, an aqp-10, lrr and nep-1 showed the strongest downregulation in expression profile, when compared to the control treatment (Fig. 5B). Aquaporins are important for solute and water transport across the membranes and are associated with changes of osmotic conditions (Kruse et al., 2006; Philip et al., 2008). They are familiar genes in the repertoire of those needed for cryptobiosis especially, cryoprotective dehydration (Thorne et al., 2014, 2017). Therefore, it seems strange that the aqp-10 transcriptional activity was significantly reduced compared to the control (Fig. 5B). The leucine-rich repeat gene (lrr) expression was down-regulated no matter on the freezing rate and freezing time (Fig. 5B). Although, leucine-rich repeat protein was previously qualified as a potential candidate for an ice-active protein, where its repetitive structure can inhibit ice crystallization (Worrall et al., 1998; Thorne et al., 2017). Thus, again it seems strange that the lrr mRNA transcripts expression was significantly reduced compared to the control. The last gene from this group is nep-1. Although the proteome of the nematode Caenorhabditis elegans has been intensively studied, very little is known about the function of neprilysin. It was shown that this enzyme plays an important role in the regulation of nematode locomotion and pharyngeal activity (Spanier et al., 2005). Also, studies on P. sp. DAW1 nematodes subjected on intracellular freezing showed a striking expression profile of neprilysin. However, it is too early to say what exact role might this gene play in the ability of nematodes to survive extracellular freezing (Thorne et al., 2017). At the same time, in our study the expression of nep-1 under exposure to slow or fast freezing was significantly down-regulated in both conditions (Fig. 5B). Thus, more work will be needed to follow this up. Next key genes involved in cryoprotection are oxidoreductase genes associated with cell stress: superoxide dismutase Cu-Zn (sod) and glutathione s-transferase (gst) (Fig. 5C). In our study gst which is upregulated during both, fast and slow freezing experiment, shows more significant expression increase at 0 h 30′ in comparison to slow freezing study, and the most significant expression increase, when compared to the control treatment. Increased expression of enzymatic antioxidants is evident upon exposure to desiccation in cold-stressed tissues, because one of the most deleterious effects of dehydration in the cell is oxidative damage (Hermes-Lima and Zenteno-Savin, 2002; Franca et al., 2007). Upon exposure to low temperatures (freezing) and thus desiccation, extra amounts of Reactive Oxygen Species (ROS) may be generated, and therefore it is important to initiate the series of genes that detoxify ROS like sod and gst. That mechanism was confirmed in Plectus murrayi in exposure to desiccation and freezing (Adhikari et al., 2010). Also, in C. elegans ROS are generated at wound sites and act as long-range signals in wound healing (Xu and Chisholm, 2014). This also might be an explanation of increased expression of gst, when taking under consideration all cuticle damages during freezing process (Table S1, Fig. 3). In our study upregulation of gst (Fig. 5C) suggest that A. simplex has efficient ROS-scavenging mechanism under cryoprotective dehydration. The superoxide dismutase Cu-Zn (sod) expression was nonsignificant during slow and fast freezing treatments, when compared to the control

3.3. Carbohydrates content and changes in specific gene expression Desiccation and cold-tolerance are considered to be overlapping adaptations eliciting similar responses to limit injury during periods of extreme environmental conditions (Ring and Danks, 1998; Convey and Williams, 2002). The sugar-based cryoprotectants prevent damage from dehydration and freezing by preserving protein structure stability, inhibiting fusion between adjacent vesicles, and by maintaining the lipids in a fluid state in the absence of water (Crowe et al., 1998). Changes in production of organic osmolytes like glycerol and trehalose are universal during the temperature stress, when they reduce osmotic outflow from the cell and thus reduce the injury due to cell freezing/dehydration (Storey and Storey, 1988). The trehalose is the main carbohydrate in nematodes, acting as energy storage, circulatory sugar, participating in glucose uptake, and playing important role in the protection against adverse environmental conditions (Elbein et al., 2003; Tang et al., 2018). Number of nematode species synthesize trehalose in response to high or low temperature stresses and adapted to that conditions, show increased survival (Stryiński and Łopieńska-Biernat, 2019). In parasitic nematodes, e.g., in A. simplex, trehalose metabolism play a key role in supporting life processes (Łopieńska-Biernat et al., 2015, 2019b). Also, the conversion of glycerol to glycerol-3phosphate and dihydroxyacetone phosphate as the part of the process of entering into either the glycolysis or the gluconeogenesis pathway is one of the most important processes in nematodes during stress conditions (Nelson and Cox, 2000). It is likely that gluconeogenesis is the preferred pathway under desiccation stress because the glucose produced by gluconeogenesis may be metabolized to protectant trehalose. An increase in glycerol content has been demonstrated a reduce rates of water loss (Yoder et al., 2006) and to protect membranes and proteins during dehydration (Tang and Pikal, 2005). Thus, we wanted to see if glycerol level is also increased during the cold-treatment as during desiccation. We have used HPLC to check the levels of carbohydrates in slow and fast freezing-treated L3 larvae of A. simplex s. s. Trehalose and glycerol were the major compounds which levels we wanted to validate. Additionally, we have measured the content of glucose, which is the main sugar taking a part in the biosynthesis of previously mentioned sugar-based protectants. The effect of slow and fast freezing on glycerol concentration was none, when compared to the control (Fig. 4). The levels of trehalose were significantly higher after slow freezing treatment (p < .0001), than the fast freezing (p < .002). The concentration of glucose was significantly lower in both, slow and fast freezing, when compared to the control treatment. The changes induced by cold exposure and environmental stresses that result in acclimation or rapid cold-hardening are presumably controlled by changes in gene expression. Eleven genes were chosen for detailed examination by qReal-time PCR. All of them were selected because of their function and role in freezing and cryoprotective dehydration: trehalose-6-phosphate synthase (tps), trehalose-6-phosphate phosphatase (tpp), trehalase (tre), heat shock cognate protein 70 (hsc 70), heat shock protein 90 (hsp 90), superoxide dismutase Cu-Zn (sod), glutathione s-transferase (gst), aquaporin-10 (aqp-10), leucine-rich repeat protein (lrr), neprylisin-1 (nep-1) and actin (act). The expression of all these genes, when compared to the control treatment, can be divided in terms of their general expression profile over the three ratios, i.e. down-regulated, up-regulated and stable. Roughly, these are: tpp, hsp90, aqp-10, lrr and nep-1 which are downregulated; tps, tre, gst, sod and hsc70 which is up-regulated. The sod behaved stable (Fig. 5). The expression of actin gene was stable during experiment pointed to nematode activity (Fig. S1). The enzymes TPS, TPP are directly involved in trehalose synthesis and enzyme trehalase (TRE), involved in trehalose breakdown in nematode, are essential genes in indicating an inducible expression in the cold adaptation (Wharton et al., 2000; Thorne et al., 2014; ŁopieńskaBiernat et al., 2015; Seybold et al., 2017; Łopieńska-Biernat et al., 2019a). In this study, trehalose biosynthesis genes, were up-regulated 6

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

Fig. 4. The carbohydrates content in slow and fast freezing-treated L3 larvae of A. simplex s. s. Significant differential carbohydrate level is indicated by asterisk where p < .0332 (*), p < .0021 (**), p < .0002 (***) and p < .0001 (****). ns- non-significant.

pathogenicity through the release of allergens, e.g. from damaged tubules. In contrast, larvae that show mobility after freezing, retain greater pathogenicity due to the possibility of causing also anisakiasis and allergies. Nematodes have a number of strategies to survive low temperatures and the risk of freezing. These include freeze avoidance, cryoprotective dehydration, andhydrobiosis and freezing tolerance, the later involving surviving the formation extracellular and/or intracellular ice (Wharton, 2002, 2003). Work done by Adhikari et al. (2009, 2010) and other studies have shown that many genes that are induced by cold are also induced by desiccation, probably because many cold-inducible genes encode proteins to protect the nematodes from the consequences of freezing stress, which include dehydration (Chen et al., 2005). That all implies, that lower temperatures induce changes in metabolic status of A. simplex s.s L3 larvae, especially in trehalose gene expression/content, genes responsible for oxidative metabolism, and chaperons proteins, but we cannot state clearly whether these changes occur during freezing, or because they are already prevalent during cold acclimation. The induction of mentioned genes seems to be a common trait of both cold- and dehydration tolerance. Should be noted that although large part of the metabolic mechanism against desiccation is turned on in defense against freezing, additional genes are activated to deal with each individual stress. The further and more detailed work is needed to unravel the molecular mechanism and different suites of genes which will be transcribed when A. simplex s.s nematodes are exposed to desiccation and freezing. What is also interesting the infective L3 of those animal-parasitic nematodes found in the environment are often considered to be equivalent to the stress-resistant Dauer stage described for the first time in C. elegans (Hotez et al., 1993). For parasitic nematodes that switch between a mammalian host and the environment, temperature changes may be one factor that allows the parasite to monitor its location and implement the appropriate gene expression profile (Hunter et al., 2001). During the infection event additional changes in parasitic

(Fig. 5C). The last group of genes (Fig. 5D) which we studied, heat shock proteins (Hsps), are general stress proteins and are synthesized in response to a wide range of stressors, including cold exposure and heat stress (Gross, 2004; Zhang and Guy, 2006; Chen et al., 2015). A temperature decreases up to 4 °C increased expression of hsp70 in the parasitic first stage larvae of Trichinella spiralis, T. nativa and T. nelsoni, but level of hsp90 decline or do not change (Martinez et al., 2001). Artic species of Trichinella have strong freezing tolerance abilities, surviving within the frozen carcasses of their hosts (Davidson et al., 2008). It seems that cold-induced Hsps play a role in this ability. Exposure of Meloidogyne artiellia to low temperature (5 °C) showed constitutive expression of hsp90 in all life stages, but at higher level in egg masses and L4 stage, but decreased level in L2 stage (DeLuca et al., 2009). Similar situation was shown when P. murrayi was exposed to freezing (−10 °C) where hsp70 and hsp90 were continuously expressed during cold treatment (Adhikari et al., 2010). In our study, hsc70 (a member of the heat shock protein 70 family) expression profiles were significantly increased when compared to the control treatment, only hsp90 decreased in slow freezing rate (Fig. 5D). In our study we have also investigated expression profiles of selected genes in larvae which were viable after freezing experiment (Fig. 5). We have noticed that expression of tps, sod, gst, hsc70 and hsp90 was significantly up-regulated, when compared to the control treatment, and when compared to the expression levels after slow and/or fast freezing experiment. Similar situation was with tpp, aqp-10, lrr, and nep-1 genes expression levels, when compared to the slow and/or fast freezing experiment but, when compared to the control, significantly down-regulated. This situation might be a picture of what was the metabolic status of larvae which survived the freezing treatment. Proving that the main factors ensuring the survival of nematodes after deep freezing are the synthesis of trehalose, thermal shock protein and enzymatic antioxidant system (Fig. 5). We might be tempted to say that the freezing of larvae results in metabolic stability, acclimatization and 7

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

Fig. 5. The gene expression profiles of A) trehalose-6-phosphate synthase (tps), trehalose-6-phosphate phosphorylase (tpp), trehalase (tre), B) aquaporin-10 (aqp-10), leucine-rich repeat protein (lrr), and neprylisin-1 (nep-1), C) superoxide dismutase Cu-Zn (sod), glutathione s-transferase (gst), D) heat shock cognate protein 70 (hsc 70), heat shock protein 90 (hsp 90) in A. simplex s. s. L3 samples in response to slow and fast freezing treatment. Additionally, expression profiles of selected genes in viable larvae after the freezing experiment were shown (A, B, C, D). The control is shown as normalized to a value 1 and the samples indicate the changes relative to the control. Significant differential expression is indicated by asterisk where p < .0332 (*), p < .0021 (**), p < .0002 (***) and p < .0001 (****). ns- nonsignificant.

and safety for the consumers in term of Anisakis survival and allergenicity, technological treatments applied to fish need to be considered again, not only in previous terms of freezing rate and larvae viability, as well cuticle damage during the freezing process and possible allergen release, but what is new, the inhomogeneity of temperature or low cooling capacity in freezers. Thus, we recommend to extend the freezing time and in the case of suspected presence of Anisakis larvae, monitor the internal temperature of the fish meat, with external thermometers, not only with the indicator of the set temperature on the freezer. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.meegid.2020.104312.

nematodes metabolism occur. Parasite must to adapt to novel environment conditions, but also confront with host immune system and what is the most important, reinitiate developmental cycle (Devaney, 2011). From this, all the exceptions from the literature data in A. simplex gene expression may result which we mentioned above. All these processes are linked and a lot needs to be studied about the mechanisms by which parasitic nematodes integrate environmental and internal signals to regulate their, stimulated from everywhere, metabolism. 4. Conclusions The metabolic status of L3 A. simplex s.s larvae is affected by coldtreatment not only in term of desiccation and freezing stresses which appear together, but also because of the composite mechanism by which, parasitic nematodes regulate their development in complex life cycles. Due that fish-borne parasite, like A. simplex, survival strategies should be more detailed studied in connection with the efforts of anisakiasis eradication and safety of the fish products consumers. According to our study and literature data fast freezing rate is preferred in order to safety of fish products in terms of Anisakis larvae mortality. What is for sure to prevent anisakiasis we need to follow the recommendations of the sanitary authorities of the USA and the EU, where what seems to be the most important, suggested temperature must be reached in all parts of the fishery product. According to above, to maintain both, the best eating quality of fish

Author contributions Elżbieta Łopieńska-Biernat: Project administration, Supervision, Validation, Supervision Writing - original draft. Robert Stryiński and Iwona Polak: Investigation, Methodology, Resources, Software, Visualization. Bogusław Pawlikwski: Formal analysis. Joanna Pawlak:Validation. Magdalena Podolska: Conceptualization, Data curation, Funding acquisition, Writing - review & editing.

8

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

Declaration of Competing Interest

49–52. Giannakourou, M.C., Taoukis, P.S., 2003. Application of a TTI-based distribution management system for quality optimization of frozen vegetables at the consumer end. J. Food Sci. 68, 201–209. Giarratana, F., Muscolino, D., Beninati, Ch., Giuffrida, A., Panebianco, A., 2014. Activity of Thymus vulgaris essential oil against Anisakis larvae. Exp. Parasitol. 142, 7–10. https://doi.org/10.1016/j.exppara.2014.03.028. Gross, M., 2004. Emergency services: a bird's eye perspective on the many different functions of stress proteins. Curr. Protein Pept. Sci. 5, 213–223. Hermes-Lima, M., Zenteno-Savin, T., 2002. Animal response to drastic changes in oxygen availability and physiological oxygen stress. Comp. Biochem. Physiol. C 133, 537–556. Hotez, P., Hawdon, J., Schad, G.A., 1993. Hookworm larval infectivity, arrest and amphiparatenesis: the Caenorhabditis elegans Daf-c paradigm. Parasitol. Today 9, 23–26. Hunter, S.J., Thompson, F.J., Tetley, L., Devaney, E., 2001. Temperature is a cue for gene expression in L3 of the filarial nematode Brugia pahangi. Mol. Biochem. Parasitol. 112, 1–9. Kono, S., Kon, M., Araki, T., Sagara, Y., 2017. Effects of relationships among freezing rate, ice crystal size and color on surface color of frozen salmon fillet. J. Food Eng. 214, 158–165. Kruse, E., Uehlein, N., Kaldenhoff, R., 2006. The aquaporins. Genome Biol. 7, 206. KruseFæste, Ch., Jonscher, K.R., Dooper, M.M.W.B., Egge-Jacobsen, W., Moen, A., Daschner, A., Egaas, E., Christians, U., 2014. Characterization of potential novel allergens in the fish parasite Anisakis simplex. Proteomics 4, 140–155. Lalchandani, U.R., Weadock, W.J., Brady, G.F., Wasnik, A.P., 2018. Imaging in gastric anisakiasis. Clin. Imaging 50, 286–288. Łopieńska-Biernat, E., Żółtowska, K., Rokicki, J., 2007. Trehalose catabolism enzymes in L3 and L4 larvae of Anisakis simplex. J. Parasitol. 93, 1291–1294. Łopieńska-Biernat, E., Czubak, M., Zaobidna, E.A., Rokicki, J., 2014. Properties of trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in third-stage larvae of the nematode Anisakis simplex—preliminary studies. Russ. J. Nematol. 22, 131–140. Łopieńska-Biernat, E., Zaobidna, E.A., Dmitryjuk, M., 2015. Expression of genes encoding the enzymes for glycogen and trehalose metabolism in L3 and L4 larvae of Anisakis simplex. J. Parasitol. Res. 438145. Łopieńska-Biernat, E., Paukszto, Ł., Jastrzębski, J.P., Makowczenko, K., Stryiński, R., 2019a. Genes expression and in silico studies of functions of trehalases, a highly dispersed Anisakis simplex s.l. specific gene family. Int. J. Biol. Macromol. 129, 957–964. Łopieńska-Biernat, E., Stryiński, R., Dmitryjuk, M., Wasilewska, B., 2019b. Infective larvae of Anisakis simplex (Nematoda) accumulate trehalose and glycogen in response to starvation and temperature stress. Biol. Open 040014. Mackenzie, C.D., Behan-Braman, A., Hauptman, J., Geary, T., 2017. Assessing the viability and degeneration of the medically important filarial nematodes chapter 6 in nematology - concepts. Diag. Control. https://doi.org/10.5772/intechopen.69512. Martinez, J., Perez-Serrano, J., Bernadina, W.E., Rodriguez-Caabeiro, F., 2001. Stress response to cold in Trichinella species. Cryobiology 43, 293–302. Mattiucci, S., Cipriani, P., Levsen, A., Paoletti, M., Nascetti, G., 2018. Molecular epidemiology of Anisakis and anisakiasis: an ecological and evolutionary road map. Adv. Parasitol. 99, 93–263. McIntyre, L., Bayne, G., Gilbert, S., Lake, R., 2007. Domestic food practices in New Zealand freezer survey. In: Final Report. Prepared as Part of a New Zealand Food Safety Authority Contract for Scientific Services, Available at: http://www. foodsafety.govt.nz/elibrary/industry/Domestic_Food_Practices-Baseline_Information. pdf. Nelson, D.L., Cox, M.M., 2000. Structure and catalysis. In: Nelson, D.L., Cox, M.M. (Eds.), Lehninger Principles of Biochemistry. Worth Publishers, New York, USA, pp. 45–421. Nieuwenhuizen, N.E., 2016. Anisakis – immunology of a foodborne parasitosis. Parasite Immunol. 38, 548–557. Nieuwenhuizen, N.E., Lopata, A.L., 2014. Allergic reactions to Anisakis found in fish. Curr Allergy Asthma Rep 14 (8), 1–6. Palomba, M., Paoletti, M., Colantoni, A., Rughetti, A., Nascetti, G., Mattiucci, S., 2019. Gene expression profiles of antigenic proteins of third stage larvae of the zoonotic nematode Anisakis pegreffii in response to temperature conditions. Parasite 26 (2019), 52. https://doi.org/10.1051/parasite/2019055. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nuceleic Acids Res. 29 (9), e45. Philip, B.N., Yi, S.X., Elnitsky, M.A., Lee, R.E., 2008. Aquaporins play a role in desiccation and freeze tolerance in larvae of the goldenrod gall fly, Eurosta solidaginis. J. Exp. Biol. 211, 1114–1119. Podolska, M., Pawlikowski, B., Nadolna-Ałtyn, K., Pawlak, J., Komar-Szymczak, K., Szostakowska, B., 2019. How effective is freezing at killing Anisakis simplex, Pseudoterranova krabbei and P. decipiens larvae? An experimental evaluation of timetemperature conditions. Parasitol. Res. 118, 2139–2147. Ring, R.A., Danks, H.V., 1998. The role of trehalose in cold-hardiness and desiccation. Cryoletters 19, 275–282. Rodríguez-Mahillo, A.I., Gonzalez-Muñoz, M., Gomez-Aguado, F., Rodriguez-Perez, R., Corcuera, M.T., Caballero, M.L., et al., 2007. Cloning and characterization of the Anisakis simplex allergen Ani s 4 as a cysteine-protease inhibitor. Int. J. Parasitol. 37, 907–917. Sánchez-Alonso, I., Carballeda-Sangiao, N., González-Muñoz, M., Navas, A., Arcos, S.C., Mendizábal, A., Tejada, M., Careche, M., 2018. Pathogenic potential of Anisakis L3 after freezing in domestic freezers. Food Control 84, 61–69. Sánchez-Alonso, I., Navas, A., Arcos, S.C., González-Muñoz, M., Carballeda-Sangiao, N., Careche, M., 2019. Respiratory analysis as a tool to detect physiological changes in Anisakis larvae subjected to stress. Parasitol. Res. 118, 1127–1135.

The authors declare that they have no competing interests that are directly relevant to the content of this study. Acknowledgment This work was supported by the Dean of Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, Poland (12.610.012.300). A part of this study (freezing experiment) was supported by The National Centre for Research and Development under the Strategic Program of Research and Development “BIOSTRATEG” (grant number BIOSTRATEG2/296211/4/NCBR/2016). References Adams, A.M., Ton, M.N., Wekell, M.M., MacKenzie, A.P., Dong, M.F., 2005. Survival of Anisakis simplex in arrowtooth flounder (Atheresthes stomia) during frozen storage. J. Food Prot. 68, 1441–1446. Adhikari, B.N., Wall, D.H., Adams, B.J., 2009. Desiccation survival in Antarctic nematode: molecular analysis using expressed sequenced tags. BMC Genomics 10, 69. Adhikari, B.N., Wall, D.H., Adams, B.J., 2010. Effect of slow desiccation and freezing on gene transcription and stress survival of an Antarctic nematode. J. Exp. Biol. 213, 1803–1812. Audicana, M.T., Kennedy, M.W., 2008. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin. Microbiol. Rev. 21, 360–379. Audicana, M.T., Ansoteguide, I.J., Corres, L.W., Kennedy, M.W., 2002. Anisakis simplex: dangerous—dead and alive? Trends Parasitol. 18, 20–25. Bao, M., Pierce, G.J., Pascual, S., González-Muñoz, M., Mattiucci, S., Mladineo, I., Cipriani, P., Bušelić, I., Strachan, N.J.C., 2017. Assessing the risk of an emerging zoonosis of worldwide concern: Anisakiasis. Sci. Report. 7, 43699. Bao, M., Pierce, G.J., Strachan, N.J.C., Pascual, S., González-Muñoz, M., Levsen, A., 2019. Human health, legislative and socioeconomic issues caused by the fish-borne zoonotic parasite Anisakis: challenges in risk assessment. Trends Food Sci. Technol. 86, 298–310. Carrera, M., Gallardo, J.M., Pascual, S., González, A.F., Medina, I., 2016. Protein biomarker discovery and fast monitoring for the identification and detection of Anisakids by parallel reaction monitoring (PRM) mass spectrometry. J. Proteome 142, 130–137. Chai, J.Y., Darwin Murrell, K., Lymbery, A.J., 2005. Fish-borne parasitic zoonoses: status and issues. Int. J. Parasitol. 35, 1233–1254. Chen, S., Gollop, N., Glazer, I., 2005. Cross-stress tolerance and expression of stress-related proteins in osmotically desiccated entomopathogenic Steinernema feltiae IS-6. Parasitology 131, 695–703. Chen, H.-Y., Cheng, Y.-S., Shih, H.-H., 2015. Expression patterns and structural modelling of Hsp70 and Hsp90 in a fish-borne zoonotic nematode Anisakis pegreffii. Vet. Parasitol. 212, 281–291. Convey, P., Williams, D.D., 2002. Antarctic soil nematode response to artificial climate amelioration. Eur. J. Soil Biol. 38, 255–259. Crowe, J.H., Carpenter, J.F., Crowe, L.M., 1998. The role of vitrification in andhydrobiosis. Annu. Rev. Physiol. 60, 73–103. Davidson, R.K., Handeland, K., Kapel, C.M.O., 2008. High tolerance to repeated cycles of freezing and thawing in different Trichinella nativa isolates. Parasitol. Res. 103, 1005–1010. DeLuca, F., DiVito, M., Fanelli, E., Reyes, A., Greco, N., De Giorgi, C., 2009. Characterization of the heat shock protein 90 gene in the plan parasitic nematode Meloidogyne artiellia and its expression as related to different developmental stages and temperature. Gene 440, 16–22. Devaney, E., 2011. Thermobiotic survival. In: Perry, R.N., Wharton, D.A. (Eds.), Molecular and Physiological Basis of Nematode Survival. CAB International, Oxfordshire, UK, pp. 233–255. Duman, J., 2015. Animal ice-binding (antifreeze) proteins and glycolipids: an overview with emphasis on physiological function. J. Exp. Biol. 2018, 1846–1855. EFSA Panel on Biological Hazards (BIOHAZ), 2010. Scientific opinion on risk assessment of parasites in fishery products. EFSA J. 8, 1543. Elbein, A.D., Pan, Y.T., Pastuszak, I., Carroll, D., 2003. New insights on trehalose: a multifunctional molecule. Glycobiology 13, 17R–27R. Eroglu, A., Russo, M.J., Bieganski, R., Fowler, A., Cheley, S., Bayley, H., Toner, M., 2000. Intracellular trehalose improves the survival of cryopreserved mammalian cells. Nat. Biotechnol. 18, 163–167. Evans, J.A., Foster, A.M., Brown, T., 2014. Temperature control in domestic refrigerators and freezers. 3rd IIR international conference on sustainability and the cold chain. Refrigeration Sci. Technol. 2014, 142–149. Falcao, H., Lunet, N., Neves, E., Iglesias, I., Barros, H., 2008. Anisakis simplex as a risk factor for relapsing acute utricaria: a case-control study. J. Epidemiol. Community Health 62, 634–637. Franca, M.B., Panek, A.D., Eleutherio, E.C.A., 2007. Oxidative stress and its effects during dehydration. Comp. Biochem. Physiol. A 146, 621–631. Garcia, F., Blanco, J.G., Garces, M., Juste, S., Fuentes, M., Herrero, D., 2001. Freezing protects against allergy to Anisakis simplex. J Investig Allergol Clin Immunol 11,

9

Infection, Genetics and Evolution 82 (2020) 104312

E. Łopieńska-Biernat, et al.

PLoS One 9, e104526. Thorne, M.A.S., Seybold, A., Marshall, C., Wharton, D., 2017. Molecular snapshot of an intracellular freezing event in an Antarctic nematode. Cryobiology 75, 117–124. Wharton, D.A., 2002. Life at the Limits: Organisms in Extreme Environments. Cambridge University Press, Cambridge, UK. Wharton, D.A., 2003. The environmental physiology of Antarctic terrestrial nematodes: a review. J. Comp. Physiol. B. 173, 621–628. Wharton, D.A., Aalders, O., 2002. The response of Anisakis larvae to freezing. J. Helminthol. 76, 363–368. Wharton, D.A., Judge, K.F., Worland, M.R., 2000. Cold acclimation and cryoprotectans in a freeze-tolerant Antarctic nematode, Panagrolaimus davidi. J. Comp. Physiol. B. 170, 321–327. Wharton, D.A., Barrett, J., Goodall, G., Marshall, C.J., Ramløv, H., 2005. Ice-active proteins from the Antarctic nematode Panagrolaimus davidi. Cryobiology 51, 198–207. Seybold, A.C., Wharton, D.A., Thorne, M.A.S., Marshall, C.J., 2017. Investigating trehalose synthesis genes after cold acclimation in the Antarctic nematode Panagrolaimus sp. DAW1. Biol. Open 6, 1953–1959. Worrall, D., Elias, L., Ashford, D., Smallwood, M., Sidebottom, C., Lillford, P., Telford, J., et al., 1998. A carrot leucine-rich-repeat protein that inhibits ice recrystallization. Science 282, 115–117. Xu, S., Chisholm, A.D., 2014. C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Develop. Cell 31, 48–60. Yoder, J.A., Benoit, J.B., Denlinger, D.L., Rivers, D.B., 2006. Stress-induced accumulation of glycerol in the flesh fly, Sacrophaga bullata: evidence indicating anti-desiccant cryoprotectant functions of this polyol and the role of the brain coordinating the response. J. Insect Physiol. 52, 202–214. Zhang, C., Guy, C.L., 2006. In vitro evidence of Hsc70 functioning as a molecular chaperone during cold stress. Plant Physiol. Biochem. 44, 844–850.

Shimamura, Y., Muwanwella, N., Chandran, S., Kandel, G., Marcon, N., 2016. Common symptoms from an uncommon Infection: Gastrointestinal anisakiasis. Can. J. Gastroenterol. Hepatol. 1–7. Solas, M.T., García, M.L., de las Heras, C., Rodriguez-Mahillo, A.I., Gonzalez-Muñoz, M., Moneo, I., et al., 2009. Anisakis simplex antigens in fresh and frozen-thawed muscle of anchovies in vinegar. Food Sci. Technol. Int. 15, 139–148. Solas, M.T., García, M.L., Rodriguez-Mahillo, A.I., Gonzalez-Muñoz, M., de las Heras, C., Tejada, M., 2008. Anisakis antigens detected in fish muscle infested with Anisakis simplex L3. J. Food Prot. 71, 1273–1276. Spanier, B., Sturzenbaum, S., Holden-Dye, L., Baumeister, R., 2005. Caenorhabditis elegans neprilysin NEP-1: an effort of locomotion and pharyngeal pumping. J. Mol. Biol. 352, 429–437. Storey, K.B., Storey, J.M., 1988. Freeze tolerance in animals. Physiol. Rev. 68, 27–84. Stryiński, R., Łopieńska-Biernat, E., 2019. Trehalose: metabolism and role in stress response in various organisms. In: Łopieńska-Biernat, E., Stryiński, R. (Eds.), Trehalose: Sources, Chemistry and Applications. NOVA Science Publisher, New York, USA. Tang, X., Pikal, M.J., 2005. The effects of stabilizers and denaturant on the cold denaturation temperatures of proteins and implications for freeze-drying. Pharmacol. Res. 22, 1167–1175. Tang, B., Wang, S., Wang, S.-G., Wang, H.-J., Zhang, J.-Y., Cui, S.-Y., 2018. Invertebrate trehalose-6-phosphate synthase gene: genetic architecture, biochemistry, physiological function, and potential applications. Front. Physiol. 9, 30. Taoukis, P.S., Giannakourou, M.C., Tsironi, T.N., 2011. Monitoring and control of the cold chain. In: Sun, D.W. (Ed.), Handbook of Frozen Food Processing and Packaging, 2nd ed. CRC Press, Taylor and Francis Group, Boca Raton FL, USA, pp. 273–299. Tejada, M., Solas, M.T., Navas, A., Mendizabal, A., 2006. Scanning electron microscopy of Anisakis larvae following different treatments. J. Food Prot. 69, 1379–1387. Thorne, M.A.S., Kagoshima, H., Clark, M.S., Marshall, C.J., Wharton, D.A., 2014. Molecular analysis of the cold tolerant Antarctic nematode, Panagrolaimus davidi.

10