Effect of heat stress on amino acid digestibility and transporters in meat-type chickens

Effect of heat stress on amino acid digestibility and transporters in meat-type chickens W. S. Habashy,∗,† M. C. Milfort,∗ K. Adomako,‡ Y. A. Attia,†,§ R. Rekaya,# and S. E. Aggrey∗,1 ∗

NutriGenomics Laboratory, Department of Poultry Science, University of Georgia, Athens 30602; † Department of Animal and Poultry Production, Damanhour University, Damanhour, Al-Behira, Egypt; ‡ Department of Animal Science, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana; § Arid Land Agriculture Department, King Abdulaziz University, Jeddah, Saudi Arabia; and # Department of Animal and Dairy Sciences, University of Georgia, Athens 30602 and retention were significantly lower in the HS group when compared to the control group. Meanwhile, the retention of amino acids per BWG was higher in the HS group when compared to the control group except for hydroxylysine and ornithine. The dynamics of amino acid transporters in the P. major and ileum was influenced by HS. In P. major and ileum tissues at d one, transporters SNAT1, SNAT2, SNAT7, TAT1, and b0,+ AT, were down-regulated in the HS group. Meanwhile, LAT4 and B0 AT were down-regulated only in the P. major in the treatment group. The amino acid transporters B0 AT and SNAT7 at d 12 post HS were down-regulated in the P. major and ileum, but SNAT2 was down-regulated only in the ileum and TAT1 was down-regulated only in the P. major compared with the control group. These changes in amino acid transporters may explain the reduced growth in meat type chickens under heat stress.

ABSTRACT The present study was conducted to investigate the effect of heat stress (HS) on performance, digestibility, and molecular transporters of amino acids in broilers. Cobb 500 chicks were raised from hatch till 13 d in floor pens. At d 14, 48 birds were randomly and equally divided between a control group (25◦ C) and a HS treatment group (35◦ C). Birds in both treatment classes were individually caged and fed ad libitum on a diet containing 18.7% CP and 3,560 Kcal ME/Kg. Five birds per treatment at one and 12 d post treatment were euthanized and the Pectoralis major (P. major) and ileum were sampled for gene expression analysis. At d 33, ileal contents were collected and used for digestibility analysis. Broilers under HS had reduced growth and feed intake compared to controls. Although the apparent ileal digestibility (AID) was consistently higher for all amino acids in the HS group, it was not significant except for hydroxylysine. The amino acid consumption

Key words: heat stress, amino acid transporters, digestibility, Pectoralis major, ileum 2017 Poultry Science 0:1–8 http://dx.doi.org/10.3382/ps/pex027

INTRODUCTION

tention, and enhanced lipid deposition (Geraert et al., 1996). The first step of nutrient utilization that might reduce feed efficiency is lower feed digestibility (Bonnet et al., 1997). Some experiments have suggested that increased environmental temperatures decreased the dietary availability of nutrients such as amino acids (Zuprizal et al., 1993; Soleimani et al., 2010). Wallis and Balnave (1984) reported that increased environmental temperatures decreased the digestibility of some amino acids in female but not in male broilers. Under HS, a change in absorption of nutrients in the intestines may occur either by changing the intestinal mucosal morphology, the activities of digestive enzymes and intestinal motility (Tsukada et al., 2002; Ferrer et al., 2003), or by changing the gene expression of nutrient transporters (Ferrer et al., 2003; Shepherd et al., 2004). Different molecular transporters are responsible for the cellular uptake of amino acids. The uptake of amino acid molecules into a specific cell type may occur by different transport systems depending

Heat stress (HS) is one of the most important stressors in the (sub) tropical regions and summer season in temperate regions of the world. Poultry is affected by HS during periods of high temperature and humidity because their heat loss is limited by feathering and by the lack of sweat glands (Cahaner, 2008). Heat stress has negative impacts on the productivity of poultry (Song et al., 2012; Sun et al., 2015). In broilers, it has been shown that decreased growth, feed intake, and feed conversion ratio occur under HS (Temim et al., 2000a; De Souza et al., 2016). These reductions were explained by decreased metabolic utilization of nutrients, increased heat production, reduced protein re-

 C 2017 Poultry Science Association Inc. Received November 2, 2016. Accepted February 24, 2017. 1 Corresponding author: [email protected]

1

2

HABASHY ET AL.

on the tissue, the charge of the amino acid, and the direction of transport (Br¨ oer, 2008; Stevens, 2010). The nutrient and energy available to the animal for growth are affected by the expression of nutrient transporter systems in the intestinal epithelium brush border (Mott et al., 2008). In animal and human skeletal muscle, muscle protein metabolism is regulated by amino acid ingestion through stimulation of the mammalian target of rapamycin complex1 signaling pathway (Suryawan et al., 2008; Dickinson et al., 2011). This stimulation by amino acids influences an increase in the rate of muscle protein synthesis (Fujita et al., 2007; Dickinson et al., 2011). In human skeletal muscle, amino acid transporters play an important role in regulating changes in muscle protein synthesis (Dickinson and Rasmussen, 2013). In chickens, chronic HS reduced protein synthesis and decreased protein break down in the Pectoralis (P.) major leading to reduced protein deposition (Temim et al., 2000b), therefore, an understanding of the regulation of amino acid transporters could guide in optimization of the dietary requirement under HS. Heat stress generates reactive oxygen species, which may alter the levels of mRNA of amino acid transporters, hence affecting the amino acid digestibility. The objective of this study was to investigate the effect of heat stress on ileal digestibility and amino acid transporters in meat-type chickens.

MATERIALS AND METHODS Animals and Diets Research on live chickens met the guidelines approved by the institutional animal care and use committee of the University of Georgia. Male Cobb 500 chicks were raised from hatch until d 13 under standard husbandry practices. At d 14, 48 individuals at similar body weight (BW) were divided into 2 groups and raised under either constant normal or high temperature (25◦ C or 35◦ C) from d 14 to 33 in individual cages (L = 30.48 cm x B = 60.96 cm x H = 45.72 cm). The digestibility experiment started from d 26 to 33.The birds were fed ad libitum on a diet containing 18.7% crude protein and 3,560 Kcal ME/Kg. The analyzed dietary composition is presented in Table 1. Individual BW and feed intake (FI) were measured at one and 12 d after HS. Feed conversion ratio (FCR) was calculated as FI per BWG. The amino acid consumed was calculated from the amount of amino acid in the diet and the amount of feed consumed during day 26 to 33.

Apparent Digestibility The ileum contents were collected from 5 birds per treatment and dried for amino acid analysis. Amino acid profile of the diets and ileal content of each bird were analyzed using standardized methods (AOAC, 2000). The apparent ileal digestibility (AID) of amino

Table 1. Analyzed composition of diet Element

%

Taurine Hydroxyproline Aspartic acid Threonine Serine Glutamic acid Proline Lanthionine Glycine Alanine Cysteine Valine Methionine Isoleucine Leucine Tyrosine Phenylalanine Hydroxylysine Ornithine Lysine Histidine Arginine Tryptophan Gross energy(Cal /100 g) Chromium Copper (ppm) Crude protein Moisture Crude fat Crude fiber Ash

0.02 0.00 1.73 0.74 0.76 3.28 1.02 0.00 0.76 0.96 0.27 0.98 0.51 0.83 1.68 0.59 0.91 0.02 0.01 1.20 0.47 1.14 0.20 356.00 0.015 8.90 18.73 11.14 4.42 2.68 5.40

acids (aa) were calculated as (Edwards and Gillis, 1959):

Apparent Ileal Digestibility (AID) = 100 



 

% Cr in diet % aa in ileum − 100 x % Cr in ileum % aa in diet



The amino acids analyzed were methionine, lysine, cysteine, threonine, isoleucine, valine, tryptophan, arginine, leucine, glycine, proline, alanine, aspartic acid, glutamic acid, serine, tyrosine, phenylalanine, hydroxylysine, ornithine, and histidine. The amino acid retained (AAR) (mg/week) was calculated as AID multiplied by amino acid intake from d 26 to 33 The AAR per BWG (mg/g) was calculated as the ratio of AAR and BWG from d 26 to 33.

Gene Expression of Amino Acid Transporters For gene expression analyses, ileum and P. major tissue samples were collected from 5 birds in each treatment group at one and 12 d post HS and were immediately placed in liquid nitrogen and later stored at -86◦ C. Total RNA was extracted from P. major and ileum tissues using Trizol reagent (Invitrogen Corp., Carlsbad, CA) according to manufacturer’s instructions and purified with RNeasy mini kits (Qiagen, Valencia, CA) according to the manufacturer’s protocol. The RNA samples were suspended in RNase-free water, and

3 Table 2. Primer pairs used to analyze amino acid transporters using quantitative RT-PCR Gene symbol

Gene bank Accession Number

Product size (bp)

NM 001199133.1

113

B0 AT (SLC6A19)

XM 419056.4

117

CAT1 (SLC7A1)

EU360441.1

111

LAT1 (SLC7A5)

NM 001030579.2

98

LAT4 (SLC43A2)

XM 415803.4

113

SNAT1 (SLC38A1)

NM 001199603.1

108

SNAT2 (SLC38A2)

NM 001305439.1

127

SNAT7 (SLC38A7)

XM 414044.4

105

TAT1 (SLC16A10)

XM 419783.4

119

B-actin

NM 205518.1

125

0,+

b

AT (SLC7A9)

sample purity and concentration were measured on a Nano Drop spectrophotometer (Thermo Scientific, Wilmington, DE). For cDNA synthesis, 10 μg of total RNA was reversed transcribed with high capacity cDNA reverse transcription kits according to manufacturer’s protocol (Applied Biosystems, Carlsbad, CA). Real-time PCR reactions were performed using the StepOnePlus (Applied Biosysems, Carlsbad, CA). Final concentration 57.5 ng/μl cDNA served as a template in a 20μl PCR mixture containing a final concentration 150 nM each of forward and reverse primers from 10 μM stocks and Fast SYBR Green Master Mix (Applied Biosystems, Carlsbad, CA). The PCR conditions were 95◦ C for 20 s, followed by 40 cycles of 95◦ C for 3 s and 60◦ C for 30 seconds. In addition, at the end of each reaction, a melting temperature curve of every PCR reaction was determined. Data were analyzed according to the 2−ΔΔCt method (Livak and Schmittgen, 2001) and were normalized by β -actin expression in each sample. The NCBI accession numbers, forward, reverse primers, and amplicon sizes used in this study are provided in Table 2.

Statistical Analysis Data analyses for BWG, FI, FCR, AAI, AID, and AAR were carried out using PROC GLM in SAS (2011). Contrasts between the treatment levels were used to assess the statistical significance.

RESULTS Birds under HS consumed less feed and experienced less growth compared to the controls (P < 0.05). There was difference in FCR between the 2 groups during days 26 to 33 (Table 3). The chickens in the HS environment consumed 20.44% less feed and grew 22.74% slower compared to the birds in the normal environment

Primer sequence Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

5 GATCCCTGGAGCCTGAATTAC3 5 CTCCTTTCTGTTGTCCTGTTCT3 5 TACAGTGGTGGCTTCTGTTATG3 5 GGTATGGAAGAGTCGACGTTATG3 5 CGAACAACAGAGGAGACAGATAA3 5 GGGACACAGTATGGCTTTGA3 5 GCCTTCTCCAATGACATCTTCT3 5 TAACGCAGCCACATCATACC3 5 GACTCGCAGCATCCCTAAAT3 5 GTGTCAGAGAAGTGGACGATATG3 5 CGCTAAATGCAACATCACCTATC3 5 TGGTGGGCAAAGCATACA3 5 GAACAAGTAGGGCCCTGTAATC3 5 GGGCAGAGCTTGATGTTATCT3 5 GAACTAGGGACCGTGCTTTAAT3 5 CAGAGCTCCCTTTGCTTTCT3 5 GCACCATCGAACCTCTGTATT3 5 CACTAGACCAAGGCGTTTCTT3 5 AGACATCAGGGTGTGATGGTTGGT3 5 TCCCAGTTGGTGACAATACCGTGT3

Table 3. Effect of heat stress on body weight gain, feed intake, and feed conversion ratio (FCR) of broilers Days

Heat Stress

Pr > F

Body weight gain (g) 14 to 26 552.4 ± 13.2a 26 to 33 617.4 ± 20.4a

426.8 ± 17.5b 350.3 ± 18.5b

0.0001 0.0001

Feed intake (g) 14 to 26 791.7 ± 31.5a 26 to 33 913.0 ± 25.7a

629.9 ± 19.6b 547.6 ± 4.44b

0.0006 0.0030

Feed conversion ratio (g/g) 14 to 26 1.43 ± 0.02 26 to 33 1.48 ± 0.02b

1.48 ± 0.03 1.56 ± 0.02a

0.1029 0.0140

a,b

Control

Means within rows with no common superscripts differ significantly.

from d 14 to 26. Similar trend was observed between d 26 and 33 where HS birds consumed 40% less feed and grew 43.3% less compared to the control group. The birds in the HS group consumed about 40% less amino acids than the birds in the control group. Although AID of amino acids was consistently 2% higher in the HS group, the differences were not statistically significant except for hydroxylysine. The AID of hydroxylysine was higher (P < 0.05) in the HS group than the control group (Table 4). The increase in AID of hydroxylysine in the HS group was 8% compared to the control group whereas the AID of the other amino acids increased by 0.5 to 4% under HS compared to the controls. Chickens exposed to HS had about 39% reduction in amino acids retention compared to the control group. Even though amino acids retention was higher than the control group; in general, amino acids retained per BWG were higher (P > 0.05) in the HS group compared to the controls (Table 5) except for hydroxylysine and ornithine. Heat stress and tissue type had statistically significant effects on the expression of some amino acid transporters. The results of amino acid transporter expression in the P. major and ileum are presented in Figures 1 and 2. The mRNA expression of LAT1

4

HABASHY ET AL.

Table 4. Apparent ileum digestibility of amino acid (%) by meat type chickens under heat stress1 Amino acid

Control ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

Methionine Lysine Cysteine Threonine Isoleucine Valine Tryptophan Arginine Leucine Glycine Proline Alanine Aspartic acid Glutamic acid Serine Tyrosine Phenylalanine Hydroxylysine2 Ornithine Histidine

95.42 93.28 81.31 87.70 89.18 89.53 90.83 93.14 89.71 87.62 87.16 89.60 88.07 91.84 88.67 89.42 89.43 82.74 74.37 89.67

Average

88.44 ± 1.11

1 2

Heat Stress

0.41 0.58 1.64 1.10 0.97 0.93 0.89 0.63 0.96 1.08 1.17 0.95 1.08 0.77 1.01 0.98 0.98 2.41 2.79 0.93

95.95 94.21 84.71 89.01 90.36 90.71 91.96 93.60 91.14 89.01 88.85 91.14 89.21 92.60 89.79 90.80 90.52 89.32 76.37 91.29

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.58 0.78 2.01 1.52 1.35 1.27 1.20 0.91 1.25 1.53 1.56 1.24 1.50 1.11 1.42 1.29 1.32 1.75 3.22 1.19

90.03 ± 1.40

P > 0.05 for all amino acids. P < 0.05.

Table 5. Amino acid retained per BWG (mg/g) by meat type chickens under heat stress1,2 Amino acid Methionine Lysine Cysteine Threonine Isoleucine Valine Tryptophan Arginine Leucine Glycine Proline Alanine Aspartic acid Glutamic acid Serine Tyrosine Phenylalanine Hydroxylysine Ornithine Histidine Average ∗ 1 2

Control 7.20 16.60 3.30 9.60 11.20 13.10 2.70 15.70 22.40 9.90 13.20 12.80 22.70 44.70 10.00 7.80 12.10 0.30 0.10 6.30 12.10

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.20 0.60 0.20 0.40 0.50 0.60 0.10 0.60 1.00 0.50 0.60 0.60 1.00 1.80 0.40 0.30 0.50 0.00 0.00 0.60 0.50

Heat Stress 7.70 17.80 3.70 10.50 11.90 14.10 2.90 16.80 24.30 10.80 14.50 13.90 24.60 48.10 10.90 8.50 13.10 0.30 0.10 6.80 13.10

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

Percent change∗

1.00 2.40 0.50 1.40 1.60 1.90 0.40 2.30 3.30 1.50 1.90 1.90 3.40 6.50 1.50 1.10 1.70 0.00 0.00 0.90 1.70

6.94 7.23 12.12 9.37 6.25 7.63 7.41 7.01 8.48 9.09 9.85 8.59 8.37 7.61 9.00 8.97 8.26 0.00 0.00 7.94 8.26

Percent change = [(Heat stress –Control)/control] ∗100. P > 0.05 for all amino acids. During 26 to 33 days.

transporter decreased in the ileum at d one and 12 after HS in the treatment group compared to the control group. However, expression of CAT1 transporter in the ileum decreased only at 12 d post HS. Across tissues, the mRNA expression was decreased in the P. major and increased in the ileum for LAT4 and SNAT1 transporters at d one and for SNAT1 transporter at d 12 after exposure to HS in the heat stress group compared to the control group. Similarly, the mRNA expression of B0 AT transporter was decreased in the P. major and ileum at d 12 post HS compared to the control group. Meanwhile this transporter was expressed higher in the

ileum at d one after exposure to HS than in the control group. The mRNA expression b0,+ AT transporter in the HS group was decreased at d one post HS in both tissues compared to controls. The SNAT2 transporter expression was decreased in the P. major at d one and in the ileum at d one and 12 post HS in the treatment group compared to the control. The SNAT7 and TAT1 transporter expressions were down-regulated at d one and 12 post HS in both tissues compared to the control group. Generally, the mRNA expression of amino acid transporters in the current study was down in the ileum at d 12 of HS except for LAT4 and TAT1 compared to the control group. The mRNA expression of B0 AT, SNAT7, and TAT1 transporters were downregulated in the P. major at d 12 post HS compared to the control group.

DISCUSSION The findings of this study revealed that HS significantly decreased growth by 34% and FI by 31%. Under HS, the FI is reduced, which leads to reduced intake of nutrients and thus limits growth (Geraert et al., 1996; Sohail et al., 2012; Diarra and Tabuaciri, 2014). The decrease in FI of the HS group also resulted in decreases in amino acid intake. However, reduced FI alone was found not to explain the entire effect of high temperature on growth (Temim et al., 1999). The reduction in FI may likely be due to the birds attempting to reduce the heat load within the body by limiting additional heat production resulting from increased digestion of feed (Etches et al., 2008). In the current study, HS had no effect on AID of amino acids. Other studies also have found no relationship between digestibility and HS, except for a few amino acids (Wallis and Balnav, 1984; Koelkebeck et al., 1998). The HS group incorporated more amino acids per unit growth than the control group, yet BWG was significantly reduced in the HS group. Heat stress leads to lower protein synthesis (Jacob, 1995) and increased protein degradation (Adomako et al., 2016). The higher amino acid incorporation into growth during heat stress may explain the reduced muscle protein turnover observed by Temim et al. (2000b) when they subjected birds to HS. This may suggest that increasing the proteinogenic amino acid concentration in diets during HS could mitigate some of the effects of HS on growth. This result may suggest a decrease in protein synthesis or an increase in catabolic rate. The proportional incorporation of cysteine into growth was highest among all the amino acids under heat stress. Cysteine is a major component of glutathione (GSH), the major antioxidant in the body. Heat stress leads to oxidative stress (Lin et al., 2006; Azad et al., 2010) and GSH mitigates the effects of HS. It is plausible that under HS, the need for GSH increases thereby leading to a higher incorporation of cysteine into tissues. Cysteine is considered to be a non-essential amino acid. Perhaps under HS, the increased need for GSH could render cysteine

5

(A)

(B)

Figure 1. mRNA expression of amino acid transporters in ileum (A) and Pectoralis major (B) tissues of broilers after one-day exposure to heat stress.

essential. Cysteine is derived from methionine through the transsulfuration pathway; therefore, under HS, the dietary concentration of methionine could be increased in an attempt to increase tissue cysteine levels. The changes in the expression of amino acid transporters in the intestine and P. major may explain the reduction in feed efficiency and BWG in heat stressed chickens. Exposure to HS leads to up-regulation of B0 AT and LAT4 and down-regulation of LAT1 expression in the ileum at d one post HS compared to the control group. LAT4 and LAT1 transporters are expressed in the basolateral membrane, whereas the B0 AT is ex-

pressed in the apical membrane (Stevens, 2010). In the apical membrane, the B0 AT (SLC6A19) is involved in low affinity and Na+ independent transport of neutral amino acids in the intestine and kidney (Br¨ oer, 2008). In the current study we observed that after one d of exposure to HS, the birds increased their intake of neutral amino acids. The b0,+ AT (SLC7A9) transporter is another Na+ independent transporter of neutral amino acids (Hyde et al., 2003) but is involved in high affinity transport (Stevens, 2010). This transporter was downregulated in the ileum after one d of HS and this may have reduced the influx of neutral amino acids.

6

HABASHY ET AL.

(A)

(B)

Figure 2. mRNA expression of amino acid transporters in ileum (A) and Pectoralis major (B) tissues of broilers after 12-day exposure to heat stress.

In the basolateral membrane, LAT1 (SLC7A5) mediates the transport of hydrophobic amino acids (Su et al., 2015). This transporter was down-regulated in the ileum at d one and 12 post HS compared to the control group. These results suggest that under HS, birds reduce the influx of hydrophobic amino acids. LAT4 (SLC43A2) mediates the transport of phenylalanine, leucine, isoleucine, and methionine with low affin-

ity contributing to efflux of amino acids after their luminal uptake from the intestinal lumen (Kanai et al., 1998; Bodoy et al., 2005; Br¨ oer, 2008; Guetg et al., 2015). This transporter is up-regulated in the ileum and down-regulated in the P. major at d one post HS. The T system amino acid transporter TAT1 (SLC16 A10) was down-regulated in the P. major and ileum at d one post HS. TAT1 plays a vital role in transport

7 of aromatic amino acids (phenylalanine, tyrosine, and tryptophan). This result suggests that the birds under HS possibly maintained homeostasis by downregulating TAT1. Ramadan et al. (2006) reported that aromatic amino acids effluxing through TAT1 can be recycled by LAT1-4F2hc through the diffusion of other intracellular neutral amino acids. Therefore, after one d post HS, mRNA expression levels of LAT1 and TAT1 suggest that the birds try to maintain the balance of aromatic amino acids between ileum cells. At d one post HS the amino acid transporters SNAT2 (SLC38A2) and SNAT7 (SLC38A7) were downregulated in the ileum and P. major; meanwhile, SNAT1 (SLC38A1) was down-regulated only in the P. major. It has been reported that glutamine is a preferable substrate throughout the SLC38 gene family (Mackenzie and Erickson, 2004). Glutamine is an important amino acid for providing fuel for metabolism, regulating cell proliferation, and maintaining the gut barrier functions (Young and Ajami, 2001). Glutamine deprivation leads to villous atrophy and cell necrosis in the intestines (Labow and Souba, 2004); therefore, decreased intake of glutamine under the HS groups as a result of reduced SNAT1,2,7 expression could potentially lead to villi atrophy and reduced growth. Similarly, at d 12, mRNA expression of the LAT1, SNAT1, SNAT2, and SNAT7 transporter genes was decreased and that of LAT4 transporter gene was increased. Meanwhile, the mRNA expression of B0 AT (SLC6A19) transporter gene was decreased. These could explain the reason for the reduction of amino acid intake under HS in the current study. Additionally, the mRNA expression of the CAT1 transporter gene was decreased after 12 d post HS. CAT1 is a cationic amino acid transporter and is sodium independent (Hyde et al., 2003). Fernandez et al. (2001) reported that the cationic amino acid transporter CAT1 promotes arginine and lysine uptake. In the current study we show that HS can decrease mRNA expression of CAT1 in the ileum after 12 days. This decrease may explain the decrease in uptake of cationic amino acids under HS. Similar to d one post HS, the mRNA expression of SNAT7 and TAT1 transporters was decreased in the P. major at d 12. Meanwhile, the expression of the SNAT1 transporter gene was increased, which may be an attempt by the birds under HS to maintain glutamine homeostasis.

CONCLUSION Subjecting broiler chickens to HS reduces growth due to reduction in feed and amino acid intake. However, broiler chickens tend to maintain the same amino acid digestibility and to channel more amino acids into growth than their counterparts raised under recommended temperatures. Heat stress changes the dynamics of amino acid transporters in the P. major muscle and the ileum. Heat stress after 12 d affects the cationic amino acid metabolism, which is explained by decreased

mRNA expression of cationic amino acid transporters. Heat stress may lead to reduced protein deposition in the muscles through down-regulation of the SNAT family. However, since AID of amino acids is similar between heat-stressed birds and birds raised in a thermoneutral environment, proteinogenic amino acid concentration could be increased in the diet to promote protein synthesis and reduce protein turnover when birds are under heat stress.

ACKNOWLEDGMENTS Walid Habashy was supported by the Missions sector of the Egyptian Ministry of Higher Education. Kwaku Adomako was supported by Borlaug Fellowship (USDA).

REFERENCE Adomako, K., W. S. Habashy, M. Milfort, A. Fuller, R. Rekaya, and S. E. Aggrey. 2016. Transcriptome analysis of genes in the protein biosynthesis and ubiquitin-proteosome pathways in meat-type chickens under heat stress. Proc. 25th World’s Poultry Congress, Beijing, China. 4– 0011. (Abstr.). AOAC. 2000. Official methods of analysis. 17th ed. Assoc. Off. Anal. Chem., Arlington. Azad, M. A. K., M. Kikusato, T. Maekawa, H. Shirakawa, and M. Toyomizu. 2010. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Physiol. Part A. Mol. Integr. Physiol. 155:401–406. Bodoy, S., L. Mart´ıns, A. Zorzano, M. Palac´ın, R. Est´evez, and J. Bertran. 2005. Identification of LAT4, a novel amino acid transporter with system L activity. J. Biol. Chem. 280:12002–12011. Bonnet, S., P. A. Geraert, M. Lessire, B. Carre, and S. Guillaumin. 1997. Effect of high ambient temperature on feed digestibility in broilers. Poult. Sci. 76:857–863. Br¨ oer, S. 2008. Amino acid transport across mammalian intestinal and renal epithelia. Physiol. Rev. 88:249–286. Cahaner, A. 2008. Breeding fast-growing, high-yield broilers for hot conditions. Page 31 in Poultry Production in Hot Climates. N. J. Daghir, ed. CABI, Cambridge. De Souza, L. F. A., L. P. Espinha, E. A. De Almeida, R. Lunedo, R. L. Furlan, and M. Macari. 2016. How heat stress (continuous or cyclical) interferes with nutrient digestibility, energy and nitrogen balances and performance in broilers. Livest. Sci. 192:39–43. Diarra, S. S., and P. Tabuaciri. 2014. Feeding management of poultry in high environmental temperatures. Int. J. Poult. Sci. 13:657– 661. Dickinson, J. M., and B. B. Rasmussen. 2013. Amino acid transporters in the regulation of human skeletal muscle protein metabolism. Curr. Opin. Clin. Nutr. Metab. Care. 16:638–644. Dickinson, J. M., C. S. Fry, M. J. Drummond, D. M. Gundermann, D. K. Walker, E. L. Glynn, K. L. Timmerman, S. Dhanani, E. Volpi, and B. B. Rasmussen. 2011. Mammalian target of rapamycin complex 1 activation is required for the stimulation of human skeletal muscle protein synthesis by essential amino acids. J. Nutr. 141:856–862. Edwards, H. M., Jr., and M. B. Gillis. 1959. A chromic oxide balance methods for determining phosphate availability. Poult. Sci. 38:569–574 Etches, R. J., T. M. John, and A. M. V. Gibbins. 2008. Behavioural, physiological, neuroendocrine and molecular responses to heat stress. Page 53 in Poultry Production in Hot Climates. N. J. Daghir, ed. CABI, Cambridge. Fernandez, J., I. Yaman, R. Mishra, W. C. Merrick, M. D. Snider, W. H. Lamers, and M. Hatzoglou. 2001. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability. J. Biol. Chem. 276:12285–12291.

8

HABASHY ET AL.

Ferrer, C., E. Pedragosa, M. Torras-Llort, X. Parcerisa, M. Rafecas, R. Ferrer, C. Amat, and M. Moret´ o. 2003. Dietary lipids modify brush border membrane composition and nutrient transport in chicken small intestine. J. Nutr. 133:1147–1153 Fujita, S., H. C. Dreyer, M. J. Drummond, E. L. Glynn, J. G. Cadenas, F. Yoshizawa, E. Volpi, and B. B. Rasmussen. 2007. Nutrient signalling in the regulation of human muscle protein synthesis. J. Physiol. 582:813–823. Geraert, P. A., J. C. F. Padilha, and S. Guillaumin. 1996. Metabolic and endocrine changes induced by chronic heat exposure in broiler chickens: Growth performance, body composition and energy retention. The Br. J. Nut. 75:195–204. Guetg, A., L. Mariotta, L. Bock, B. Herzog, R. Fingerhut, S. M. Camargo, and F. Verrey. 2015. Essential amino acid transporter Lat4 (Slc43a2) is required for mouse development. J. Physiol. 593:1273–1289. Hyde, R., P. M. Taylor, and H. S. Hundal. 2003. Amino acid transporters: Roles in amino acid sensing and signalling in animal cells. Biochem. J. 373:1–18. Jacob, S. T. 1995. Regulation of ribosomal gene transcription. Biochem. J. 306:617–626. Kanai, Y., H. Segawa, K. I. Miyamoto, H. Uchino, E. Takeda, and H. Endou. 1998. Expression cloning and characterization of a transporter for large neutral amino acids activated by the heavy chain of 4F2 antigen (CD98). J. Biol. Chem. 273: 23629–23632. Koelkebeck, K. W., C. M. Parsons, and X. Wang. 1998. Effect of acute heat stress on amino acid digestibility in laying hens. Poult. Sci. 77:1393–1396. Labow, B. I., and W. W. Souba. 2004. Glutamine. World J. Surg. 24:1503–1513. Lin, H., E. Decuypere, and J. Buyse. 2006. Acute heat stress induces oxidative stress in broiler chickens. Comp. Biochem. Physiol., Part A. 144:11–17. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25:402–408. Mackenzie, B., and J. D. Erickson. 2004. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family. Pflugers Arch. 447:784–795. Mott, C. R., P. B. Siegel, K. E. Webb, Jr., and E. A. Wong. 2008. Gene expression of nutrient transporters in the small intestine of chickens from lines divergently selected for high or low juvenile body weight. Poult. Sci. 87:2215–2224. Ramadan, T., S. M. Camargo, V. Summa, P. Hunziker, S. Chesnov, K. M. Pos, and F. Verrey. 2006. Basolateral aromatic amino acid transporter TAT1 (Slc16a10) functions as an efflux pathway. J. Cell Physiol. 206:771–779. SAS. 2011. SAS/SAT user guide SAS Inst. Inc., USA. Shepherd, E. J., P. A. Helliwell, O. J. Mace, E. L. Morgan, N. Patel, and G. L. Kellett. 2004. Stress and glucocorticoid inhibit apical Glut2-trafficking and intestinal glucose absorption in rat small intestine. J. Physiol. 560:281–290.

Sohail, M. U., M. E. Hume, J. A. Byrd, D. J. Nisbet, A. Ijaz, A. Sohail, M. Z. Shabbir, and H. Rehman. 2012. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress. Poult. Sci. 91:2235–2240. Soleimani, A. F., A. Meimandipour, K. Azhar, M. Ebrahimi, and I. Zulkifli. 2010. Effects of heat exposure and sex on ileal digestibility of amino acids of soybean meal in broiler chickens. Arch. Gefl¨ ugelk. 74:249–255. Song, Z., L. Liu, A. Sheikhahmadi, H. Jiao, and H. Lin. 2012. Effect of heat exposure on gene expression of feed intake regulatory peptides in laying hens. J Biomed. Biotechnol. doi:10.1155/2012/484869. Stevens, B. R. 2010. Amino acid transport by epithelial membranes. Pages 353–378 in Epithelial Transport Physiology. G. A. Gerencser, ed. Humana Press, New York. Su, S., K. B. Miska, R. H. Fetterer, M. C. Jenkins, and E. A. Wong. 2015. Expression of digestive enzymes and nutrient transporters in Eimeria-challenged broilers. Exper. Para. 150:13–21. Sun, X., H. Zhang, A. Sheikhahmadi, Y. Wang, H. Jiao, H. Lin, and Z. Song. 2015. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus domesticus). Int. J. Biometeorol. 59:127–135. Suryawan, A., A. S. Jeyapalan, R. A. Orellana, F. A. Wilson, H. V. Nguyen, and T. A. Davis. 2008. Leucine stimulates protein synthesis in skeletal muscle of neonatal pigs by enhancing mTORC1 activation. Am. J. Physiol. Endocrinol. Metab. 295:868–875. Temim, S., A. M Chagneau, R. Peresson, and S. Tesseraud. 2000b. Chronic heat exposure alters protein turnover of three different skeletal muscles in finishing broiler chickens fed 20 or 25% protein diets. J. Nutr. 130:813–819. Temim, S., A. M. Chagneau, S. Guillaumin, J. Michel, R. Peresson, P. A. Geraert, and S. Tesseraud. 1999. Effects of chronic heat exposure and protein intake on growth performance, nitrogen retention and muscle development in broiler chickens. Reprod. Nutr. Dev. 39:145–156. Temim, S., A. M. Chagneau, S. Guillaumin, J. Mitchel, R. Peresson, and S. Tesseraud. 2000a. Does excess dietary protein improve growth performance and carcass characteristics in heat exposed chickens? Poult. Sci. 79:312–317. Tsukada, F., K. Sawamura, H. Kohno, and Y. Ohkubo. 2002. Mechanism of inhibition of small intestinal motility by restraint stress differs from that with norepinephrine treatment in rats. Biol. Pharm. Bull. 25:122–124. Wallis, I. R., and D. Balnave. 1984. The influence of environmental temperature, age and sex on the digestibility of amino acids in growing broiler chickens. Br. Poult. Sci. 25:401–407. Young, V. R., and A. M. Ajami. 2001. Glutamine: The emperor or his clothes? J. Nutr. 13l:2449–2459. Zuprizal, M. L., A. M. Chagneau, and P. A. Geraert. 1993. Influence of ambient temperature on true digestibility of protein and amino acids of rapeseed and soybean meals in broilers. Poult. Sci. 72:289–295.