Effect of long-term human exposure to environmental heavy metals on the expression of detoxification and DNA repair genes

Environmental Pollution 181 (2013) 226e232

Contents lists available at SciVerse ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Effect of long-term human exposure to environmental heavy metals on the expression of detoxification and DNA repair genes Saleh A. Al Bakheet a, Ibraheem M. Attafi a, Zaid H. Maayah a, Adel R. Abd-Allah a, Yousif A. Asiri b, Hesham M. Korashy a, * a b

Department of Pharmacology & Toxicology, College of Pharmacy, King Saud University, P.O. Box 2457, Riyadh 11451, Saudi Arabia Department of Clinical Pharmacy, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 January 2013 Received in revised form 6 June 2013 Accepted 7 June 2013

The present study was designed to evaluate the influence of long-term environmental human exposure to three heavy metals, lead (Pb), cadmium (Cd), and mercury (Hg), on the expression of detoxifying, xenobiotic metabolizing, and DNA repair genes in Mahd Ad-Dahab city. The study groups consisted of 40 healthy male residents (heavy metal-exposed) and 20 healthy male from Riyadh city, 700 km away, and served as control group. The heavy metal-exposed group with high exposure to Pb, Cd, or Hg was divided into three subgroups Pb-, Cd-, and Hg-exposed groups, respectively. The mRNA expression levels of detoxifying, NQO1, HO-1, GSTA1, MT-1, and HSP70, were significantly decreased in all heavy metalexposed group as compared to control group. This was accompanied with a proportional decrease in the expression of xenobiotic metabolizing gene, cytochrome P4501A1. On the other hand, the DNA repair gene OGG1 and the 8-OHdG level were dramatically inhibited in Cd-exposed group only. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Cadmium DNA adduct Mercury Mining activity Lead

1. Introduction Living around polluted areas is one of the most common sources of exposure to environmental toxicants. Of these toxicants, heavy metals are widely used in foundries, mining, and manufacturing industries. Once heavy metals accumulate in the ecosystem components, such as air, soil, and water, the risk of human exposure increases among industrial workers as well as the people who live near polluted areas (Li et al., 2006; Mazej et al., 2010; Qiao et al., 2011; Quandt et al., 2010). Heavy metals adversely affect a variety of body systems such as the cardiovascular, the respiratory, the endocrine, the immune, and the reproductive systems (Jarup, 2003; Wirth and Mijal, 2010). In addition, long-term exposure and accumulation of heavy metals in the body may disturb oxidative stress genes and thus increase the susceptibility to various diseases. Among heavy metals, lead (Pb), cadmium (Cd), and mercury (Hg) are the most commonly encountered toxic substances according to the Agency for Toxic Substances and Disease Registry (ATSDR, 2011) and the Canadian Environmental Protection Act Registry (CEPA, 2012). Several previous environmental heavy metal toxicities have been reported before. For example, In Japan, two

* Corresponding author. E-mail address: [email protected] (H.M. Korashy). 0269-7491/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.envpol.2013.06.014

outbreaks of acute poisoning with Hg were reported in Niigata and Minamata due to ingestion of fish heavily contaminated with industrial discharge of Hg (Eto et al., 2010). In addition, consumption of Cd-contaminated rice from the area nearby mining industry in Japan caused ItaieItai disease (Kobayashi et al., 2009). In Saudi Arabia, a recent massive pollution of heavy metals was reported in Mahd Ad-Dahab Gold mine, about 700 km away from the capital Riyadh city. Previous studies in Mahd Ad-Dahab city have reported a significant contamination with more than thirteen heavy metals in the soils and plants collected from different regions nearby the mining activities, where the concentrations of Pb, Cd, and Hg were the highest (Al-Farraj and Al-Wabel, 2007a, 2007b). Unfortunately, studies on human contamination with heavy metals are lacking. Importantly, unpublished data from Mahd Ad-Dahab Hospital Medical Records have also reported an increase in the incidence of several diseases such as asthma, renal failure, and teratogenicity. Heavy metals are considered as potential toxicants, which are capable of disrupting the activity of a number of prominent proteins as well as altering the expression patterns of numerous genes, thereby interfere with multiple cellular events leading to increased susceptibility to several diseases (Ademuyiwa et al., 2010; Kakkar and Jaffery, 2005; Zawia et al., 1998). For example, human exposure to Pb increased heme oxygenase-1 (HO-1) gene in renal tubule cells and also increased the urinary excretion of alpha-glutathione

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

S-transferase (GSTA1), both are considered as detoxifying genes (Garcon et al., 2004; Vargas et al., 2003). Whereas, the alteration of renal HO-1 expression and increased renal generation of hydrogen peroxide by Hg cause renal injury (Nath et al., 1996). Furthermore, Cd, a well-known human carcinogen, inhibits the DNA repair genes (Joseph, 2009; Shin et al., 2004) such as 8-oxoguanine DNAglycosylase 1 (OGG1) that is involved in the excision repair of 8hydroxy-20 -deoxyguanosine (8-OHdG), a biomarker for DNA damage (Chevillard et al., 1998). In the light of information described above, residents of Mahd Ad-Dahab city face immediate environmental impact of heavy metals pollution, however, no single study in the available literature has addressed the impact of heavy metal contamination to human. Therefore, the present study was conducted to investigate the potential effect of environmental exposure of human subjects to heavy metals in Mahad Ad-Dahab region and its impact on gene expression profiling.

227

2.5. RNA isolation and purification

2. Material and methods

The total RNA was extracted from blood using the PAXgene Blood RNA Kit for isolation and purification according to the manufacturer’s instructions (PreAnalytiX, Qiagen). Briefly, approximately 2.5 ml of peripheral blood sample from each volunteer was collected in PAXgeneÒ Blood RNA tubes (PreAnalytiX, Qiagen), gently inverted and then incubated for two hours at room temperature (25  C), and thereafter stored at 80  C until analysis (Chai et al., 2005). Thawed PAXgene tubes were centrifuged for 10 min at 3000  g and the cell pellets were suspended in 4 ml of RNase-free water followed by centrifugation for 10 min at 3000  g. The cell pellets were suspended in 350 ml of suspension buffer, and then incubated with mixture of 300 ml of binding buffer and 40 ml of proteinase K for 10 min at 55  C while shaking at 400 rpm. The resultant lysate was centrifuged for 3 min using a PAXgeneÔ Shredder spin column at 16,300  g, and the supernatant was then added to 350 ml of 100% ethanol, mixed and applied to a PAXgeneÔ RNA spin column and then centrifuged for 1 min at 16,300  g. Thereafter, 350 ml of wash buffer was added to the PAXgeneÔ RNA spin column and centrifuged for one minute at 16,300  g. Approximately, a 500-ml wash buffer was added to the PAXgeneÔ RNA spin column and centrifuged for one and four minutes (16,300  g) and the purified RNA was eluted by elution buffer. Finally, all eluted RNA was then denatured by incubation at 65  C for five minutes, then chilled on iced and stored at 20  C for gene expression study (Kennedy et al., 2008). The RNA quantity and quality were determined by NanoDrop 8000 (Thermo Scientific).

2.1. Study population

2.6. cDNA synthesis

The study population composed of two groups; heavy metal-exposed group that included 40 healthy adult male volunteers who are residents of Mahd Ad-Dahab city and control (non-exposed) group which included 20 healthy male volunteers from Riyadh city, 700 km far away from Mahd Ad-Dahab city. All volunteers were ranged in age from 20 to 40 years and were resident in Mahd Ad-Dahab or Riyadh city for more than three consecutive years. Exclusion criteria included the presence of any acute and chronic diseases, use of anticoagulants, abnormal blood profile or blood disorders, and smoking.

First strand cDNA synthesis was performed according to the manufacturer’s instructions by using the High-Capacity cDNA reverse transcription kit (Applied BiosystemsÒ) and as described before (Korashy et al., 2011). Briefly, a volume equivalent to 1 mg of total RNA from each sample was added to a mixture of 2.0 ml of 10 reverse transcriptase buffer, 2.0 ml of 10 reverse transcriptase random primers, 1.0 ml of MultiScribe reverse transcriptase, 0.8 ml of 25 dNTP mix (100 mM), and 4.2 ml of RNase-free water. The final reaction mixture (20 ml) was kept at 25  C for 10 min, heated to 37  C for 120 min, then to 85  C for 5 min, and finally cooled to 4  C, using VeritiÒ Thermal cycler (Applied BiosystemsÒ).

2.2. Ethical consideration and consent form 2.7. Quantitative real-time polymerase chain reaction (RT-PCR) analysis A questionnaire and consent form was created according to the International Union of Pure and Applied Chemistry commission (IUPAC) (Cornelis et al., 1996). The study was approved by the Mahd Ad-Dahab Hospital Ethics Committee. The questionnaire provided the volunteers with information about the aims of study and the potential outcomes. In addition, the questionnaire gathered information about volunteers demographic data (age, job, body weight, and the residence time in the study area), lifestyle habits (smoking, eating habits, and source of drinking water), and health status (medical problem, medication chronically or recently used, and surgical history). All volunteers filled the questionnaires and signed the consent forms just before participating in the study. 2.3. Determination of the blood levels of Pb, Cd, and Hg in human volunteers The blood levels of Pd and Cd were determined using Inductive Coupled PlasmaMass Spectrometry method (ICP-MS; Agilent 4500, Agilent Technologies, CA) as described previously (Bazzi et al., 2008). Briefly, approximately 1 ml of blood samples was mixed with 2 ml of concentrated nitric acid (Optima grade, Fisher Scientific) and 0.01% TritonX-100 for three hours at room temperature, thereafter diluted with high-grade Milli-Q water to a 10 ml volume. The mixtures were then ionized by ICP-MS, and the extracted ions were separated according to their mass to charge ratios (m/z) as follows; Cd (m/z ¼ 111), Pb (m/z ¼ 208), and the internal standard Rhodium (Rh) (m/z ¼ 103). For each metal, the analytical detection limit was calculated as the concentration of the metal, which gave a detectable signal above the background noise at greater than the 99% confidence level (Goulle et al., 2005). On the other hand, Hg blood levels were determined by the Direct Mercury Analyzer (DMA; Milestone Inc., CT) according to U.S. EPA accredited methods (Method 7473) as previously described (Alicia et al., 2011). Briefly, 500 ml of blood sample in a quartz boat was introduced into the instrument decomposition furnace, in which Hg vapor liberated from the sample and carried to an absorbance cell by oxygen. The absorbance was measured at 253.65 nm as a function of Hg concentration. The blood concentrations of the three heavy metals were expressed as mg/l. 2.4. Determination of hematological profiles The hematological profiles of all volunteers were measured using a fully automatic blood cell counter Model PCE 210 N (ERMA INC, Japan). Briefly, fresh whole blood was collected by standardized venipuncture in EDTA tubes from all volunteers. The hematological profiles, including hemoglobin, red blood cell (RBC), white blood cell (WBC), lymphocytes and monocytes, mean corpuscular volume (MCV), mean cell hemoglobin (MCH), red cell distribution width (RDW), and platelet counts were measured according to the standard operating manual.

Quantitative mRNA expression was determined by RT-PCR by subjecting the resulting cDNA to PCR amplification in the ABI Prism 7500 System (Applied BiosystemsÒ) using 96-well optical reaction plates (Korashy et al., 2012). The 25-ml reaction mix contained 0.1 ml of 10 mM forward primer and 0.1 ml of 10 mM reverse primer (40 nM final concentration of each primer), 12.5 ml of SYBR Green Universal Mastermix, 11.05 ml of nuclease-free water, and 1.25 ml of cDNA sample. The primers used in the current study, which were chosen from previously published studies (Janik et al., 2011; Liu et al., 2012, 2007; Rushworth et al., 2008; Yoon et al., 2011; Zhang et al., 2011), included “NAD(P)H:quinone oxidoreductase 1 (NQO1), HO-1, metallothionein 1 (MT-1), GSTA1, catalase (CAT), heat shock protein 70 (HSP70), Cytochrome P4501A1 (CYP1A1), CYP2E1, CYP3A4, OGG1, Apurimac/Apyrimidinic endonuclease 1 (APE1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)” (Table 1). Assay controls were incorporated onto the same plate, namely, notemplate controls to test for the contamination of any assay reagents. The realtime PCR data were analyzed by using the relative gene expression (i.e., DDCT) method and the data are presented as the fold change in gene expression after being normalized to the endogenous reference gene GAPDH (Livak and Schmittgen, 2001). 2.8. Measurement of 8-hydroxy-2-deoxyguanosine (8-OHdG) level The level of 8-OHdG in the plasma of all volunteers was determined using established ELISA methods according to the manufacture’s protocol (Abcam Ltd., 330

Table 1 Primers sequences used for Real-Time PCR reactions. Gene

50 / 30 Forward primer

50 / 30 Reverse primer

GAPDH NQO1 HO-1 MT1 GSTA1 CAT HSP70 CYP1A1 CYP2E1 CYP3A4 OGG1 APE1

CCATGGCACCGTCAAGGCTGA CGCAGACCTTGTGATATTCCAG ATGGCCTCCCTGTACGACATC CTCGAAATGGACCCCAACTG TTGATGTTCCAGCAAGTGCC GATAGCCTTCGACCCAAGCA ACCAAGCAGACGCAGATCTTC CTATCTGGGCTGGGCAA ACCTGCCCCATGAAGCAACC GGGAAGCAGAGACAGGCAAG CCCCACGTCTCATGTTG AGCCTTTCGCAAGTTCCTGA

GCCAGTAGAGGCAGGGATGAT CGTTTCTTCCATCCTTCCAGG TGTTGCGCTCAATCTCCTCCT CAGCCCTGGGCACACTTG CACCAGCTTCATCCCATCAAT ATGGCGGTGAGTGTCAGGAT CGCCCTCGTACACCTGGAT CTGGCTCAAGCACAACTTGG GAAACAACTCCATGCGAGCC GAGCGTTTCATTCACCACCA CCATCCTTAGCGCTGTCC GCGTGAAGCCAGCATTCTTT

228

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

Cambridge Science Park, Cambridge CB4 0FL, UK). The plasma samples were separated by centrifugation for 10 min at 5000  g. Thereafter, 50 ml of the plasma sample was transferred to a 96-well plate, and then incubated for 18 h at 4  C. The plate was rinsed five times with wash buffer followed by the addition of 200 ml of freshly prepared Ellman’s Reagent and 5 ml of tracer to each well. The plate was then developed in the dark room for two hours at wavelength 412 nm. 2.9. Statistical analysis The significance of the differences between the means of controls and exposed groups was analyzed by unpaired Student t-test using the Graph Pad Prism 5 Software package for WindowsÒ. The median values of blood Pb, Cd, and Hg levels were used as a cutoff. The significance of correlations between parameters was determined by Spearman’s rank correlation coefficient and simple or multiple regression analyses. One-way analysis of variance (ANOVA) was used to assess which exposed groups showed a significant difference from the control group followed by a Dunnett multiple comparison test. Statistical significance was defined as a p-value of <0.05.

3. Results 3.1. Demographic data The demographic characteristic of the study volunteers is summarized in Table 2. Approximately, 50% of all volunteers in both groups were in the age range of 28e35 years old. Among heavy metal-exposed volunteers, 85% were residents of Mahd Ad-Dahab city for more than 7 years. Most of the control and exposed volunteers (88%) eat meat, whereas only 20% of control and 12% of exposed group eat fish. Importantly, 75% of heavy metal-exposed volunteers used ground water as a source of drinking water compared to 0% of the control volunteers, who used only bottled water. In addition, all participants were non-smokers. 3.2. Blood concentrations of heavy metals To investigate whether long-term exposure to heavy metals is associated with increased their blood concentrations, the blood levels of Pb, Cd, and Hg were determined using ICP-MS and DMA, respectively. Our results showed that blood concentrations of Pb, Cd, and Hg were significantly higher among heavy metals-exposed volunteers compared with controls. For example, mean Pb

Table 2 Demographic characteristics of the study volunteers. Variables Age 20e27 years 28e35 years 36e43 years Residence time 3e6 years 7e10 years 11 years Workplace Office Classroom Military Hospital Dietary habits Vegetarian Fish consumption Meat diet Drinking water (source) Bottled water Ground water Smoking status Nonsmokers Passive smoker

Control volunteers (N ¼ 20)

Heavy metal-exposed volunteers (N ¼ 40)

8 (40%) 10 (50%) 2 (10%)

11 (27.5%) 20 (50%) 9 (22.5%)

6 (30%) 11 (55%) 3 (15%)

6 (15%) 19 (47.5%) 15 (37.5%)

3 16 0 1

5 15 8 12

(15%) (80%) (0%) (5%)

(12.5%) (37.5%) (20%) (30%)

0 (0%) 4 (20%) 16 (80%)

0 (0%) 5 (12.5%) 35 (87.5%)

20 (100%) 0 (0%)

10 (25%) 30 (75%)

10 (50%) 10 (50%)

21 (52.5%) 19 (47.5%)

concentration in heavy metal-exposed volunteers was 2-fold higher than the control. On the other hand, Cd and Hg blood concentration levels were 25% and 22% higher in heavy metal-exposed as compared to control, respectively. The cutoff points were determined according to median values (Pb, 16.74 mg/l; Cd, 2.12 mg/ l; Hg, 1.2 mg/l) of heavy metal concentrations among all exposed volunteers. Based on the median values, heavy metal-exposed volunteers were subdivided into three groups; Pb-, Cd-, or Hgexposed that showed highest levels of either Pb, Cd, or Hg, respectively (Table 3). 3.3. Correlation between blood concentrations of heavy metals and other variables To examine the effects of age, resident time, source of drinking water, and diet on blood heavy metal concentrations, regression analysis was conducted. The extent of heavy metals intoxication as reflected by the increase in heavy metals blood concentration was not significantly correlated with volunteers age, resident time, dietary habits, source of drinking water, and smoking (Table 4). With the exception of Pb-exposed volunteers, where increased Pb blood levels were highly correlated with residence time (Spearman r ¼ 0.34, p<0.05) and source of drinking water (Spearman r ¼ 0.35, p<0.05). 3.4. Effect of heavy metal exposure on hematological profile In order to correlate heavy metals exposure with hematological profiles, we determined the changes in blood components in both groups. Although, all hematological parameters were within the normal range, the level of RDW, RBC, hematocrit, WBC, and lymphocytes were significantly higher in the heavy metals-exposed group (p < 0.05) as compared to non-exposed volunteers (Table 5). Whereas, hemoglobin and platelets were significantly decreased in the heavy metal-exposed group as compared to control group. 3.5. Effect of heavy metal exposure on the expression profile of detoxifying genes To investigate whether exposure to heavy metals altered the expression levels of detoxifying genes, the mRNA expression levels of NQO1, HO-1, MT-1, GSTA1, CAT, and HSP70 in exposed and control volunteers were quantified using RT-PCR. Fig. 1 shows a significant inhibition in the mRNA expression levels of NQO1 (150%, 70%, and 80%), HO-1 (75%, 130%, and 70%), MT1 (66%, 100%, and 76%), and HSP70 (150%, 280%, and 120%) among Pb, Cd, and Hg exposed groups, respectively. Whereas, the GSTA1 mRNA level was significantly decreased among Cd- (50%) and Hg- (80%) but not Pbexposed group. Although no significant change in the expression

Table 3 Blood concentration levels of heavy metals. Heavy metals (mg/l) Lead (Pb) Mean  SEM Median Cadmium (Cd) Mean  SEM Median Mercury (Hg) Mean  SEM Median

Control volunteers (N ¼ 20)

Heavy metal-exposed volunteers (N ¼ 40)

11.22  0.62 11.00

21.00  2.51*** 16.74

1.93  0.028 1.96

2.485  0.237* 2.12

0.9869  0.043 1.00

1.221  0.059* 1.2

Unpaired student t-test ManneWhitney. *p < 0.05; **p < 0.01; ***p < 0.001.

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

229

Table 4 The correlation between blood heavy metals concentrations and variables. Variables Age 20e27 years 28e35 years 36e42 years Spearman r p-Value Residence time 3e6 years 7e10 years 11 years or more Spearman r p-Value Smoking habit Nonsmokers Passive smokers Spearman r p-Value Water source Bottled Ground Spearman r p-Value

Pb (mg/l)

Cd (mg/l)

Hg (mg/l)

26.57  6.659 17.62  1.801 18.47  2.747 0.17 0.336

1.614  0.1403 1.72  0.1914 2.2  0.2509 0.22 0.187

1.649  0.1504 1.75  0.1542 2.32  0.3091 0.22 0.187

12.53  4.004 22.30  4.558 21.39  3.138 0.34 0.045*

1.720  0.3359 1.903  0.2492 1.861  0.1889 0.11 0.497

1.077  0.1286 1.111  0.07677 1.198  0.1114 0.08 0.641

18.36  2.111 19.55  4.848 0.10 0.556

1.665  0.1044 2.098  0.2880 0.17 0.282

1.154  0.09241 1.120  0.06401 0.04 0.807

13.808  1.421 20.583  3.029 0.35 0.035*

1.864  0.1973 1.858  0.1818 0.10 0.528

1.116  0.1222 1.056  0.0817 0.07 0.659

Spearman Rank Correlation. All data expressed as Mean  SEM. Notes: *p < 0.05.

level of CAT mRNA was demonstrated among Pb- and Hg-exposed groups, a significant decrease (200%) was observed among Cdexposed group compared with the control group (Fig. 1). 3.6. Effect of heavy metal exposure on the expression profile of xenobiotic metabolizing genes To investigate whether exposure to heavy metals altered the expression levels of xenobiotic metabolizing genes, the mRNA levels of CYP1A1, CYP2E1, and CYP3A4 were quantified using RTPCR. Fig. 2 shows a significant inhibition in CYP1A1 mRNA level by approximately 280%, 130%, and 100% in Pb-, Cd-, and Hgexposed groups, respectively. Whereas, no significant changes in the mRNA expression levels of CYP2E1 and CYP3A4 were observed. 3.7. Effect of heavy metal exposure on the expression profile of DNA repair genes To examine whether exposure to heavy metals altered the expression of DNA repair genes, the mRNA levels of OGG1 and APE1 were quantified using RT-PCR. Our results showed that Pbexposed volunteers did not show any significant changes in the mRNA expression of DNA repair genes. However, long-term exposure to Cd and Hg was associated with a significant increase

Table 5 Hematological Profile. Parameters

Control volunteers (N ¼ 20)

Hemoglobin (g/dL) WBC (K/mL) RBC (M/mL) Hematocrit (%) Platelet (K/mL) Lymphocytes (%L) MCV (fL) MCH (pg) RDW (%)

16.7 5.4 5.08 40.60 316.8 1.4 80.38 30.63 14.03

        

0.3 0.37 0.19 1.16 12.1 0.31 0.88 2.26 0.376

Heavy metals volunteers (N ¼ 40) 14.87 7.83 5.74 46.22 265.7 2.85 81.02 26.66 28.56

        

0.6* 0.3*** 0.2* 1.07** 12.31* 0.18*** 2.67 1.3 4.73*

Normal values 12e18 4.1e10.9 4.2e6.3 37e51 140e440 0.6e4.1 80e97 26e32 11.5e14.5

All results are expressed as Mean  SEM. *p < 0.05; **p < 0.01; ***p < 0.001.

Fig. 1. Effect of long-term environmental exposure to Pb (A), Cd (B), and Hg (C) on the mRNA expression of detoxifying genes. Total RNA was extracted from blood using the PAXgene Blood RNA Kit, and the mRNA expression levels of target genes were quantified by RT-PCR. Duplicate reactions were performed for each experiment, and values are presented as means  SEM (N ¼ 6). *p < 0.05, **p < 0.01, ***p < 0.001 compared with control.

in OGG1 mRNA level (90%) and decrease in APE1 mRNA level (50%), respectively, as compared to non-exposed volunteers (Fig. 3). 3.8. Effect of heavy metal exposure on the plasma level of 8-OHdG To determine whether DNA repair gene expression alteration (Fig. 3) were associated with increased the oxidized DNA adduct formation, we measured the 8-OHdG levels in the plasma of all volunteers using an ELISA kit. As Fig. 4 shows, there is a significant increase in 8-OHdG plasma level by 50% in Cd-exposed group as compared with the control group, whereas no significant changes were demonstrated in both Pb- and Hg-exposed groups.

230

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

Fig. 2. The effect of long-term environmental exposure to Pb (A), Cd (B), and Hg (C) on the mRNA expression of xenobiotic metabolizing genes. Total RNA was extracted from blood using the PAXgene Blood RNA Kit, and the mRNA expression levels of target genes were quantified by RT-PCR. Duplicate reactions were performed for each experiment and values are presented as means  SEM (N ¼ 6). *p<0.05, **p<0.01, ***p<0.001 compared with control.

Fig. 3. The effects of long-term environmental exposure to Pb (A), Cd (B), and Hg (C) on the mRNA expression of DNA repair genes. Total RNA was extracted from blood using the PAXgene Blood RNA Kit and the mRNA expression levels of target genes were quantified by RT-PCR. Duplicate reactions were performed for each experiment and values are presented as means  SEM (N ¼ 6). *p<0.05 compared with control.

4. Discussion Environmental pollution poses a high risk of heavy metals exposure and thus individuals living near polluted areas are facing a significant heavy metals intoxications even at relatively low concentrations. Such toxicity results in genes expression alteration that may increase the susceptibility to various diseases (Benin et al., 1999; Hodgson et al., 2007; Jarup, 2003; Wang et al., 2010). Thus, the main objectives of the present study was to assess whether living near to heavy metal-polluted Mahad Ad-Dahab areas for a long-term could increase plasma heavy metals concentrations among populations, and to what extent this exposure could affect the expression of detoxifying, xenobiotic metabolizing, and DNA repair genes. In the current study, all heavy metal-exposed volunteers in Mahad Ad-Dahab city exhibited a significant increase in heavy

Fig. 4. The effect of long-term environmental exposure to Pb, Cd, and Hg on the level of 8-OHdG adduct formation. The level of 8-OHdG in the plasma of all volunteers was determined using ELISA kits. Values are presented as means  SEM (N ¼ 6). *p<0.05 compared with control.

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

metals (Pb, Hg, and Cd) blood concentrations as compared to the control. The increase in heavy metals concentrations in whole blood is considered as a biomarker for the long-term exposure (Barbosa et al., 2005) and reflects the body burden (Sakai et al., 2003). This heavy metal intoxication is probably attributed to inhalation of heavy metals transported by dust through the air, drinking water, or by consumption of contaminated food (Al-Farraj and Al-Wabel, 2007a, 2007b; Li et al., 2006). This is supported by the observation that the soils and plants in Mahad Ad-Dahab mine, are highly polluted with heavy metals, particularly Pb, Hg, and Cd (Al-Farraj and Al-Wabel, 2007a, 2007b). In addition, the high blood concentration level of Pb in exposed volunteers was significantly correlated with drinking of ground water. These results are in agreement with Al-Hobaib and co-workers who have reported elevated levels of heavy metals in ground water source (Al-Hobaib et al., 2013). In that, it has been reported that Pb concentrations in some ground water samples from Mahad Ad-Dahab mine were higher than the recommend maximum acceptable concentration (0.01 mg/l), according to the Guideline for Canadian Drinking Water Quality (Health Canada, 2012). Changes in hematological parameters are used as early biomarkers for heavy metals exposure. In this current study, all blood profile parameters studied were within the normal range, however the RDW levels were higher in heavy metal-exposed volunteers than in control group. The elevated RDW levels are usually associated with iron-deficiency anemia, decreased vitamin B12 or folic acid, inflammation, or impaired iron metabolism (Allen et al., 2010). In addition, a significant decrease in hemoglobin levels among heavy metals-exposed groups as compared to control group was also observed. These findings are consistent with previous studies, which showed that increased blood heavy metals levels were associated with decreased in the hemoglobin levels (Bersenyi et al., 2003; Hegazy et al., 2010; Tripathi et al., 2001; Yilmaz et al., 2012). Importantly, the elevation of heavy metals blood concentrations with changes in the hematological parameter were associated with significant inhibition of many detoxifying genes, such as NQO1, HO1, and GSTA1 mRNA levels. The inhibition of NQO1, HO1, and GSTA1, which are considered as a protective response to reverse the oxidative stress at molecular levels, may increase the susceptibility to several diseases (De Luca et al., 2011). This is because that NQO1 and HO-1 genes are known to play a protective role against different types of cancers (Li et al., 2011; Wakai et al., 2011; Yin et al., 2012) through counteracting the oxidative imbalance and reducing reactive oxygen species levels (Ferrando et al., 2011; Senthil Kumar et al., 2012). In addition, the inhibition at the expression level of GSTA1, an enzyme responsible for detoxification of carcinogens and environmental toxins, may increase the susceptibility to carcinogenesis and toxicity as well as the efficacy of some drugs (Coles and Kadlubar, 2005; Schwarz et al., 2004; Zordoky and El-Kadi, 2010). It is well known that exposure to heavy metals significantly modulate the expression of xenobiotic metabolizing enzymes in different species and cell lines (Korashy and El-Kadi, 2004). In the current study, significant inhibition of CYP1A1, but not CYP2E1 or CYP3A1, which involved in xenobiotic and endogenous metabolism, was observed by all heavy metals. In agreement with our observations, Uno et al. found that the toxicity of benzo[a]pyrene, an environmental toxicant, was increased in CYP1A1 knockout mice (Uno et al., 2001), suggesting that induction of CYP1A1 enzyme is important in the protection against benzo[a]pyrene toxicity (Uno et al., 2004). Taken together, the inhibition of CYP1A1 enzyme may increase the susceptibility to toxicity. Further studies are needed to confirm the changed in gene expression due to the effect of long-term environmental heavy metal’s exposure and combine evidence by epidemiological studies (Barrett et al., 1997).

231

Interestingly, Cd-exposed volunteers exhibited a higher incidence in DNA adduct formation as evidence by the increase in the mRNA expression level of OGG1 and 8-OHdG plasma as compared to control. This may result in genomic instability and hence susceptibility to different types of cancer (Beyersmann and Hartwig, 2008; Elbekai et al., 2007). In agreement with these observation, Kumar et al. (2012) have reported a proportional correlation between the expression of OGG1 mRNA and the 8-OHdG levels (Kumar et al., 2012). The present findings are consistent with previous studies, which showed that long-term exposure to Cd increased the level of 8-OHdG and DNA adduct (Filipic and Hei, 2004). In addition, a link between the 8-OHdG formation and the expression of OGG1 mRNA with Cd carcinogenesis has been observed in laryngeal cancer patients (Mahjabeen et al., 2012). On the other hand, the expression of APE1 was significantly inhibited among Hg-exposed volunteers, suggests a heavy-metal specific effect. The results were consistent with previous finding of inhibition of APE1 activity was associated with heavy-metal exposure (McNeill et al., 2004). To our knowledge, the present study is the first that addressed the influence of exposure of heavy metals on human gene expression and hence diseases susceptibility. The results of the current study clearly indicate that chronic exposure to environmental heavy metals differentially altered the expression of genes involved in detoxification, xenobiotic metabolism, and DNA repair process, and hence increase the susceptibility to diseases. More research in this regard needs to be undertaken before the association between chronic heavy metals exposure and capacity of DNA repair is clarified. These results may guide us to the need for health protection and prophylactic measures to avoid delayed health effects consequences. Therefore, individuals living around polluted areas must be under regular medical follow-up through standard timetabled medical laboratory investigations to allow for early detection of any biochemical or blood hematological changes.

Conflict of interest There are no financial, personal or other relationships with other people or organizations or any other interests with regard to this manuscript that might be constructed as conflict of interest.

Acknowledgments The authors are thankful to the Deanship of Scientific Research at King Saud University for funding this work (grant #NPAR3-21). The authors are grateful to Mr. Fawaz M. Almutairi and Abdul Rahman Al Ghadeer for their technical assistance.

References Ademuyiwa, O., et al., 2010. Effects of sub-chronic low-level lead exposure on the homeostasis of copper and zinc in rat tissues. J. Trace Elem. Med. Biol. 24, 207e 211. Agency for Toxic Substances and Disease Registry (ATSDR), 2011. The ATSDR 2011, Substance Priority List. U.S. ATSDR, Atlanta, GA. Available at: http://www.atsdr. cdc.gov/SPL/index.html. Al-Farraj, A.S., Al-Wabel, M.I., 2007a. Evaluation of soil pollution around Mahad AD’Dahab Mine. J. Saudi Soc. Agric. Sci. 6, 89e106. Al-Farraj, A.S., Al-Wabel, M.I., 2007b. Heavy metals accumulation of some plant species grown on mining area at Mahad AD’Dahab, Saudi Arabia. J. Appl. Sci. 7, 1170e1175. Al-Hobaib, A., et al., 2013. Heavy metals concentrations and usability of groundwater at Mahd Adh Dhahab gold mine, Saudi Arabia. Arab. J. Geosci. 6, 259e270. Alicia, E.S., et al., 2011. A method for the measurement of mercury in human whole blood. Am. J. Anal. Chem. 2, 752e756. Allen, L.A., et al., 2010. Validation and potential mechanisms of red cell distribution width as a prognostic marker in heart failure. J. Card. Fail. 16, 230e238.

232

S.A. Al Bakheet et al. / Environmental Pollution 181 (2013) 226e232

Barbosa Jr., F., et al., 2005. A critical review of biomarkers used for monitoring human exposure to lead: advantages, limitations, and future needs. Environ. Health Perspect. 113, 1669e1674. Barrett, J.C., et al., 1997. 12th meeting of the scientific group on methodologies for the safety evaluation of chemicals: susceptibility to environmental hazards. Environ. Health Perspect. 105 (Suppl. 4), 699e737. Bazzi, A., et al., 2008. Determination of toxic and essential elements in children’s blood with inductively coupled plasma-mass spectrometry. J. Environ. Monit. 10, 1226e1232. Benin, A.L., et al., 1999. High concentrations of heavy metals in neighborhoods near ore smelters in northern Mexico. Environ. Health Perspect. 107, 279e284. Bersenyi, A., et al., 2003. Effect of ingested heavy metals (Cd, Pb and Hg) on haematology and serum biochemistry in rabbits. Acta Vet. Hung. 51, 297e304. Beyersmann, D., Hartwig, A., 2008. Carcinogenic metal compounds: recent insight into molecular and cellular mechanisms. Arch. Toxicol. 82, 493e512. Canadian Environmental Protection Act (CEPA), 2012. Toxic Substances List e Schedule 1. Available: http://www.ec.gc.ca/lcpe-cepa/default.asp?lang¼En&n¼0DA2924D1&wsdoc¼4ABEFFC8-5BEC-B57A-F4BF-11069545E434. Chai, V., et al., 2005. Optimization of the PAXgene blood RNA extraction system for gene expression analysis of clinical samples. J. Clin. Lab. Anal. 19, 182e188. Chevillard, S., et al., 1998. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumours. Oncogene 16, 3083e3086. Coles, B.F., Kadlubar, F.F., 2005. Human alpha class glutathione S-transferases: genetic polymorphism, expression, and susceptibility to disease. Methods Enzymol. 401, 9e42. Cornelis, R., et al., 1996. Sample collection guidelines for trace elements in blood and urine. IUPAC Commission of Toxicology. J. Trace Elem. Med. Biol. 10, 103e 127. De Luca, C., et al., 2011. The search for reliable biomarkers of disease in multiple chemical sensitivity and other environmental intolerances. Int. J. Environ. Res. Public Health 8, 2770e2797. Elbekai, R.H., et al., 2007. Ascorbic acid differentially modulates the induction of heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and glutathione Stransferase Ya by As(3þ), Cd(2þ) and Cr(6þ). Cancer Lett. 246, 54e62. Eto, K., Marumoto, M., Takeya, M., 2010. The pathology of methylmercury poisoning (Minamata disease). Neuropathology 30, 471e479. Ferrando, M., et al., 2011. Heme oxygenase 1 (HO-1) challenges the angiogenic switch in prostate cancer. Angiogenesis 14, 467e479. Filipic, M., Hei, T.K., 2004. Mutagenicity of cadmium in mammalian cells: implication of oxidative DNA damage. Mutat. Res. 546, 81e91. Garcon, G., et al., 2004. Biologic markers of oxidative stress and nephrotoxicity as studied in biomonitoring of adverse effects of occupational exposure to lead and cadmium. J. Occup. Environ. Med. 46, 1180e1186. Goulle, J.P., et al., 2005. Metal and metalloid multi-elementary ICP-MS validation in whole blood, plasma, urine and hair. Reference values. Forensic Sci. Int. 153, 39e44. Health Canada, 2012. Guidelines for Canadian Drinking Water QualitydSummary Table. Water, Air and Climate Change Bureau, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario. Hegazy, A.A., et al., 2010. Relation between anemia and blood levels of lead, copper, zinc and iron among children. BMC Res. Notes 3, 133. Hodgson, S., et al., 2007. Kidney disease mortality and environmental exposure to mercury. Am. J. Epidemiol. 165, 72e77. Janik, J., et al., 2011. 8-Oxoguanine incision activity is impaired in lung tissues of NSCLC patients with the polymorphism of OGG1 and XRCC1 genes. Mutat. Res. 709e710, 21e31. Jarup, L., 2003. Hazards of heavy metal contamination. Br. Med. Bull. 68, 167e182. Joseph, P., 2009. Mechanisms of cadmium carcinogenesis. Toxicol. Appl. Pharmacol. 238, 272e279. Kakkar, P., Jaffery, F.N., 2005. Biological markers for metal toxicity. Environ. Toxicol. Pharmacol. 19, 335e349. Kennedy, L., et al., 2008. Hematopoietic lineage transcriptome stability and representation in PAXgene collected peripheral blood utilising SPIA single-stranded cDNA probes for microarray. Biomark Insights 3, 403e417. Kobayashi, E., et al., 2009. Influence of consumption of cadmium-polluted rice or Jinzu River water on occurrence of renal tubular dysfunction and/or Itaieitai disease. Biol. Trace Elem. Res. 127, 257e268. Korashy, H.M., El-Kadi, A.O., 2004. Differential effects of mercury, lead and copper on the constitutive and inducible expression of aryl hydrocarbon receptor (AHR)-regulated genes in cultured hepatoma Hepa 1c1c7 cells. Toxicology 201, 153e172. Korashy, H.M., et al., 2011. The p38 MAPK inhibitor SB203580 induces cytochrome P450 1A1 gene expression in murine and human hepatoma cell lines through ligand-dependent aryl hydrocarbon receptor activation. Chem. Res. Toxicol. 24, 1540e1548. Korashy, H.M., et al., 2012. Camel milk modulates the expression of aryl hydrocarbon receptor-regulated genes, Cyp1a1, Nqo1, and Gsta1, in murine hepatoma Hepa 1c1c7 cells. J. Biomed. Biotechnol. 2012, 782642.

Kumar, A., et al., 2012. Reduced expression of DNA repair genes (XRCC1, XPD, and OGG1) in squamous cell carcinoma of head and neck in North India. Tumour Biol. 33, 111e119. Li, J., et al., 2011. Patient outcome prediction using multiple biomarkers in human melanoma: a clinicopathological study of 118 cases. Exp. Ther. Med. 2, 131e135. Li, Y., et al., 2006. Risk assessment of heavy metals in soils and vegetables around non-ferrous metals mining and smelting sites, Baiyin, China. J. Environ. Sci. (China) 18, 1124e1134. Liu, C.L., et al., 2012. Fucoxanthin attenuates rifampin-induced cytochrome P450 3A4 (CYP3A4) and multiple drug resistance 1 (MDR1) gene expression through pregnane X receptor (PXR)-mediated pathways in human hepatoma HepG2 and colon adenocarcinoma LS174T cells. Mar. Drugs 10, 242e257. Liu, J., et al., 2007. Blood metallothionein transcript as a biomarker for metal sensitivity: low blood metallothionein transcripts in arsenicosis patients from Guizhou, China. Environ. Health Perspect. 115, 1101e1106. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402e408. Mahjabeen, I., et al., 2012. Novel mutations of OGG1 base excision repair pathway gene in laryngeal cancer patients. Fam. Cancer 11, 587e593. Mazej, Z., et al., 2010. Heavy metal concentrations in food chain of Lake Velenjsko jezero, Slovenia: an artificial lake from mining. Arch. Environ. Contam. Toxicol. 58, 998e1007. McNeill, D.R., et al., 2004. Inhibition of Ape1 nuclease activity by lead, iron, and cadmium. Environ. Health Perspect. 112, 799e804. Nath, K.A., et al., 1996. Renal oxidant injury and oxidant response induced by mercury. Kidney Int. 50, 1032e1043. Qiao, M., et al., 2011. Characterization of soil heavy metal contamination and potential health risk in metropolitan region of northern China. Environ. Monit. Assess. 172, 353e365. Quandt, S.A., et al., 2010. Heavy metals exposures among Mexican farmworkers in eastern North Carolina. Environ. Res. 110, 83e88. Rushworth, S.A., et al., 2008. Lipopolysaccharide-induced expression of NAD(P)H: quinone oxidoreductase 1 and heme oxygenase-1 protects against excessive inflammatory responses in human monocytes. J. Immunol. 181, 6730e6737. Sakai, T., et al., 2003. Determination of lead in plasma, whole blood, and urine by icp-ms and the relationships among the three exposure indices. J. Occup. Med. Tox. 51, 50e57. Schwarz, D., et al., 2004. Arachidonic and eicosapentaenoic acid metabolism by human CYP1A1: highly stereoselective formation of 17(R), 18(S)-epoxyeicosatetraenoic acid. Biochem. Pharmacol. 67, 1445e1457. Senthil Kumar, K.J., et al., 2012. Hepatoprotective effect of lucidone against alcoholinduced oxidative stress in human hepatic HepG2 cells through the upregulation of HO-1/Nrf-2 antioxidant genes. Toxicol. In Vitro 26, 700e708. Shin, H.J., et al., 2004. Induction of orphan nuclear receptor Nur77 gene expression and its role in cadmium-induced apoptosis in lung. Carcinogenesis 25, 1467e1475. Tripathi, R.M., et al., 2001. Blood lead and its effect on Cd, Cu, Zn, Fe and hemoglobin levels of children. Sci. Total Environ. 277, 161e168. Uno, S., et al., 2001. Benzo[a]pyrene-induced toxicity: paradoxical protection in Cyp1a1(/) knockout mice having increased hepatic BaP-DNA adduct levels. Biochem. Biophys. Res. Commun. 289, 1049e1056. Uno, S., et al., 2004. Oral exposure to benzo[a]pyrene in the mouse: detoxication by inducible cytochrome P450 is more important than metabolic activation. Mol. Pharmacol. 65, 1225e1237. Vargas, H., et al., 2003. Acute lead exposure induces renal haeme oxygenase-1 and decreases urinary Naþ excretion. Hum. Exp. Toxicol. 22, 237e244. Wakai, T., et al., 2011. Prognostic significance of NQO1 expression in intrahepatic cholangiocarcinoma. Int. J. Clin. Exp. Pathol. 4, 363e370. Wang, Z., et al., 2010. Identifying sources and assessing potential risk of heavy metals in soils from direct exposure to children in a mine-impacted city, Changsha, China. J. Environ. Qual. 39, 1616e1623. Wirth, J.J., Mijal, R.S., 2010. Adverse effects of low level heavy metal exposure on male reproductive function. Syst. Biol. Reprod. Med. 56, 147e167. Yilmaz, H., et al., 2012. Analysis of the hematological and biochemical parameters related to lead intoxication. J. Forensic Leg. Med. 19, 452e454. Yin, Y., et al., 2012. Expression and function of heme oxygenase-1 in human gastric cancer. Exp. Biol. Med. (Maywood) 237, 362e371. Yoon, Y.J., et al., 2011. KRIBB11 inhibits HSP70 synthesis through inhibition of heat shock factor 1 function by impairing the recruitment of positive transcription elongation factor b to the hsp70 promoter. J. Biol. Chem. 286, 1737e1747. Zawia, N.H., et al., 1998. Sp1 as a target site for metal-induced perturbations of transcriptional regulation of developmental brain gene expression. Brain Res. Dev. Brain Res. 107, 291e298. Zhang, J., et al., 2011. Detection of CYP2E1, a genetic biomarker of susceptibility to benzene metabolism toxicity in immortal human lymphocytes derived from the Han Chinese population. Biomed. Environ. Sci. 24, 300e309. Zordoky, B.N., El-Kadi, A.O., 2010. Effect of cytochrome P450 polymorphism on arachidonic acid metabolism and their impact on cardiovascular diseases. Pharmacol. Ther. 125, 446e463.