- Email: [email protected]
Effect of low frequency stimulation on impaired spontaneous alternation behavior of kindled rats in Y-maze test
Epilepsy Research 126 (2016) 37–44
Contents lists available at www.sciencedirect.com
Epilepsy Research journal homepage: www.elsevier.com/locate/epilepsyres
Effect of low frequency stimulation on impaired spontaneous alternation behavior of kindled rats in Y-maze test Samireh Ghafouri, Yaghoub Fathollahi, Mohammad Javan, Amir Shojaei, Azam Asgari, Javad Mirnajafi-Zadeh ∗ Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e
i n f o
Article history: Received 22 January 2016 Received in revised form 28 May 2016 Accepted 25 June 2016 Available online 26 June 2016 Keywords: Seizure Spontaneous alternation behavior Low-frequency stimulation Calcineurin Y-maze test
a b s t r a c t Epileptic seizures are characterized with cognitive disorders. In this study we investigated the effect of electrical low frequency stimulation (LFS), as a potential anticonvulsant agent, on kindled seizureinduced cognitive impairments. Animals were kindled through electrical stimulation of hippocampal CA1 area in a semi-rapid manner (12 stimulations/day). One group of animals received LFS 4 times at 0.5, 6.5, 24 and 30 h following the last kindling stimulation. Applied LFS was consisted of 4 packages at 5 min intervals. Each package contained 200 monophasic square wave pulses of 0.1 ms duration at 1 Hz. The Y-maze test was performed in all animals to measure the spontaneous alternation behavior. Kindled animals showed significant impairment in spontaneous alternation behavior compared to the control group. Application of LFS improved the observed impairment in spontaneous alternation behavior in kindled animals, so that there was no significant difference between kindled + LFS and control group. The observed improving effect of LFS was accompanied with a significant increase in calcineurin gene expression within the hippocampal area. Therefore, it may be postulated that application of LFS in kindled animals, which resulted in increment of calcineurin gene expression, can improve the seizure–induced impairment in spontaneous alternation behavior in Y-maze test. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Epilepsy is known as a common neurological disease which is characterized by repeated spontaneous seizures. In addition to recurrent seizures, patients with epilepsy frequently exhibit cognitive impairments, particularly in learning and memory related functions (Helmstaedter et al., 2003; Elger et al., 2004). Kindling is the most commonly used model of temporal lobe epilepsy which can be generated by repetitive and low-intensity electrical stimulation of limbic areas including the hippocampus (Goddard et al., 1969; Racine, 1978). Kindling is associated with long-lasting facilitation of synaptic transmission and therefore shares several features with long-term potentiation (LTP) (Cain, 1989; Cain et al., 1992). In previous studies conducted by this group, it was shown that semi-rapid kindling model (in which the animals receive 10–12 stimulations per day) can induce synaptic
Abbreviations: AD, afterdischarge; ADD, afterdischarge duration; LFS, lowfrequency stimulation. ∗ Corresponding author at: Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, PO Box 14115-331, Tehran, Iran. E-mail address: [email protected] (J. Mirnajafi-Zadeh). http://dx.doi.org/10.1016/j.eplepsyres.2016.06.010 0920-1211/© 2016 Elsevier B.V. All rights reserved.
potentiation which is similar to the potentiation induced during the traditional model of kindling (once or twice stimulations per day) (Mohammad-Zadeh et al., 2007; Jahanshahi et al., 2009). The kindling-induced increase in synaptic efficacy is not restricted to the first synaptic relay but extends gradually and successively to other synaptic stations in the stimulated circuit. Kindling leads to a significant impairment of LTP in different brain areas including the hippocampal CA1 region (Leite et al., 2005). Synaptic plasticity is an important physiological phenomenon which plays a key role in information processing and storage in the brain (Howland and Wang, 2008). This phenomenon occurs in brain regions underlying the expression of experience-dependent behaviors (Kolb and Whishaw, 1998). Disorders, such as epilepsy, which affect synaptic plasticity, may impair the learning and memory. Therefore, memory and learning deficiencies are notable consequences in chemical and/or electrical kindling models of seizure (Beldhuis et al., 1992; Genkova-Papazova and Lazarova-Bakarova, 1995). Several lines of evidences have shown that impairment in cognitive functions relates to the seizure focus, especially the hippocampal CA1 area which has an important role in spatial working memory (Olton et al., 1978b; Morris et al., 1982). It has been
38
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
previously revealed a correlation between the hippocampal CA1 degradation and memory impairment in experimental model of temporal lobe epilepsy (Leung and Shen, 2006) and there is a link between structural degradation and memory capacity in this area (Barnett et al., 2015). Similarly, spatial memory and working memory deficits are correlated with hippocampal sclerosis in patients with epilepsy (Glikmann-Johnston et al., 2008; Stretton et al., 2013). Therefore, measuring the spontaneous alternation behavior in Y-maze test (as a main test for spatial-working memory in rodents (Olton, 1979)) during hippocampal kindled seizures (as a model of temporal lobe epilepsy) is a suitable manner for studying the temporal lobe epilepsy-induced impairment in working memory. Despite remarkable number of studies has been conducted; there is still no absolute treatment for patients with epilepsy. Anticonvulsant medication, as the most common therapeutic method, only suppresses seizures rather than improving the abnormalities underlying epilepsy (Macdonald and Kelly, 1993). Moreover, general antiepileptic drugs may also induce cognitive side effects or exacerbate a previously existing cognitive deficit (Aldenkamp et al., 2003; Ortinski and Meador, 2004). With all this, it is necessary to find new strategies for reducing the seizure-induced impairments of learning and memory. Low-frequency electrical stimulation (LFS) is effective against kindled seizures (Gaito et al., 1980; Shahpari et al., 2012; Ghotbedin et al., 2013). Recently, we showed that application of LFS following kindling stimulations can prevent the kindlinginduced potentiation during the first 7 days of kindling acquisition (Mohammad-Zadeh et al., 2007). Application of LFS can induce long-term depression (LTD) (Fujii et al., 2000; Manahan-Vaughan and Kulla, 2003) and depotentiation (Manahan-Vaughan and Kulla, 2003; Klausnitzer et al., 2004). Therefore, it has been suggested that the anticonvulsant mechanisms of LFS may be similar to mechanisms involved in LTD or depotentiation (Schiller and Bankirer, 2007). Various molecules have been demonstrated to mediate LTD and depotentiation, including calcineurin A-␣ (Zhuo et al., 1999). Calcineurin is a member of the serine/threonine protein phosphatase family enriched in neural tissue (Pallen and Wang, 1985). It has been found that calcineurin A-␣ is the predominant isoform in the hippocampus (Takaishi et al., 1991; Kuno et al., 1992; Zhang et al., 1996). Calcineurin mediated dephosphorylation is important in controlling many cellular processes including development of learning and memory (Riedel, 1999; Mansuy, 2003), regulation of long-term potentiation (Wang and Stelzer, 1994) and modulation of neurotransmitter release (Cordeiro et al., 2000). In addition, calcineurin is essential for induction of LTD and depotentiation (Mulkey et al., 1994; Zhuo et al., 1999; Baumgartel and Mansuy, 2012). Therefore, the present study was an attempt to investigate the preventive effect of LFS application, as a potential anticonvulsant therapeutic manner, on kindling-induced impairment of spontaneous alternation behavior in a calcineurin related manner.
2. Material and methods Male Wistar rats (5–6 weeks old at the time of surgery) were housed individually in cages with an ambient temperature of 22 ◦ C–25 ◦ C and a 12-h light/12-h dark cycle (lights on from 6:00 a.m– 6np.m.). Animals were provided with water and food ad libitum. Experiments were carried out each day between 8:00 a.m.–6 p.m. All experimental and animal care procedures were performed according to international guidelines for the use of laboratory animals and approved by “Tarbiat Modares University Ethical Committee for Animal Research” which is in line with the “NIH Guide for the Care and Use of Laboratory Animals”. Efforts
were made to minimize both the number of animals used and their suffering. 2.1. Animal surgery The rats were deeply anesthetized by a ketamine/xylazine mixture (100/10 mg/kg, i.p.), fixed in a stereotaxic frame and their skull were exposed. A bipolar stimulating electrode and a monopolar recording electrode were twisted together and chronically implanted in the hippocampal CA1 region of the right hemisphere at 2.4 mm posterior and 1.8 mm lateral to the bregma and 2.8 mm below skull (Paxinos and Watson, 1986). These teflon-coated, stainless steel electrodes (A-M Systems, Inc., WA, U.S.A.; 127 m in diameter) were insulated except at their tips. A monopolar electrode connected to a stainless steel screw was also positioned in the skull above the occipital cortex as a reference and/or ground electrode. All electrodes were connected to pins of a lightweight multi-channel miniature socket as a head stage and fixed to the skull with dental acrylic. The electrode location was histologically confirmed in animals at the end of the experiments. To do this, rats were deeply anesthetized and perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Then, their brain was removed and sectioned to verify electrode placement. 2.2. Kindling procedure As it was explained previously (Sadegh et al., 2007), after a post-surgical recovery period of 7 days, the afterdischarge (AD) threshold was determined by 1 ms monophasic square wave of 50 Hz with 3 s train duration. Briefly, the stimulating currents were initially delivered at 30 A and then its intensity was increased in increments of 10 A at 10 min intervals until ADs of at least 8 s were recorded. The ADs were defined as spikes with a frequency of at least 1 Hz and amplitude of at least twice the baseline activity originating immediately post stimulation. Rats were electrically stimulated at the AD threshold 12 times a day with an interval of 10 min. Epileptiform ADs were continuously recorded from the hippocampal CA1 area following kindling stimulations using a PCbased data acquisition system (D3107; ScienceBeam Co., Tehran, Iran). The behavioral seizure severity was rated according to Racine’s scale (Racine et al., 1977): stage 0, rats showed no convulsion; stage 1, rats showed facial automatism; stage 2, head nodding, stage 3, unilateral forelimb clonus, stage 4, bilateral forelimb clonus; stage 5, rearing, falling and generalized convulsions. The animals were considered as fully kindled when they exhibited stage 5 seizure in three consecutive days. 2.3. Y-maze task The Y-maze test was done at least two weeks following the animal surgery (one week as a recovery period after surgery and one week as averaged time to reach fully kindled state). The Ymaze is a hippocampal dependent–spatial working memory task that requires rats to use external maze cues to navigate the identical internal arms. The Y-maze was chosen to reduce habituation time and provide a measure of spatial working memory and to limit stressful confounds such as food deprivation (radial arm maze) or forced swimming (water maze). The apparatus consisted of a black plastic maze with three arms (50 cm long, 32 cm high and 16 cm wide) that were intersected at 120◦ . A rat was placed at the end of one arm and allowed to move freely through the maze for 8 min without reinforcements, such as food and water. Entries into all arms were noted (4 paws had to be inside the arm for a valid entry) and a spontaneous alternation was counted if an animal entered three different arms consecutively. Percentage of sponta-
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
neous alternation was calculated according to following formula: [(number of alternations)/(total number of arm entries − 2)] × 100 (Sierksma et al., 2014; Kitanaka et al., 2015). To prevent a bias in data analysis, the Y-maze test was carried out in a blind manner by an experimenter. All behavioral tests were done at 4 p.m. to 5 p.m. 2.4. Open field test The open field arena was used to assess locomotor activity. The apparatus was made of a black wooden square arena (60 × 60 × 60 cm). After each session the arena was thoroughly cleaned using a 70% ethanol solution. The rat was placed in the center of the arena, being able to move around freely for 15 min. The movements of each rat were tracked automatically by using a video camera and home-made software. The total distance moved and the velocity of movement within 15 min was used as a measure of locomotor activity (Kalueff et al., 2007; Sierksma et al., 2014). In addition, the time spent in center of box was measured as an index of animal anxiety (Sanchez and Jensen, 2001; Hsiao et al., 2012). 2.5. RNA extraction, cDNA synthesis and quantitative real time-PCR experiments For quantitative real time-PCR (qRT-PCR), animals were sacrificed and their hippocampus were extracted immediately after Y-maze test in first experiment and preserved at −80 ◦ C temperature. (a) RNA preparation and reverse transcription: For gene expression study, total mRNA was isolated based on method of phenol-chloroform extraction (Ausubel et al., 1992), using total extraction kit (Parstous, Iran) according to the manufacturer’s instructions. The final total RNA pellet was air-dried and the RNA was suspended in 30 l of DEPC (diethyl-pyrocarbonate)-treated water. 1 l of total RNA was used for spectrophotometeric determination of the RNA concentration at 260 and 280 nm 2 l of total RNA were used to determine integrity and quality of RNA samples extracted in electrophoresis (Akhtarian, Iran) on 1% agarose gel (Fermentaz, Germany). The extracted RNA was entered into the cDNA construction phase. For each sample, cDNA synthesis was performed using 2 g of total RNA, 2 l Oligo-dT primer (Parstous, Iran) and 10 l reverse transcriptase (Parstous, Iran) based on the manufacture’s instruction. (b) qRT-PCR: The cDNA pool was subjected to qRT-PCR by using a Real Q-PCR Master Mix Kit (Ampliqon, Herlev, Denmark) on a Rotor-Gene Q device (Qiagen, Hilden, Germany). The following conditions were used for qRT-PCR: initial heating for 15 min at 95 ◦ C; 35 cycles of amplification, each composed of 60 s at 95 ◦ C; 60 s at the annealing temperature; and 60 s at 72 ◦ C. The annealing temperature for calcineurin A-␣ and PGK-1 was 60 ◦ C. PGK-1 was used as an endogenous control to minimize the effect of sample variations in calculating the relative expression level of target genes by the delta–delta-Ct method. We measured cycle threshold as an expression of calcineurin A-␣ gene. Primers for calcineurin A-␣ and PGK1 were purchase from CinnaGen, Iran (Table 1). 2.6. Experimental design In the first experiment, we examined the effect of LFS on kindling-induced memory impairment. Animals were assigned to 5 groups. In kindled group, fully kindled animals were tested by Y-maze 24 h following the last kindling stimulation (Fig. 1-A). Animals of kindled + LFS group received LFS as follows: first and second LFS were applied immediately and 6 h following the last kindling stimulation respectively; third and fourth LFS were applied on the next day in a similar manner (Fig. 1-A). Each LFS was consisted of 4 packages at 5 min intervals; each package contained 200 monopha-
39
sic square wave pulses of 0.1 ms duration at 1 Hz. LFS pattern was achieved according to our preliminary experiments on hippocampal CA1 area. The intensity for delivery of LFS was equal to AD threshold for each kindled rat. Animals were tested by Y-maze 2–3 h after the last LFS. In LFS group, animals were manipulated similar to kindled + LFS group, but received only LFS (without kindling stimulations). Another group of animals were underwent surgery but did not received any kind of stimulations and were considered as sham group. In this group, the elapsing time between surgery and behavioral test was similar to animals of kindled and/or kindled + LFS group (about 15 days). In control group, Y-maze test was done without undergoing surgery and any kind of stimulations. In the second experiment, we investigated the effect of LFS on kindling-induced memory impairment during 2 consecutive Y-maze tests in fully kindled animals while the LFS was applied after the first and before the second Y-maze test. Therefore, in this experiment we could compare the spontaneous alternation before and after LFS application. Similar to the first experiment, animals were divided into 5 groups. In kindled group, the first Y-maze test was performed 2–3 h following the last kindling stimulation. The second Y-maze test was done 24 h later (Fig. 1-B). In animals of kindled + LFS group, 2–3 h following the last kindling stimulation the first Y-maze test was carried out. Then, LFS was delivered for 4 times: two LFS were applied immediately and 6 h following the first Y-maze test. The other two LFSs were applied in a similar manner during the next day. The second Y-maze test was done 2–3 h after the last LFS (Fig. 1-B). In LFS group, animals were manipulated similar to kindled + LFS group, but received only LFS (without kindling stimulations). Another group of animals was underwent surgery but did not received any kind of stimulations and was considered as sham group. In control group, Y-maze test was done two times in intact animals. Open field test was done in all of the animals of first experiment before Y-maze test. In addition, in all groups of first experiment the hippocampal sampling was done for qRT-PCR immediately following the Y-maze test. 2.7. Statistical analysis Data were averaged and expressed as mean ± S.E.M. To evaluate the effect of kindling and LFS application on measured parameters, a two-way ANOVA followed by a post-hoc Tukey’s test was used to compare the percent of spontaneous alternation, total arm entries, traveled distance, velocity of movement and calcineurin A-␣ gene expression in different groups of experiments 1. In different groups of second experiment, the changes in percentage of spontaneous alternation and total arm entries between first and second Y-maze tests were compared by three-way ANOVA to evaluate the effect of kindling, LFS and number (first or second) of Y-maze test as three factors. Tukey’s test was used as post-hoc analysis whenever necessary. Spontaneous alternation in different experimental groups was also compared with that of a theoretical group performing at chance level of 50% by using a one-sample t-test. Linear regression analysis and nonparametric Spearman’s rank correlation test were carried out to find the correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test for each animal. P-value of less than 0.05 was considered to represent a significant difference. 3. Results There was no significant difference in AD threshold (90.0 ± 24.5 A in kindled and 116.7 ± 16.7 A in kindled + LFS group) and ADD after the first kindling stimulation (20.0 ± 2.6 s in kindled and 19.6 ± 1.9 s in kindled + LFS group) among dif-
40
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Table 1 Sequences of primers used in qRT-PCR. Gene
Forward
Reverse
Accession number
PGK 1 Calcineurin A-␣
GCCAAGTCGGTTGTGCTTATG TGACCACTTCCTGTTCACTTTTTTT
CCAGGAGGATGACAGTCCCA GCAAGAACATCCAACTGCTGAG
NM 053291.3 NM 017041.1
Fig. 1. Time-line diagram showing the experimental protocol used in experiment 1 (A) and experiment 2 (B) in kindled and kindled + LFS groups.
ferent experimental groups. In addition, the mean number of stimulation to achieve the fully kindled state was similar in kindled (8.6 ± 0.75 days) and kindled + LFS (8.0 ± 0.7 days) groups. Therefore, the seizure susceptibility was not different among experimental groups at the beginning of experiments. LFS alone had no significant effect on the spatial working memory. There was no significant difference in sham and control groups, thus, their data were merged and considered as control. In the first experiment we examined the spontaneous alternation behavior by Y- maze test. A two-way ANOVA showed no significant interaction of kindling × LFS factors among experimental groups (F(1,38) = 2.69, P = 0.11). However, LFS and kindling alone had significant effect on spontaneous alternation behavior (F(1,38) = 19.66, P < 0.001 and F(1, 38) = 19.75, P < 0.001, respectively). The post-hoc Tuckey’s test revealed that spontaneous alternation percentage of arm entries decreased in the kindled (55.40 ± 4.7%) compared to control group (78.13 ± 2.35%) significantly (P < 0.001). However, application of LFS prevented the kindling-induced impairment of spontaneous alternation behavior in kindled + LFS group, so that there was no significant difference between their spontaneous alternation rates (78.17 ± 1.85%) compared to control group. Application of LFS alone had no significant effect on this parameter (88.63 ± 3.32%) (Fig. 2A). In all different experimental groups, except the kindled group, spontaneous alternation was significantly (p < 0.001) above the chance level (50%). To get more confirmation of the preventive effect of LFS on kindling-induced spontaneous alternation behavior impairment, in the second experiment the Y-maze test was done before and after LFS application. A three-way ANOVA showed a significant interaction of kindling, LFS and number of Y-maze test between experimental groups (F(1,38) = 8.08, P < 0.05). By using the post-hoc Tukey’s test a significant reduction was observed in the percentage of spontaneous alternation during both first and second Y-maze test in kindled compared to control group (P < 0.001). There was no significant difference in this parameter during the first (56.8 ± 2.1%)
and second (61.2 ± 3.62%) Y-maze tests in kindled group. Application of LFS following the first Y-maze test increased the percentage of spontaneous alternation during the second Y-maze test, so that there was no significant difference between alternation rate in kindled + LFS (82.2 ± 2.35%) and control (86 ± 1.5%) groups during the second Y-maze test. Similar to kindled group, the alternation rate during the first Y-maze test (before application of LFS) of kindled + LFS group (55.40 ± 4.7%) was significantly (P < 0.001) lower than control (86.7 ± 2.6%). Obtained results revealed no significant difference between the percentage of spontaneous alternation in first and second Y-maze tests in control (86.7 ± 2.6% vs 86 ± 1.5%) and LFS (86.14 ± 1.8% vs 86.2 ± 1.9%) groups. Therefore, the observed changes in the percentage of spontaneous alternation before and after application of LFS in kindled + LFS group was due to delivery of LFS but not an effect of the first Y-maze test (Fig. 2B). Similar to the first experiment, all different experimental groups, but not kindled group, showed a spontaneous alternation in second Y-maze test which was significantly (p < 0.001) above the chance level (50%). The number of total arm entries was also measured in Y-maze test. In first experiment, a two-way ANOVA revealed significant difference in this parameter between experimental groups (F(1,29) = 14.27, P < 0.001). The post-hoc Tuckey’s test showed that there was significant increase in the number of total arm entries during Y-maze test in fully kindled animals which did not received LFS (P < 0.001, Fig. 2A). Similarly, a three-way AVOVA test showed significant difference in the number of total arm entries between experimental groups in second experiment (F(1,38) = 4.31, P < 0.05). The post-hoc Tuckey’s test showed that application of LFS in kindled + LFS group reduced this parameter in second Y-maze test compared to the first one (P < 0.001). To determine if the increased number of total arm entries in kindled animals is related to the difference in their locomotor activity, open field test was done. There was no significant difference in the mean of traveled distance (F(1,31) = 0.02, P = 0.88), the velocity of movements (F(1,32) = 0.57,
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
41
Fig. 2. Effect of LFS application on kindling-induced impairment in spontaneous alternation in Y-maze test. (A) Changes in percentage of spontaneous alternation (left) and total arm entries (right) in different groups of the first experiment. Kindled animals showed significant decrease in the percentage of spontaneous alternation and significant increase in the total arm entries. Application of LFS in fully kindled animals (kindled + LFS) prevented the kindling induced changes in these parameters and there was no significant difference between kindled + LFS and control group. (B) Changes in percentage of spontaneous alternation (left) and total arm entries (right) in different groups of the second experiment during the 1st (dark) and 2nd (light) Y-maze tests. Similar to first experiment, there was significant decrease in spontaneous alternation% and increase in total arm entries during 1st and 2nd Y-maze tests in kindled groups. In kindled + LFS group, application of LFS following the 1st Y-maze test, returned the parameters to control values during the 2nd Y-maze test. The lines connect data of the same animals in 1st and 2nd Y-maze test. In each group empty bar represents 1st Y-maze test and filled bar indicates 2nd Y-maze test. The travel distance (C, left), velocity (C, right) and center time (D) of animals in different experimental groups were also measured by open field test. There was no significant difference in these parameters between four groups. Application of LFS alone had no significant effect on measured parameters. Dashed-lines in A and B reflect the chance level (50%) of spontaneous alternation. The Data are shown as mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001.
P = 0.46) and center time (F(1,25) = 0.10, P = 0.76) during 15 min of open field test between different groups in first experiment (Fig. 2C and D). In addition, Tukey’s post test did not showed any significant difference between experimental groups. Therefore, the differences in Y maze performance were not due to a global change in locomotor activity. In the next step we measured the calcineurin A-␣ gene expression in experimental groups. A two-way ANOVA showed a significant difference in the gene expression between groups (F(1,22) = 9.35, P < 0.01). Tukey’s post test revealed no significant changes in calcineurin A-␣ gene expression in kindled group (0.55 ± 0.08) compared to control (1.05 ± 0.12). However, there was a significant increase in the expression of this gene in kindled + LFS (4.20 ± 0.92) group compared to control and kindled
groups (P < 0.05). Application of LFS alone had no significant effect on calcineurin A-␣ gene expression (1.86 ± 0.37) (Fig. 3B). In addition there was a significant correlation between the amount of calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test in kindled + LFS group (r = 0.78, P < 0.01, Fig. 4). 4. Discussion Our findings indicated that application of LFS in CA1 region of the dorsal hippocampus can prevent the kindled seizure-induced impairment of spontaneous alternation behavior in hippocampus of fully kindled animals. Several lines of evidence have implicated the important role of the hippocampus in spatial working memory.
42
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Fig. 3. Changes in calcineurin A-␣ gene expression in hippocampal CA1 region in different experimental groups. (A) Representative images for the expression of calcineurin A- ␣ gene in the hippocampus of control, LFS, kindled and kindled + LFS groups as measured by qRT-PCR. PGK-1 was used as an internal control. (B) Quantification data for qRT-PCR analysis of changes in the expression of calcineurin A␣ gene. As the figure shows, there was a significant increase in the expression of calcineurin A- ␣ gene in kindled + LFS group. No significant difference observed in kindled and LFS groups. Data are shown as mean ± SEM. * p < 0.05 compared to control group.
Fig. 4. Correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test in kindled + LFS group. Linear regression analysis showed a significant correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test. r = 0.78, P < 0.01.
Lesion of hippocampus impairs spatial working memory in young rats (Olton et al., 1978b; Morris et al., 1982; Sutherland et al., 1983; Dong et al., 2012). The hippocampus is hypothesized to represent a spatial map as neural firing which is correlated with the animal’s position in its environment (Hill, 1978; Olton et al., 1978a; McNaughton et al., 1983). In hippocampal neurons, spatial work-
ing memory is accompanied with LTP, a long lasting use-dependent modification of synaptic strength, which is thought to be a cellular substrate involved in learning and memory (Bliss and Collingridge, 1993; Lynch, 2004). In addition, alterations in hippocampal LTP has been shown to be involved in kindling-related learning deficits (Schubert et al., 2005; Mazarati, 2008). Therefore, the hippocampal kindling is a good model for studying the seizure-induced impairment in learning and memory. Previous studies have shown that hippocampal kindling can induce spatial memory deficits, as tested in the radial arm maze (Leung et al., 1990; Leung and Shen, 1991) or Morris’ water maze (Gilbert et al., 1996; Hannesson et al., 2001). The results of the present study also showed a significant impairment of spontaneous alternation behavior in Y-maze in kindled animals. Kindling procedure is associated with a special kind of synaptic potentiation which is similar to LTP (Cain, 1989; Cain et al., 1992). This potentiation reduces the ability of hippocampal synapses to express a new plasticity (especially in the form of LTP). This kindling-induced impairment in synaptic plasticity can account for disruption of learning and memory in kindled animals (Schubert et al., 2005). In addition, an impaired physiological balance between excitatory and inhibitory transmitters in kindled animals may be involved in reducing the expression of new synaptic plasticity (Morimoto, 1989; Kapur and Lothman, 1990). Patients with epilepsy have difficulties with learning and attention (van Rijckevorsel, 2006). Most of antiepileptic drugs can also induce cognitive side effects or exacerbate a previously existing cognitive deficit (Aldenkamp et al., 2003; Ortinski and Meador, 2004). Our results showed that application of LFS can reduce the kindled seizure-induced impairment of spontaneous alternation behavior in Y-maze test. Thus, it can be considered as a positive effect of LFS (which is potentially a novel therapeutic strategy in patients with epilepsy (Goodman et al., 2005; Yang et al., 2006)) compared to antiepileptic drugs. LFS (1–3 Hz) induces long-term depression (LTD) (Fujii et al., 2000; Manahan-Vaughan and Kulla, 2003) and depotentiation (Manahan-Vaughan and Kulla, 2003; Klausnitzer et al., 2004). Therefore, the improving effect of LFS on Y-maze performance of fully kindled rats may be somehow related to its suppressing effect on kindling-induced synaptic potentiation. In this regard, our previous experiments also showed that application of LFS retarded the perforant path kindling acquisition and prevented kindling-induced synaptic potentiation in perforant path-granular cells synapses (Mohammad-Zadeh et al., 2007; Jahanshahi et al., 2009). In the first experiment, the significant increase of the spontaneous alternation in kindled + LFS compared to kindled group clearly showed the improving effect of LFS on kindling-induced deficiency in Y-maze performance. However, to confirm that animals of kindled + LFS group had spontaneous alternation behavior impairment following the fully kindled state, a second set of experiments were carried out. In these experiments the first Y-maze test in kindled + LFS group showed a significant reduction in spontaneous alternation in animals of this group. Application of LFS restored the kindling-induced impairment of spontaneous alternation behavior toward its normal values during the second Y-maze test in these animals. The positive effect of LFS on Y-maze performance may be potentially considered as an index of its effectiveness in improving the kindling-induced memory impairment. However, it needs to use other behavioral tests for more confirmation. Therefore, it is possible to consider the observed changes in the spontaneous alternation behavior as impairment in memory. In this study, Y-maze test was performed shortly after the last kindling stimulation. Because the short effects of kindling may be differ from its permanent impairment in learning and memory (which could last up to 4 weeks after the kindling (Leung et al.,
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
1990; Leung and Shen, 1991)), the findings of the present study should be confirmed by testing the animals 1–2 weeks after the last kindled seizure. For this purpose, in another experiment we showed that the improving effects of LFS in Moriss water maze test remain up to one week following the last kindling stimulation (unpublished data). In our study, the total arm entries in kindled group during both first and second experiments and in kindled + LFS group during the first Y-maze test of second experiment were more than control. This may be as a result of the increase in locomotor activity of kindled rats. However, open field test showed no significant difference in traveled distance and velocity of movement among different groups of animals. Therefore, the observed difference in total number of entrance was not related to the variation in motor activity. In addition, it was not related to changes in animal’s anxiety as there was no significance difference in the time spent in the center of open field box in kindled compared to control group. In our experiments, the increment of the total arm entries may be considered as a result of memory impairment; however, this conclusion needs more behavioral experiments to be confirmed. One interesting finding of this study was the effect of LFS application on calcineurin A-␣ gene expression. While kindling acquisition had no significant effect on gene expression of calcineurin A-␣, administration of LFS in fully kindled animals significantly increased it compared to control group. Previous studies have shown that seizure and hyperexcitability are accompanied with the increase in calcineurin activity (Kurz et al., 2001; Kurz et al., 2003; Eckel et al., 2015). However, another study has demonstrated that seizure-induced increase in the activity of calcineurin is not accompanied with its gene expression (Kurz et al., 2001). On the other hand, the down-regulation of calcineurin in patients with epilepsy has also been reported (Lie et al., 1998). Regardless of any changes in calcineurin A-␣ gene expression during kindling, it is important to note that in our experiments the increase in calcineurin gene expression was observed following application of LFS. Generally, calcineurin is thought to play a critical role in synaptic plasticity (Bliss and Collingridge, 1993) and some studies have provided genetic evidences on the important role of the A␣ isoform of calcineurin in the reversal of LTP in the hippocampus (Zhuo et al., 1999; Baumgartel and Mansuy, 2012). On the other hand, many researchers have suggested that the inhibitory action of LFS on kindled seizures may be through the mechanisms involved in depotentiation (Goodman et al., 2005; Yang et al., 2006). Therefore, it may be postulated that application of LFS in hippocampal CA1 area affects the expression of some genes, including calcineurin A-␣, through a depotentiation-like mechanism. However, the exact mechanism of LFS action needs to be investigated. This effect may return the ability of synaptic plasticity to the hippocampal circuits which is necessary for learning and memory. The significant correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternations in Y-maze test also confirms the probable role of calcineurin in the observed effect of LFS in kindled + LFS group. However, to confirm the role of calcineurin, it will be helpful to check the effect of calcineurin inhibitor on LFS effects. In addition, considering the involvement of multiple complex molecular mechanisms in memory, measurement of calcineurin alone provides limited insights. Therefore, it is necessary to evaluate the role other molecules in mediating the LFS effects. During stimulation of hippocampal CA1 area, the dentate gyrus is also stimulated in an ortodromic and antidromic manner. In addition, the calcineurin gene expression was measured in the whole hippocampal areas and dentate gyrus. Therefore, considering the important role of dentate gyrus in cognitive functions of the hippocampal formation, at least part of the difference in spontaneous alternation and in calcineurin A-␣ gene expression between the
43
experimental groups may be related to the changes in the activity of dentate gyrus neurons. 5. Conclusion Taking together, results of the present study showed that application of LFS could reduce the Y-maze performance impairment in kindled rats and this effect is accompanied with the increase in calcineurin A-␣ gene expression. However, it is necessary to measure the enzyme activity and post-translational changes of calcineurin for better determining of its role. Conflict of interest None. Acknowledgement This study was supported by a grant from Tarbiat Modares University, Iran. References Aldenkamp, A.P., De Krom, M., Reijs, R., 2003. Newer antiepileptic drugs and cognitive issues. Epilepsia 44 (Suppl. 4), 21–29. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., 1992. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. Greene Pub. Associates, New York, pp. 232. Barnett, A.J., Park, M.T., Pipitone, J., Chakravarty, M.M., McAndrews, M.P., 2015. Functional and structural correlates of memory in patients with mesial temporal lobe epilepsy. Front. Neurol. 6, 103. Baumgartel, K., Mansuy, I.M., 2012. Neural functions of calcineurin in synaptic plasticity and memory. Learn. Mem. 19, 375–384. Beldhuis, H.J., Everts, H.G., Van der Zee, E.A., Luiten, P.G., Bohus, B., 1992. Amygdala kindling-induced seizures selectively impair spatial memory. 2. Effects on hippocampal neuronal and glial muscarinic acetylcholine receptor. Hippocampus 2, 411–419. Bliss, T.V., Collingridge, G.L., 1993. A synaptic model of memory: long-term potentiation in the hippocampus. Nature 361, 31–39. Cain, D.P., Boon, F., Hargreaves, E.L., 1992. Evidence for different neurochemical contributions to long-term potentiation and to kindling and kindling-induced potentiation: role of NMDA and urethane-sensitive mechanisms. Exp. Neurol. 116, 330–338. Cain, D.P., 1989. Long-term potentiation and kindling: how similar are the mechanisms? Trends Neurosci. 12, 6–10. Cordeiro, J.M., Meireles, S.M., Vale, M.G., Oliveira, C.R., Goncalves, P.P., 2000. Ca(2+) regulation of the carrier-mediated gamma-aminobutyric acid release from isolated synaptic plasma membrane vesicles. Neurosci. Res. 38, 385–395. Dong, Z., Gong, B., Li, H., Bai, Y., Wu, X., Huang, Y., He, W., Li, T., Wang, Y.T., 2012. Mechanisms of hippocampal long-term depression are required for memory enhancement by novelty exploration. J. Neurosci. 32, 11980–11990. Eckel, R., Szulc, B., Walker, M.C., Kittler, J.T., 2015. Activation of calcineurin underlies altered trafficking of alpha2 subunit containing GABAA receptors during prolonged epileptiform activity. Neuropharmacology 88, 82–90. Elger, C.E., Helmstaedter, C., Kurthen, M., 2004. Chronic epilepsy and cognition. Lancet Neurol. 3, 663–672. Fujii, S., Kuroda, Y., Ito, K.L., Yoshioka, M., Kaneko, K., Yamazaki, Y., Sasaki, H., Kato, H., 2000. Endogenous adenosine regulates the effects of low-frequency stimulation on the induction of long-term potentiation in CA1 neurons of guinea pig hippocampal slices. Neurosci. Lett. 279, 121–124. Gaito, J., Nobrega, J.N., Gaito, S.T., 1980. Interference effect of 3 Hz brain stimulation on kindling behavior induced by 60 Hz stimulation. Epilepsia 21, 73–84. Genkova-Papazova, M.G., Lazarova-Bakarova, M.B., 1995. Pentylenetetrazole kindling impairs long-term memory in rats. Eur. Neuropsychopharmacol. 5, 53–56. Ghotbedin, Z., Janahmadi, M., Mirnajafi-Zadeh, J., Behzadi, G., Semnanian, S., 2013. Electrical low frequency stimulation of the kindling site preserves the electrophysiological properties of the rat hippocampal CA1 pyramidal neurons from the destructive effects of amygdala kindling: the basis for a possible promising epilepsy therapy. Brain Stimul. 6, 515–523. Gilbert, T.H., McNamara, R.K., Corcoran, M.E., 1996. Kindling of hippocampal field CA1 impairs spatial learning and retention in the Morris water maze. Behav. Brain Res. 82, 57–66. Glikmann-Johnston, Y., Saling, M.M., Chen, J., Cooper, K.A., Beare, R.J., Reutens, D.C., 2008. Structural and functional correlates of unilateral mesial temporal lobe spatial memory impairment. Brain 131, 3006–3018. Goddard, G.V., McIntyre, D.C., Leech, C.K., 1969. A permanent change in brain function resulting from daily electrical stimulation. Exp. Neurol. 25, 295–330.
44
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Goodman, J.H., Berger, R.E., Tcheng, T.K., 2005. Preemptive low-frequency stimulation decreases the incidence of amygdala-kindled seizures. Epilepsia 46, 1–7. Hannesson, D.K., Mohapel, P., Corcoran, M.E., 2001. Dorsal hippocampal kindling selectively impairs spatial learning/short-term memory. Hippocampus 11, 275–286. Helmstaedter, C., Kurthen, M., Lux, S., Reuber, M., Elger, C.E., 2003. Chronic epilepsy and cognition: a longitudinal study in temporal lobe epilepsy. Ann. Neurol. 54, 425–432. Hill, A.J., 1978. First occurrence of hippocampal spatial firing in a new environment. Exp. Neurol. 62, 282–297. Howland, J.G., Wang, Y.T., 2008. Synaptic plasticity in learning and memory: stress effects in the hippocampus. Prog. Brain Res. 169, 145–158. Hsiao, Y.T., Yi, P.L., Li, C.L., Chang, F.C., 2012. Effect of cannabidiol on sleep disruption induced by the repeated combination tests consisting of open field and elevated plus-maze in rats. Neuropharmacology 62, 373–384. Jahanshahi, A., Mirnajafi-Zadeh, J., Javan, M., Mohammad-Zadeh, M., Rohani, R., 2009. The antiepileptogenic effect of electrical stimulation at different low frequencies is accompanied with change in adenosine receptors gene expression in rats. Epilepsia 50, 1768–1779. Kalueff, A.V., Jensen, C.L., Murphy, D.L., 2007. Locomotory patterns, spatiotemporal organization of exploration and spatial memory in serotonin transporter knockout mice. Brain Res. 1169, 87–97. Kapur, J., Lothman, E.W., 1990. NMDA receptor activation mediates the loss of GABAergic inhibition induced by recurrent seizures. Epilepsy Res. 5, 103–111. Kitanaka, J., Kitanaka, N., Hall, F.S., Fujii, M., Goto, A., Kanda, Y., Koizumi, A., Kuroiwa, H., Mibayashi, S., Muranishi, Y., Otaki, S., Sumikawa, M., Tanaka, K., Nishiyama, N., Uhl, G.R., Takemura, M., 2015. Memory impairment and reduced exploratory behavior in mice after administration of systemic morphine. J. Exp. Neurosci. 9, 27–35. Klausnitzer, J., Kulla, A., Manahan-Vaughan, D., 2004. Role of the group III metabotropic glutamate receptor in LTP, depotentiation and LTD in dentate gyrus of freely moving rats. Neuropharmacology 46, 160–170. Kolb, B., Whishaw, I.Q., 1998. Brain plasticity and behavior. Annu. Rev. Psychol. 49, 43–64. Kuno, T., Mukai, H., Ito, A., Chang, C.D., Kishima, K., Saito, N., Tanaka, C., 1992. Distinct cellular expression of calcineurin A alpha and A beta in rat brain. J. Neurochem. 58, 1643–1651. Kurz, J.E., Sheets, D., Parsons, J.T., Rana, A., Delorenzo, R.J., Churn, S.B., 2001. A significant increase in both basal and maximal calcineurin activity in the rat pilocarpine model of status epilepticus. J. Neurochem. 78, 304–315. Kurz, J.E., Rana, A., Parsons, J.T., Churn, S.B., 2003. Status epilepticus-induced changes in the subcellular distribution and activity of calcineurin in rat forebrain. Neurobiol. Dis. 14, 483–493. Leite, J.P., Neder, L., Arisi, G.M., Carlotti Jr., C.G., Assirati, J.A., Moreira, J.E., 2005. Plasticity, synaptic strength, and epilepsy: what can we learn from ultrastructural data? Epilepsia 46 (Suppl. 5), 134–141. Leung, L.S., Shen, B., 1991. Hippocampal CA1 evoked response and radial 8-arm maze performance after hippocampal kindling. Brain Res. 555, 353–357. Leung, L.S., Shen, B., 2006. Hippocampal CA1 kindling but not long-term potentiation disrupts spatial memory performance. Learn. Mem. 13, 18–26. Leung, L.S., Boon, K.A., Kaibara, T., Innis, N.K., 1990. Radial maze performance following hippocampal kindling. Behav. Brain Res. 40, 119–129. Lie, A.A., Blumcke, I., Beck, H., Schramm, J., Wiestler, O.D., Elger, C.E., 1998. Altered patterns of Ca2+/calmodulin-dependent protein kinase II and calcineurin immunoreactivity in the hippocampus of patients with temporal lobe epilepsy. J. Neuropathol. Exp. Neurol. 57, 1078–1088. Lynch, M.A., 2004. Long-term potentiation and memory. Physiol. Rev. 84, 87–136. Macdonald, R.L., Kelly, K.M., 1993. Antiepileptic drug mechanisms of action. Epilepsia 34 (Suppl. 5), S1–S8. Manahan-Vaughan, D., Kulla, A., 2003. Regulation of depotentiation and long-term potentiation in the dentate gyrus of freely moving rats by dopamine D2-like receptors. Cereb. Cortex 13, 123–135. Mansuy, I.M., 2003. Calcineurin in memory and bidirectional plasticity. Biochem. Biophys. Res. Commun. 311, 1195–1208. Mazarati, A., 2008. Epilepsy and forgetfulness: one impairment, multiple mechanisms. Epilepsy Curr. 8, 25–26. McNaughton, B.L., Barnes, C.A., O’Keefe, J., 1983. The contributions of position, direction, and velocity to single unit activity in the hippocampus of freely-moving rats. Exp. Brain Res. 52, 41–49. Mohammad-Zadeh, M., Mirnajafi-Zadeh, J., Fathollahi, Y., Javan, M., Ghorbani, P., Sadegh, M., Noorbakhsh, S.M., 2007. Effect of low frequency stimulation of
perforant path on kindling rate and synaptic transmission in the dentate gyrus during kindling acquisition in rats. Epilepsy Res. 75, 154–161. Morimoto, K., 1989. Seizure-triggering mechanisms in the kindling model of epilepsy: collapse of GABA-mediated inhibition and activation of NMDA receptors. Neurosci. Biobehav. Rev. 13, 253–260. Morris, R.G., Garrud, P., Rawlins, J.N., O’Keefe, J., 1982. Place navigation impaired in rats with hippocampal lesions. Nature 297, 681–683. Mulkey, R.M., Endo, S., Shenolikar, S., Malenka, R.C., 1994. Involvement of a calcineurin/inhibitor-1 phosphatase cascade in hippocampal long-term depression. Nature 369, 486–488. Olton, D.S., Branch, M., Best, P.J., 1978a. Spatial correlates of hippocampal unit activity. Exp. Neurol. 58, 387–409. Olton, D.S., Walker, J.A., Gage, F.H., 1978b. Hippocampal connections and spatial discrimination. Brain Res. 139, 295–308. Olton, D.S., 1979. Mazes, maps, and memory. Am. Psychol. 34, 583–596. Ortinski, P., Meador, K.J., 2004. Cognitive side effects of antiepileptic drugs. Epilepsy Behav. 5 (Suppl. 1), S60–S65. Pallen, C.J., Wang, J.H., 1985. A multifunctional calmodulin-stimulated phosphatase. Arch. Biochem. Biophys. 237, 281–291. Paxinos, G., Watson, C.W., 1986. The Rat Brain in Stereotaxic Coordinates. Academic press, New York. Racine, R., Rose, P.A., Burnham, W.M., 1977. Afterdischarge thresholds and kindling rates in dorsal and ventral hippocampus and dentate gyrus. Can. J. Neurol. Sci. 4, 273–278. Racine, R., 1978. Kindling: the first decade. Neurosurgery 3, 234–252. Riedel, G., 1999. If phosphatases go up, memory goes down. Cell. Mol. Life Sci. 55, 549–553. Sadegh, M., Mirnajafi-Zadeh, J., Javan, M., Fathollahi, Y., Mohammad-Zadeh, M., Jahanshahi, A., Noorbakhsh, S.M., 2007. The role of galanin receptors in anticonvulsant effects of low-frequency stimulation in perforant path-kindled rats. Neuroscience 150, 396–403. Sanchez, R.M., Jensen, F.E., 2001. Maturational aspects of epilepsy mechanisms and consequences for the immature brain. Epilepsia 42, 577–585. Schiller, Y., Bankirer, Y., 2007. Cellular mechanisms underlying antiepileptic effects of low- and high-frequency electrical stimulation in acute epilepsy in neocortical brain slices in vitro. J. Neurophysiol. 97, 1887–1902. Schubert, M., Siegmund, H., Pape, H.C., Albrecht, D., 2005. Kindling-induced changes in plasticity of the rat amygdala and hippocampus. Learn. Mem. 12, 520–526. Shahpari, M., Mirnajafi-Zadeh, J., Firoozabadi, S.M., Yadollahpour, A., 2012. Effect of low-frequency electrical stimulation parameters on its anticonvulsant action during rapid perforant path kindling in rat. Epilepsy Res. 99, 69–77. Sierksma, A.S., van den Hove, D.L., Pfau, F., Philippens, M., Bruno, O., Fedele, E., Ricciarelli, R., Steinbusch, H.W., Vanmierlo, T., Prickaerts, J., 2014. Improvement of spatial memory function in APPswe/PS1dE9 mice after chronic inhibition of phosphodiesterase type 4D. Neuropharmacology 77, 120–130. Stretton, J., Winston, G.P., Sidhu, M., Bonelli, S., Centeno, M., Vollmar, C., Cleary, R.A., Williams, E., Symms, M.R., Koepp, M.J., Thompson, P.J., Duncan, J.S., 2013. Disrupted segregation of working memory networks in temporal lobe epilepsy. Neuroimage Clin. 2, 273–281. Sutherland, R.J., Whishaw, I.Q., Kolb, B., 1983. A behavioural analysis of spatial localization following electrolytic, kainate- or colchicine-induced damage to the hippocampal formation in the rat. Behav. Brain Res. 7, 133–153. Takaishi, T., Saito, N., Kuno, T., Tanaka, C., 1991. Differential distribution of the mRNA encoding two isoforms of the catalytic subunit of calcineurin in the rat brain. Biochem. Biophys. Res. Commun. 174, 393–398. Wang, J.H., Stelzer, A., 1994. Inhibition of phosphatase 2 B prevents expression of hippocampal long-term potentiation. Neuroreport 5, 2377–2380. Yang, L.X., Jin, C.L., Zhu-Ge, Z.B., Wang, S., Wei, E.Q., Bruce, I.C., Chen, Z., 2006. Unilateral low-frequency stimulation of central piriform cortex delays seizure development induced by amygdaloid kindling in rats. Neuroscience 138, 1089–1096. Zhang, B.W., Zimmer, G., Chen, J., Ladd, D., Li, E., Alt, F.W., Wiederrecht, G., Cryan, J., O’Neill, E.A., Seidman, C.E., Abbas, A.K., Seidman, J.G., 1996. T cell responses in calcineurin A alpha-deficient mice. J. Exp. Med. 183, 413–420. Zhuo, M., Zhang, W., Son, H., Mansuy, I., Sobel, R.A., Seidman, J., Kandel, E.R., 1999. A selective role of calcineurin aalpha in synaptic depotentiation in hippocampus. Proc. Natl. Acad. Sci. U. S. A. 96, 4650–4655. van Rijckevorsel, K., 2006. Cognitive problems related to epilepsy syndromes, especially malignant epilepsies. Seizure 15, 227–234.
Contents lists available at www.sciencedirect.com
Epilepsy Research journal homepage: www.elsevier.com/locate/epilepsyres
Effect of low frequency stimulation on impaired spontaneous alternation behavior of kindled rats in Y-maze test Samireh Ghafouri, Yaghoub Fathollahi, Mohammad Javan, Amir Shojaei, Azam Asgari, Javad Mirnajafi-Zadeh ∗ Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e
i n f o
Article history: Received 22 January 2016 Received in revised form 28 May 2016 Accepted 25 June 2016 Available online 26 June 2016 Keywords: Seizure Spontaneous alternation behavior Low-frequency stimulation Calcineurin Y-maze test
a b s t r a c t Epileptic seizures are characterized with cognitive disorders. In this study we investigated the effect of electrical low frequency stimulation (LFS), as a potential anticonvulsant agent, on kindled seizureinduced cognitive impairments. Animals were kindled through electrical stimulation of hippocampal CA1 area in a semi-rapid manner (12 stimulations/day). One group of animals received LFS 4 times at 0.5, 6.5, 24 and 30 h following the last kindling stimulation. Applied LFS was consisted of 4 packages at 5 min intervals. Each package contained 200 monophasic square wave pulses of 0.1 ms duration at 1 Hz. The Y-maze test was performed in all animals to measure the spontaneous alternation behavior. Kindled animals showed significant impairment in spontaneous alternation behavior compared to the control group. Application of LFS improved the observed impairment in spontaneous alternation behavior in kindled animals, so that there was no significant difference between kindled + LFS and control group. The observed improving effect of LFS was accompanied with a significant increase in calcineurin gene expression within the hippocampal area. Therefore, it may be postulated that application of LFS in kindled animals, which resulted in increment of calcineurin gene expression, can improve the seizure–induced impairment in spontaneous alternation behavior in Y-maze test. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Epilepsy is known as a common neurological disease which is characterized by repeated spontaneous seizures. In addition to recurrent seizures, patients with epilepsy frequently exhibit cognitive impairments, particularly in learning and memory related functions (Helmstaedter et al., 2003; Elger et al., 2004). Kindling is the most commonly used model of temporal lobe epilepsy which can be generated by repetitive and low-intensity electrical stimulation of limbic areas including the hippocampus (Goddard et al., 1969; Racine, 1978). Kindling is associated with long-lasting facilitation of synaptic transmission and therefore shares several features with long-term potentiation (LTP) (Cain, 1989; Cain et al., 1992). In previous studies conducted by this group, it was shown that semi-rapid kindling model (in which the animals receive 10–12 stimulations per day) can induce synaptic
Abbreviations: AD, afterdischarge; ADD, afterdischarge duration; LFS, lowfrequency stimulation. ∗ Corresponding author at: Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, PO Box 14115-331, Tehran, Iran. E-mail address: [email protected] (J. Mirnajafi-Zadeh). http://dx.doi.org/10.1016/j.eplepsyres.2016.06.010 0920-1211/© 2016 Elsevier B.V. All rights reserved.
potentiation which is similar to the potentiation induced during the traditional model of kindling (once or twice stimulations per day) (Mohammad-Zadeh et al., 2007; Jahanshahi et al., 2009). The kindling-induced increase in synaptic efficacy is not restricted to the first synaptic relay but extends gradually and successively to other synaptic stations in the stimulated circuit. Kindling leads to a significant impairment of LTP in different brain areas including the hippocampal CA1 region (Leite et al., 2005). Synaptic plasticity is an important physiological phenomenon which plays a key role in information processing and storage in the brain (Howland and Wang, 2008). This phenomenon occurs in brain regions underlying the expression of experience-dependent behaviors (Kolb and Whishaw, 1998). Disorders, such as epilepsy, which affect synaptic plasticity, may impair the learning and memory. Therefore, memory and learning deficiencies are notable consequences in chemical and/or electrical kindling models of seizure (Beldhuis et al., 1992; Genkova-Papazova and Lazarova-Bakarova, 1995). Several lines of evidences have shown that impairment in cognitive functions relates to the seizure focus, especially the hippocampal CA1 area which has an important role in spatial working memory (Olton et al., 1978b; Morris et al., 1982). It has been
38
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
previously revealed a correlation between the hippocampal CA1 degradation and memory impairment in experimental model of temporal lobe epilepsy (Leung and Shen, 2006) and there is a link between structural degradation and memory capacity in this area (Barnett et al., 2015). Similarly, spatial memory and working memory deficits are correlated with hippocampal sclerosis in patients with epilepsy (Glikmann-Johnston et al., 2008; Stretton et al., 2013). Therefore, measuring the spontaneous alternation behavior in Y-maze test (as a main test for spatial-working memory in rodents (Olton, 1979)) during hippocampal kindled seizures (as a model of temporal lobe epilepsy) is a suitable manner for studying the temporal lobe epilepsy-induced impairment in working memory. Despite remarkable number of studies has been conducted; there is still no absolute treatment for patients with epilepsy. Anticonvulsant medication, as the most common therapeutic method, only suppresses seizures rather than improving the abnormalities underlying epilepsy (Macdonald and Kelly, 1993). Moreover, general antiepileptic drugs may also induce cognitive side effects or exacerbate a previously existing cognitive deficit (Aldenkamp et al., 2003; Ortinski and Meador, 2004). With all this, it is necessary to find new strategies for reducing the seizure-induced impairments of learning and memory. Low-frequency electrical stimulation (LFS) is effective against kindled seizures (Gaito et al., 1980; Shahpari et al., 2012; Ghotbedin et al., 2013). Recently, we showed that application of LFS following kindling stimulations can prevent the kindlinginduced potentiation during the first 7 days of kindling acquisition (Mohammad-Zadeh et al., 2007). Application of LFS can induce long-term depression (LTD) (Fujii et al., 2000; Manahan-Vaughan and Kulla, 2003) and depotentiation (Manahan-Vaughan and Kulla, 2003; Klausnitzer et al., 2004). Therefore, it has been suggested that the anticonvulsant mechanisms of LFS may be similar to mechanisms involved in LTD or depotentiation (Schiller and Bankirer, 2007). Various molecules have been demonstrated to mediate LTD and depotentiation, including calcineurin A-␣ (Zhuo et al., 1999). Calcineurin is a member of the serine/threonine protein phosphatase family enriched in neural tissue (Pallen and Wang, 1985). It has been found that calcineurin A-␣ is the predominant isoform in the hippocampus (Takaishi et al., 1991; Kuno et al., 1992; Zhang et al., 1996). Calcineurin mediated dephosphorylation is important in controlling many cellular processes including development of learning and memory (Riedel, 1999; Mansuy, 2003), regulation of long-term potentiation (Wang and Stelzer, 1994) and modulation of neurotransmitter release (Cordeiro et al., 2000). In addition, calcineurin is essential for induction of LTD and depotentiation (Mulkey et al., 1994; Zhuo et al., 1999; Baumgartel and Mansuy, 2012). Therefore, the present study was an attempt to investigate the preventive effect of LFS application, as a potential anticonvulsant therapeutic manner, on kindling-induced impairment of spontaneous alternation behavior in a calcineurin related manner.
2. Material and methods Male Wistar rats (5–6 weeks old at the time of surgery) were housed individually in cages with an ambient temperature of 22 ◦ C–25 ◦ C and a 12-h light/12-h dark cycle (lights on from 6:00 a.m– 6np.m.). Animals were provided with water and food ad libitum. Experiments were carried out each day between 8:00 a.m.–6 p.m. All experimental and animal care procedures were performed according to international guidelines for the use of laboratory animals and approved by “Tarbiat Modares University Ethical Committee for Animal Research” which is in line with the “NIH Guide for the Care and Use of Laboratory Animals”. Efforts
were made to minimize both the number of animals used and their suffering. 2.1. Animal surgery The rats were deeply anesthetized by a ketamine/xylazine mixture (100/10 mg/kg, i.p.), fixed in a stereotaxic frame and their skull were exposed. A bipolar stimulating electrode and a monopolar recording electrode were twisted together and chronically implanted in the hippocampal CA1 region of the right hemisphere at 2.4 mm posterior and 1.8 mm lateral to the bregma and 2.8 mm below skull (Paxinos and Watson, 1986). These teflon-coated, stainless steel electrodes (A-M Systems, Inc., WA, U.S.A.; 127 m in diameter) were insulated except at their tips. A monopolar electrode connected to a stainless steel screw was also positioned in the skull above the occipital cortex as a reference and/or ground electrode. All electrodes were connected to pins of a lightweight multi-channel miniature socket as a head stage and fixed to the skull with dental acrylic. The electrode location was histologically confirmed in animals at the end of the experiments. To do this, rats were deeply anesthetized and perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Then, their brain was removed and sectioned to verify electrode placement. 2.2. Kindling procedure As it was explained previously (Sadegh et al., 2007), after a post-surgical recovery period of 7 days, the afterdischarge (AD) threshold was determined by 1 ms monophasic square wave of 50 Hz with 3 s train duration. Briefly, the stimulating currents were initially delivered at 30 A and then its intensity was increased in increments of 10 A at 10 min intervals until ADs of at least 8 s were recorded. The ADs were defined as spikes with a frequency of at least 1 Hz and amplitude of at least twice the baseline activity originating immediately post stimulation. Rats were electrically stimulated at the AD threshold 12 times a day with an interval of 10 min. Epileptiform ADs were continuously recorded from the hippocampal CA1 area following kindling stimulations using a PCbased data acquisition system (D3107; ScienceBeam Co., Tehran, Iran). The behavioral seizure severity was rated according to Racine’s scale (Racine et al., 1977): stage 0, rats showed no convulsion; stage 1, rats showed facial automatism; stage 2, head nodding, stage 3, unilateral forelimb clonus, stage 4, bilateral forelimb clonus; stage 5, rearing, falling and generalized convulsions. The animals were considered as fully kindled when they exhibited stage 5 seizure in three consecutive days. 2.3. Y-maze task The Y-maze test was done at least two weeks following the animal surgery (one week as a recovery period after surgery and one week as averaged time to reach fully kindled state). The Ymaze is a hippocampal dependent–spatial working memory task that requires rats to use external maze cues to navigate the identical internal arms. The Y-maze was chosen to reduce habituation time and provide a measure of spatial working memory and to limit stressful confounds such as food deprivation (radial arm maze) or forced swimming (water maze). The apparatus consisted of a black plastic maze with three arms (50 cm long, 32 cm high and 16 cm wide) that were intersected at 120◦ . A rat was placed at the end of one arm and allowed to move freely through the maze for 8 min without reinforcements, such as food and water. Entries into all arms were noted (4 paws had to be inside the arm for a valid entry) and a spontaneous alternation was counted if an animal entered three different arms consecutively. Percentage of sponta-
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
neous alternation was calculated according to following formula: [(number of alternations)/(total number of arm entries − 2)] × 100 (Sierksma et al., 2014; Kitanaka et al., 2015). To prevent a bias in data analysis, the Y-maze test was carried out in a blind manner by an experimenter. All behavioral tests were done at 4 p.m. to 5 p.m. 2.4. Open field test The open field arena was used to assess locomotor activity. The apparatus was made of a black wooden square arena (60 × 60 × 60 cm). After each session the arena was thoroughly cleaned using a 70% ethanol solution. The rat was placed in the center of the arena, being able to move around freely for 15 min. The movements of each rat were tracked automatically by using a video camera and home-made software. The total distance moved and the velocity of movement within 15 min was used as a measure of locomotor activity (Kalueff et al., 2007; Sierksma et al., 2014). In addition, the time spent in center of box was measured as an index of animal anxiety (Sanchez and Jensen, 2001; Hsiao et al., 2012). 2.5. RNA extraction, cDNA synthesis and quantitative real time-PCR experiments For quantitative real time-PCR (qRT-PCR), animals were sacrificed and their hippocampus were extracted immediately after Y-maze test in first experiment and preserved at −80 ◦ C temperature. (a) RNA preparation and reverse transcription: For gene expression study, total mRNA was isolated based on method of phenol-chloroform extraction (Ausubel et al., 1992), using total extraction kit (Parstous, Iran) according to the manufacturer’s instructions. The final total RNA pellet was air-dried and the RNA was suspended in 30 l of DEPC (diethyl-pyrocarbonate)-treated water. 1 l of total RNA was used for spectrophotometeric determination of the RNA concentration at 260 and 280 nm 2 l of total RNA were used to determine integrity and quality of RNA samples extracted in electrophoresis (Akhtarian, Iran) on 1% agarose gel (Fermentaz, Germany). The extracted RNA was entered into the cDNA construction phase. For each sample, cDNA synthesis was performed using 2 g of total RNA, 2 l Oligo-dT primer (Parstous, Iran) and 10 l reverse transcriptase (Parstous, Iran) based on the manufacture’s instruction. (b) qRT-PCR: The cDNA pool was subjected to qRT-PCR by using a Real Q-PCR Master Mix Kit (Ampliqon, Herlev, Denmark) on a Rotor-Gene Q device (Qiagen, Hilden, Germany). The following conditions were used for qRT-PCR: initial heating for 15 min at 95 ◦ C; 35 cycles of amplification, each composed of 60 s at 95 ◦ C; 60 s at the annealing temperature; and 60 s at 72 ◦ C. The annealing temperature for calcineurin A-␣ and PGK-1 was 60 ◦ C. PGK-1 was used as an endogenous control to minimize the effect of sample variations in calculating the relative expression level of target genes by the delta–delta-Ct method. We measured cycle threshold as an expression of calcineurin A-␣ gene. Primers for calcineurin A-␣ and PGK1 were purchase from CinnaGen, Iran (Table 1). 2.6. Experimental design In the first experiment, we examined the effect of LFS on kindling-induced memory impairment. Animals were assigned to 5 groups. In kindled group, fully kindled animals were tested by Y-maze 24 h following the last kindling stimulation (Fig. 1-A). Animals of kindled + LFS group received LFS as follows: first and second LFS were applied immediately and 6 h following the last kindling stimulation respectively; third and fourth LFS were applied on the next day in a similar manner (Fig. 1-A). Each LFS was consisted of 4 packages at 5 min intervals; each package contained 200 monopha-
39
sic square wave pulses of 0.1 ms duration at 1 Hz. LFS pattern was achieved according to our preliminary experiments on hippocampal CA1 area. The intensity for delivery of LFS was equal to AD threshold for each kindled rat. Animals were tested by Y-maze 2–3 h after the last LFS. In LFS group, animals were manipulated similar to kindled + LFS group, but received only LFS (without kindling stimulations). Another group of animals were underwent surgery but did not received any kind of stimulations and were considered as sham group. In this group, the elapsing time between surgery and behavioral test was similar to animals of kindled and/or kindled + LFS group (about 15 days). In control group, Y-maze test was done without undergoing surgery and any kind of stimulations. In the second experiment, we investigated the effect of LFS on kindling-induced memory impairment during 2 consecutive Y-maze tests in fully kindled animals while the LFS was applied after the first and before the second Y-maze test. Therefore, in this experiment we could compare the spontaneous alternation before and after LFS application. Similar to the first experiment, animals were divided into 5 groups. In kindled group, the first Y-maze test was performed 2–3 h following the last kindling stimulation. The second Y-maze test was done 24 h later (Fig. 1-B). In animals of kindled + LFS group, 2–3 h following the last kindling stimulation the first Y-maze test was carried out. Then, LFS was delivered for 4 times: two LFS were applied immediately and 6 h following the first Y-maze test. The other two LFSs were applied in a similar manner during the next day. The second Y-maze test was done 2–3 h after the last LFS (Fig. 1-B). In LFS group, animals were manipulated similar to kindled + LFS group, but received only LFS (without kindling stimulations). Another group of animals was underwent surgery but did not received any kind of stimulations and was considered as sham group. In control group, Y-maze test was done two times in intact animals. Open field test was done in all of the animals of first experiment before Y-maze test. In addition, in all groups of first experiment the hippocampal sampling was done for qRT-PCR immediately following the Y-maze test. 2.7. Statistical analysis Data were averaged and expressed as mean ± S.E.M. To evaluate the effect of kindling and LFS application on measured parameters, a two-way ANOVA followed by a post-hoc Tukey’s test was used to compare the percent of spontaneous alternation, total arm entries, traveled distance, velocity of movement and calcineurin A-␣ gene expression in different groups of experiments 1. In different groups of second experiment, the changes in percentage of spontaneous alternation and total arm entries between first and second Y-maze tests were compared by three-way ANOVA to evaluate the effect of kindling, LFS and number (first or second) of Y-maze test as three factors. Tukey’s test was used as post-hoc analysis whenever necessary. Spontaneous alternation in different experimental groups was also compared with that of a theoretical group performing at chance level of 50% by using a one-sample t-test. Linear regression analysis and nonparametric Spearman’s rank correlation test were carried out to find the correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test for each animal. P-value of less than 0.05 was considered to represent a significant difference. 3. Results There was no significant difference in AD threshold (90.0 ± 24.5 A in kindled and 116.7 ± 16.7 A in kindled + LFS group) and ADD after the first kindling stimulation (20.0 ± 2.6 s in kindled and 19.6 ± 1.9 s in kindled + LFS group) among dif-
40
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Table 1 Sequences of primers used in qRT-PCR. Gene
Forward
Reverse
Accession number
PGK 1 Calcineurin A-␣
GCCAAGTCGGTTGTGCTTATG TGACCACTTCCTGTTCACTTTTTTT
CCAGGAGGATGACAGTCCCA GCAAGAACATCCAACTGCTGAG
NM 053291.3 NM 017041.1
Fig. 1. Time-line diagram showing the experimental protocol used in experiment 1 (A) and experiment 2 (B) in kindled and kindled + LFS groups.
ferent experimental groups. In addition, the mean number of stimulation to achieve the fully kindled state was similar in kindled (8.6 ± 0.75 days) and kindled + LFS (8.0 ± 0.7 days) groups. Therefore, the seizure susceptibility was not different among experimental groups at the beginning of experiments. LFS alone had no significant effect on the spatial working memory. There was no significant difference in sham and control groups, thus, their data were merged and considered as control. In the first experiment we examined the spontaneous alternation behavior by Y- maze test. A two-way ANOVA showed no significant interaction of kindling × LFS factors among experimental groups (F(1,38) = 2.69, P = 0.11). However, LFS and kindling alone had significant effect on spontaneous alternation behavior (F(1,38) = 19.66, P < 0.001 and F(1, 38) = 19.75, P < 0.001, respectively). The post-hoc Tuckey’s test revealed that spontaneous alternation percentage of arm entries decreased in the kindled (55.40 ± 4.7%) compared to control group (78.13 ± 2.35%) significantly (P < 0.001). However, application of LFS prevented the kindling-induced impairment of spontaneous alternation behavior in kindled + LFS group, so that there was no significant difference between their spontaneous alternation rates (78.17 ± 1.85%) compared to control group. Application of LFS alone had no significant effect on this parameter (88.63 ± 3.32%) (Fig. 2A). In all different experimental groups, except the kindled group, spontaneous alternation was significantly (p < 0.001) above the chance level (50%). To get more confirmation of the preventive effect of LFS on kindling-induced spontaneous alternation behavior impairment, in the second experiment the Y-maze test was done before and after LFS application. A three-way ANOVA showed a significant interaction of kindling, LFS and number of Y-maze test between experimental groups (F(1,38) = 8.08, P < 0.05). By using the post-hoc Tukey’s test a significant reduction was observed in the percentage of spontaneous alternation during both first and second Y-maze test in kindled compared to control group (P < 0.001). There was no significant difference in this parameter during the first (56.8 ± 2.1%)
and second (61.2 ± 3.62%) Y-maze tests in kindled group. Application of LFS following the first Y-maze test increased the percentage of spontaneous alternation during the second Y-maze test, so that there was no significant difference between alternation rate in kindled + LFS (82.2 ± 2.35%) and control (86 ± 1.5%) groups during the second Y-maze test. Similar to kindled group, the alternation rate during the first Y-maze test (before application of LFS) of kindled + LFS group (55.40 ± 4.7%) was significantly (P < 0.001) lower than control (86.7 ± 2.6%). Obtained results revealed no significant difference between the percentage of spontaneous alternation in first and second Y-maze tests in control (86.7 ± 2.6% vs 86 ± 1.5%) and LFS (86.14 ± 1.8% vs 86.2 ± 1.9%) groups. Therefore, the observed changes in the percentage of spontaneous alternation before and after application of LFS in kindled + LFS group was due to delivery of LFS but not an effect of the first Y-maze test (Fig. 2B). Similar to the first experiment, all different experimental groups, but not kindled group, showed a spontaneous alternation in second Y-maze test which was significantly (p < 0.001) above the chance level (50%). The number of total arm entries was also measured in Y-maze test. In first experiment, a two-way ANOVA revealed significant difference in this parameter between experimental groups (F(1,29) = 14.27, P < 0.001). The post-hoc Tuckey’s test showed that there was significant increase in the number of total arm entries during Y-maze test in fully kindled animals which did not received LFS (P < 0.001, Fig. 2A). Similarly, a three-way AVOVA test showed significant difference in the number of total arm entries between experimental groups in second experiment (F(1,38) = 4.31, P < 0.05). The post-hoc Tuckey’s test showed that application of LFS in kindled + LFS group reduced this parameter in second Y-maze test compared to the first one (P < 0.001). To determine if the increased number of total arm entries in kindled animals is related to the difference in their locomotor activity, open field test was done. There was no significant difference in the mean of traveled distance (F(1,31) = 0.02, P = 0.88), the velocity of movements (F(1,32) = 0.57,
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
41
Fig. 2. Effect of LFS application on kindling-induced impairment in spontaneous alternation in Y-maze test. (A) Changes in percentage of spontaneous alternation (left) and total arm entries (right) in different groups of the first experiment. Kindled animals showed significant decrease in the percentage of spontaneous alternation and significant increase in the total arm entries. Application of LFS in fully kindled animals (kindled + LFS) prevented the kindling induced changes in these parameters and there was no significant difference between kindled + LFS and control group. (B) Changes in percentage of spontaneous alternation (left) and total arm entries (right) in different groups of the second experiment during the 1st (dark) and 2nd (light) Y-maze tests. Similar to first experiment, there was significant decrease in spontaneous alternation% and increase in total arm entries during 1st and 2nd Y-maze tests in kindled groups. In kindled + LFS group, application of LFS following the 1st Y-maze test, returned the parameters to control values during the 2nd Y-maze test. The lines connect data of the same animals in 1st and 2nd Y-maze test. In each group empty bar represents 1st Y-maze test and filled bar indicates 2nd Y-maze test. The travel distance (C, left), velocity (C, right) and center time (D) of animals in different experimental groups were also measured by open field test. There was no significant difference in these parameters between four groups. Application of LFS alone had no significant effect on measured parameters. Dashed-lines in A and B reflect the chance level (50%) of spontaneous alternation. The Data are shown as mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001.
P = 0.46) and center time (F(1,25) = 0.10, P = 0.76) during 15 min of open field test between different groups in first experiment (Fig. 2C and D). In addition, Tukey’s post test did not showed any significant difference between experimental groups. Therefore, the differences in Y maze performance were not due to a global change in locomotor activity. In the next step we measured the calcineurin A-␣ gene expression in experimental groups. A two-way ANOVA showed a significant difference in the gene expression between groups (F(1,22) = 9.35, P < 0.01). Tukey’s post test revealed no significant changes in calcineurin A-␣ gene expression in kindled group (0.55 ± 0.08) compared to control (1.05 ± 0.12). However, there was a significant increase in the expression of this gene in kindled + LFS (4.20 ± 0.92) group compared to control and kindled
groups (P < 0.05). Application of LFS alone had no significant effect on calcineurin A-␣ gene expression (1.86 ± 0.37) (Fig. 3B). In addition there was a significant correlation between the amount of calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test in kindled + LFS group (r = 0.78, P < 0.01, Fig. 4). 4. Discussion Our findings indicated that application of LFS in CA1 region of the dorsal hippocampus can prevent the kindled seizure-induced impairment of spontaneous alternation behavior in hippocampus of fully kindled animals. Several lines of evidence have implicated the important role of the hippocampus in spatial working memory.
42
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Fig. 3. Changes in calcineurin A-␣ gene expression in hippocampal CA1 region in different experimental groups. (A) Representative images for the expression of calcineurin A- ␣ gene in the hippocampus of control, LFS, kindled and kindled + LFS groups as measured by qRT-PCR. PGK-1 was used as an internal control. (B) Quantification data for qRT-PCR analysis of changes in the expression of calcineurin A␣ gene. As the figure shows, there was a significant increase in the expression of calcineurin A- ␣ gene in kindled + LFS group. No significant difference observed in kindled and LFS groups. Data are shown as mean ± SEM. * p < 0.05 compared to control group.
Fig. 4. Correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test in kindled + LFS group. Linear regression analysis showed a significant correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternation in Y-maze test. r = 0.78, P < 0.01.
Lesion of hippocampus impairs spatial working memory in young rats (Olton et al., 1978b; Morris et al., 1982; Sutherland et al., 1983; Dong et al., 2012). The hippocampus is hypothesized to represent a spatial map as neural firing which is correlated with the animal’s position in its environment (Hill, 1978; Olton et al., 1978a; McNaughton et al., 1983). In hippocampal neurons, spatial work-
ing memory is accompanied with LTP, a long lasting use-dependent modification of synaptic strength, which is thought to be a cellular substrate involved in learning and memory (Bliss and Collingridge, 1993; Lynch, 2004). In addition, alterations in hippocampal LTP has been shown to be involved in kindling-related learning deficits (Schubert et al., 2005; Mazarati, 2008). Therefore, the hippocampal kindling is a good model for studying the seizure-induced impairment in learning and memory. Previous studies have shown that hippocampal kindling can induce spatial memory deficits, as tested in the radial arm maze (Leung et al., 1990; Leung and Shen, 1991) or Morris’ water maze (Gilbert et al., 1996; Hannesson et al., 2001). The results of the present study also showed a significant impairment of spontaneous alternation behavior in Y-maze in kindled animals. Kindling procedure is associated with a special kind of synaptic potentiation which is similar to LTP (Cain, 1989; Cain et al., 1992). This potentiation reduces the ability of hippocampal synapses to express a new plasticity (especially in the form of LTP). This kindling-induced impairment in synaptic plasticity can account for disruption of learning and memory in kindled animals (Schubert et al., 2005). In addition, an impaired physiological balance between excitatory and inhibitory transmitters in kindled animals may be involved in reducing the expression of new synaptic plasticity (Morimoto, 1989; Kapur and Lothman, 1990). Patients with epilepsy have difficulties with learning and attention (van Rijckevorsel, 2006). Most of antiepileptic drugs can also induce cognitive side effects or exacerbate a previously existing cognitive deficit (Aldenkamp et al., 2003; Ortinski and Meador, 2004). Our results showed that application of LFS can reduce the kindled seizure-induced impairment of spontaneous alternation behavior in Y-maze test. Thus, it can be considered as a positive effect of LFS (which is potentially a novel therapeutic strategy in patients with epilepsy (Goodman et al., 2005; Yang et al., 2006)) compared to antiepileptic drugs. LFS (1–3 Hz) induces long-term depression (LTD) (Fujii et al., 2000; Manahan-Vaughan and Kulla, 2003) and depotentiation (Manahan-Vaughan and Kulla, 2003; Klausnitzer et al., 2004). Therefore, the improving effect of LFS on Y-maze performance of fully kindled rats may be somehow related to its suppressing effect on kindling-induced synaptic potentiation. In this regard, our previous experiments also showed that application of LFS retarded the perforant path kindling acquisition and prevented kindling-induced synaptic potentiation in perforant path-granular cells synapses (Mohammad-Zadeh et al., 2007; Jahanshahi et al., 2009). In the first experiment, the significant increase of the spontaneous alternation in kindled + LFS compared to kindled group clearly showed the improving effect of LFS on kindling-induced deficiency in Y-maze performance. However, to confirm that animals of kindled + LFS group had spontaneous alternation behavior impairment following the fully kindled state, a second set of experiments were carried out. In these experiments the first Y-maze test in kindled + LFS group showed a significant reduction in spontaneous alternation in animals of this group. Application of LFS restored the kindling-induced impairment of spontaneous alternation behavior toward its normal values during the second Y-maze test in these animals. The positive effect of LFS on Y-maze performance may be potentially considered as an index of its effectiveness in improving the kindling-induced memory impairment. However, it needs to use other behavioral tests for more confirmation. Therefore, it is possible to consider the observed changes in the spontaneous alternation behavior as impairment in memory. In this study, Y-maze test was performed shortly after the last kindling stimulation. Because the short effects of kindling may be differ from its permanent impairment in learning and memory (which could last up to 4 weeks after the kindling (Leung et al.,
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
1990; Leung and Shen, 1991)), the findings of the present study should be confirmed by testing the animals 1–2 weeks after the last kindled seizure. For this purpose, in another experiment we showed that the improving effects of LFS in Moriss water maze test remain up to one week following the last kindling stimulation (unpublished data). In our study, the total arm entries in kindled group during both first and second experiments and in kindled + LFS group during the first Y-maze test of second experiment were more than control. This may be as a result of the increase in locomotor activity of kindled rats. However, open field test showed no significant difference in traveled distance and velocity of movement among different groups of animals. Therefore, the observed difference in total number of entrance was not related to the variation in motor activity. In addition, it was not related to changes in animal’s anxiety as there was no significance difference in the time spent in the center of open field box in kindled compared to control group. In our experiments, the increment of the total arm entries may be considered as a result of memory impairment; however, this conclusion needs more behavioral experiments to be confirmed. One interesting finding of this study was the effect of LFS application on calcineurin A-␣ gene expression. While kindling acquisition had no significant effect on gene expression of calcineurin A-␣, administration of LFS in fully kindled animals significantly increased it compared to control group. Previous studies have shown that seizure and hyperexcitability are accompanied with the increase in calcineurin activity (Kurz et al., 2001; Kurz et al., 2003; Eckel et al., 2015). However, another study has demonstrated that seizure-induced increase in the activity of calcineurin is not accompanied with its gene expression (Kurz et al., 2001). On the other hand, the down-regulation of calcineurin in patients with epilepsy has also been reported (Lie et al., 1998). Regardless of any changes in calcineurin A-␣ gene expression during kindling, it is important to note that in our experiments the increase in calcineurin gene expression was observed following application of LFS. Generally, calcineurin is thought to play a critical role in synaptic plasticity (Bliss and Collingridge, 1993) and some studies have provided genetic evidences on the important role of the A␣ isoform of calcineurin in the reversal of LTP in the hippocampus (Zhuo et al., 1999; Baumgartel and Mansuy, 2012). On the other hand, many researchers have suggested that the inhibitory action of LFS on kindled seizures may be through the mechanisms involved in depotentiation (Goodman et al., 2005; Yang et al., 2006). Therefore, it may be postulated that application of LFS in hippocampal CA1 area affects the expression of some genes, including calcineurin A-␣, through a depotentiation-like mechanism. However, the exact mechanism of LFS action needs to be investigated. This effect may return the ability of synaptic plasticity to the hippocampal circuits which is necessary for learning and memory. The significant correlation between calcineurin A-␣ gene expression and the percentage of spontaneous alternations in Y-maze test also confirms the probable role of calcineurin in the observed effect of LFS in kindled + LFS group. However, to confirm the role of calcineurin, it will be helpful to check the effect of calcineurin inhibitor on LFS effects. In addition, considering the involvement of multiple complex molecular mechanisms in memory, measurement of calcineurin alone provides limited insights. Therefore, it is necessary to evaluate the role other molecules in mediating the LFS effects. During stimulation of hippocampal CA1 area, the dentate gyrus is also stimulated in an ortodromic and antidromic manner. In addition, the calcineurin gene expression was measured in the whole hippocampal areas and dentate gyrus. Therefore, considering the important role of dentate gyrus in cognitive functions of the hippocampal formation, at least part of the difference in spontaneous alternation and in calcineurin A-␣ gene expression between the
43
experimental groups may be related to the changes in the activity of dentate gyrus neurons. 5. Conclusion Taking together, results of the present study showed that application of LFS could reduce the Y-maze performance impairment in kindled rats and this effect is accompanied with the increase in calcineurin A-␣ gene expression. However, it is necessary to measure the enzyme activity and post-translational changes of calcineurin for better determining of its role. Conflict of interest None. Acknowledgement This study was supported by a grant from Tarbiat Modares University, Iran. References Aldenkamp, A.P., De Krom, M., Reijs, R., 2003. Newer antiepileptic drugs and cognitive issues. Epilepsia 44 (Suppl. 4), 21–29. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., 1992. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. Greene Pub. Associates, New York, pp. 232. Barnett, A.J., Park, M.T., Pipitone, J., Chakravarty, M.M., McAndrews, M.P., 2015. Functional and structural correlates of memory in patients with mesial temporal lobe epilepsy. Front. Neurol. 6, 103. Baumgartel, K., Mansuy, I.M., 2012. Neural functions of calcineurin in synaptic plasticity and memory. Learn. Mem. 19, 375–384. Beldhuis, H.J., Everts, H.G., Van der Zee, E.A., Luiten, P.G., Bohus, B., 1992. Amygdala kindling-induced seizures selectively impair spatial memory. 2. Effects on hippocampal neuronal and glial muscarinic acetylcholine receptor. Hippocampus 2, 411–419. Bliss, T.V., Collingridge, G.L., 1993. A synaptic model of memory: long-term potentiation in the hippocampus. Nature 361, 31–39. Cain, D.P., Boon, F., Hargreaves, E.L., 1992. Evidence for different neurochemical contributions to long-term potentiation and to kindling and kindling-induced potentiation: role of NMDA and urethane-sensitive mechanisms. Exp. Neurol. 116, 330–338. Cain, D.P., 1989. Long-term potentiation and kindling: how similar are the mechanisms? Trends Neurosci. 12, 6–10. Cordeiro, J.M., Meireles, S.M., Vale, M.G., Oliveira, C.R., Goncalves, P.P., 2000. Ca(2+) regulation of the carrier-mediated gamma-aminobutyric acid release from isolated synaptic plasma membrane vesicles. Neurosci. Res. 38, 385–395. Dong, Z., Gong, B., Li, H., Bai, Y., Wu, X., Huang, Y., He, W., Li, T., Wang, Y.T., 2012. Mechanisms of hippocampal long-term depression are required for memory enhancement by novelty exploration. J. Neurosci. 32, 11980–11990. Eckel, R., Szulc, B., Walker, M.C., Kittler, J.T., 2015. Activation of calcineurin underlies altered trafficking of alpha2 subunit containing GABAA receptors during prolonged epileptiform activity. Neuropharmacology 88, 82–90. Elger, C.E., Helmstaedter, C., Kurthen, M., 2004. Chronic epilepsy and cognition. Lancet Neurol. 3, 663–672. Fujii, S., Kuroda, Y., Ito, K.L., Yoshioka, M., Kaneko, K., Yamazaki, Y., Sasaki, H., Kato, H., 2000. Endogenous adenosine regulates the effects of low-frequency stimulation on the induction of long-term potentiation in CA1 neurons of guinea pig hippocampal slices. Neurosci. Lett. 279, 121–124. Gaito, J., Nobrega, J.N., Gaito, S.T., 1980. Interference effect of 3 Hz brain stimulation on kindling behavior induced by 60 Hz stimulation. Epilepsia 21, 73–84. Genkova-Papazova, M.G., Lazarova-Bakarova, M.B., 1995. Pentylenetetrazole kindling impairs long-term memory in rats. Eur. Neuropsychopharmacol. 5, 53–56. Ghotbedin, Z., Janahmadi, M., Mirnajafi-Zadeh, J., Behzadi, G., Semnanian, S., 2013. Electrical low frequency stimulation of the kindling site preserves the electrophysiological properties of the rat hippocampal CA1 pyramidal neurons from the destructive effects of amygdala kindling: the basis for a possible promising epilepsy therapy. Brain Stimul. 6, 515–523. Gilbert, T.H., McNamara, R.K., Corcoran, M.E., 1996. Kindling of hippocampal field CA1 impairs spatial learning and retention in the Morris water maze. Behav. Brain Res. 82, 57–66. Glikmann-Johnston, Y., Saling, M.M., Chen, J., Cooper, K.A., Beare, R.J., Reutens, D.C., 2008. Structural and functional correlates of unilateral mesial temporal lobe spatial memory impairment. Brain 131, 3006–3018. Goddard, G.V., McIntyre, D.C., Leech, C.K., 1969. A permanent change in brain function resulting from daily electrical stimulation. Exp. Neurol. 25, 295–330.
44
S. Ghafouri et al. / Epilepsy Research 126 (2016) 37–44
Goodman, J.H., Berger, R.E., Tcheng, T.K., 2005. Preemptive low-frequency stimulation decreases the incidence of amygdala-kindled seizures. Epilepsia 46, 1–7. Hannesson, D.K., Mohapel, P., Corcoran, M.E., 2001. Dorsal hippocampal kindling selectively impairs spatial learning/short-term memory. Hippocampus 11, 275–286. Helmstaedter, C., Kurthen, M., Lux, S., Reuber, M., Elger, C.E., 2003. Chronic epilepsy and cognition: a longitudinal study in temporal lobe epilepsy. Ann. Neurol. 54, 425–432. Hill, A.J., 1978. First occurrence of hippocampal spatial firing in a new environment. Exp. Neurol. 62, 282–297. Howland, J.G., Wang, Y.T., 2008. Synaptic plasticity in learning and memory: stress effects in the hippocampus. Prog. Brain Res. 169, 145–158. Hsiao, Y.T., Yi, P.L., Li, C.L., Chang, F.C., 2012. Effect of cannabidiol on sleep disruption induced by the repeated combination tests consisting of open field and elevated plus-maze in rats. Neuropharmacology 62, 373–384. Jahanshahi, A., Mirnajafi-Zadeh, J., Javan, M., Mohammad-Zadeh, M., Rohani, R., 2009. The antiepileptogenic effect of electrical stimulation at different low frequencies is accompanied with change in adenosine receptors gene expression in rats. Epilepsia 50, 1768–1779. Kalueff, A.V., Jensen, C.L., Murphy, D.L., 2007. Locomotory patterns, spatiotemporal organization of exploration and spatial memory in serotonin transporter knockout mice. Brain Res. 1169, 87–97. Kapur, J., Lothman, E.W., 1990. NMDA receptor activation mediates the loss of GABAergic inhibition induced by recurrent seizures. Epilepsy Res. 5, 103–111. Kitanaka, J., Kitanaka, N., Hall, F.S., Fujii, M., Goto, A., Kanda, Y., Koizumi, A., Kuroiwa, H., Mibayashi, S., Muranishi, Y., Otaki, S., Sumikawa, M., Tanaka, K., Nishiyama, N., Uhl, G.R., Takemura, M., 2015. Memory impairment and reduced exploratory behavior in mice after administration of systemic morphine. J. Exp. Neurosci. 9, 27–35. Klausnitzer, J., Kulla, A., Manahan-Vaughan, D., 2004. Role of the group III metabotropic glutamate receptor in LTP, depotentiation and LTD in dentate gyrus of freely moving rats. Neuropharmacology 46, 160–170. Kolb, B., Whishaw, I.Q., 1998. Brain plasticity and behavior. Annu. Rev. Psychol. 49, 43–64. Kuno, T., Mukai, H., Ito, A., Chang, C.D., Kishima, K., Saito, N., Tanaka, C., 1992. Distinct cellular expression of calcineurin A alpha and A beta in rat brain. J. Neurochem. 58, 1643–1651. Kurz, J.E., Sheets, D., Parsons, J.T., Rana, A., Delorenzo, R.J., Churn, S.B., 2001. A significant increase in both basal and maximal calcineurin activity in the rat pilocarpine model of status epilepticus. J. Neurochem. 78, 304–315. Kurz, J.E., Rana, A., Parsons, J.T., Churn, S.B., 2003. Status epilepticus-induced changes in the subcellular distribution and activity of calcineurin in rat forebrain. Neurobiol. Dis. 14, 483–493. Leite, J.P., Neder, L., Arisi, G.M., Carlotti Jr., C.G., Assirati, J.A., Moreira, J.E., 2005. Plasticity, synaptic strength, and epilepsy: what can we learn from ultrastructural data? Epilepsia 46 (Suppl. 5), 134–141. Leung, L.S., Shen, B., 1991. Hippocampal CA1 evoked response and radial 8-arm maze performance after hippocampal kindling. Brain Res. 555, 353–357. Leung, L.S., Shen, B., 2006. Hippocampal CA1 kindling but not long-term potentiation disrupts spatial memory performance. Learn. Mem. 13, 18–26. Leung, L.S., Boon, K.A., Kaibara, T., Innis, N.K., 1990. Radial maze performance following hippocampal kindling. Behav. Brain Res. 40, 119–129. Lie, A.A., Blumcke, I., Beck, H., Schramm, J., Wiestler, O.D., Elger, C.E., 1998. Altered patterns of Ca2+/calmodulin-dependent protein kinase II and calcineurin immunoreactivity in the hippocampus of patients with temporal lobe epilepsy. J. Neuropathol. Exp. Neurol. 57, 1078–1088. Lynch, M.A., 2004. Long-term potentiation and memory. Physiol. Rev. 84, 87–136. Macdonald, R.L., Kelly, K.M., 1993. Antiepileptic drug mechanisms of action. Epilepsia 34 (Suppl. 5), S1–S8. Manahan-Vaughan, D., Kulla, A., 2003. Regulation of depotentiation and long-term potentiation in the dentate gyrus of freely moving rats by dopamine D2-like receptors. Cereb. Cortex 13, 123–135. Mansuy, I.M., 2003. Calcineurin in memory and bidirectional plasticity. Biochem. Biophys. Res. Commun. 311, 1195–1208. Mazarati, A., 2008. Epilepsy and forgetfulness: one impairment, multiple mechanisms. Epilepsy Curr. 8, 25–26. McNaughton, B.L., Barnes, C.A., O’Keefe, J., 1983. The contributions of position, direction, and velocity to single unit activity in the hippocampus of freely-moving rats. Exp. Brain Res. 52, 41–49. Mohammad-Zadeh, M., Mirnajafi-Zadeh, J., Fathollahi, Y., Javan, M., Ghorbani, P., Sadegh, M., Noorbakhsh, S.M., 2007. Effect of low frequency stimulation of
perforant path on kindling rate and synaptic transmission in the dentate gyrus during kindling acquisition in rats. Epilepsy Res. 75, 154–161. Morimoto, K., 1989. Seizure-triggering mechanisms in the kindling model of epilepsy: collapse of GABA-mediated inhibition and activation of NMDA receptors. Neurosci. Biobehav. Rev. 13, 253–260. Morris, R.G., Garrud, P., Rawlins, J.N., O’Keefe, J., 1982. Place navigation impaired in rats with hippocampal lesions. Nature 297, 681–683. Mulkey, R.M., Endo, S., Shenolikar, S., Malenka, R.C., 1994. Involvement of a calcineurin/inhibitor-1 phosphatase cascade in hippocampal long-term depression. Nature 369, 486–488. Olton, D.S., Branch, M., Best, P.J., 1978a. Spatial correlates of hippocampal unit activity. Exp. Neurol. 58, 387–409. Olton, D.S., Walker, J.A., Gage, F.H., 1978b. Hippocampal connections and spatial discrimination. Brain Res. 139, 295–308. Olton, D.S., 1979. Mazes, maps, and memory. Am. Psychol. 34, 583–596. Ortinski, P., Meador, K.J., 2004. Cognitive side effects of antiepileptic drugs. Epilepsy Behav. 5 (Suppl. 1), S60–S65. Pallen, C.J., Wang, J.H., 1985. A multifunctional calmodulin-stimulated phosphatase. Arch. Biochem. Biophys. 237, 281–291. Paxinos, G., Watson, C.W., 1986. The Rat Brain in Stereotaxic Coordinates. Academic press, New York. Racine, R., Rose, P.A., Burnham, W.M., 1977. Afterdischarge thresholds and kindling rates in dorsal and ventral hippocampus and dentate gyrus. Can. J. Neurol. Sci. 4, 273–278. Racine, R., 1978. Kindling: the first decade. Neurosurgery 3, 234–252. Riedel, G., 1999. If phosphatases go up, memory goes down. Cell. Mol. Life Sci. 55, 549–553. Sadegh, M., Mirnajafi-Zadeh, J., Javan, M., Fathollahi, Y., Mohammad-Zadeh, M., Jahanshahi, A., Noorbakhsh, S.M., 2007. The role of galanin receptors in anticonvulsant effects of low-frequency stimulation in perforant path-kindled rats. Neuroscience 150, 396–403. Sanchez, R.M., Jensen, F.E., 2001. Maturational aspects of epilepsy mechanisms and consequences for the immature brain. Epilepsia 42, 577–585. Schiller, Y., Bankirer, Y., 2007. Cellular mechanisms underlying antiepileptic effects of low- and high-frequency electrical stimulation in acute epilepsy in neocortical brain slices in vitro. J. Neurophysiol. 97, 1887–1902. Schubert, M., Siegmund, H., Pape, H.C., Albrecht, D., 2005. Kindling-induced changes in plasticity of the rat amygdala and hippocampus. Learn. Mem. 12, 520–526. Shahpari, M., Mirnajafi-Zadeh, J., Firoozabadi, S.M., Yadollahpour, A., 2012. Effect of low-frequency electrical stimulation parameters on its anticonvulsant action during rapid perforant path kindling in rat. Epilepsy Res. 99, 69–77. Sierksma, A.S., van den Hove, D.L., Pfau, F., Philippens, M., Bruno, O., Fedele, E., Ricciarelli, R., Steinbusch, H.W., Vanmierlo, T., Prickaerts, J., 2014. Improvement of spatial memory function in APPswe/PS1dE9 mice after chronic inhibition of phosphodiesterase type 4D. Neuropharmacology 77, 120–130. Stretton, J., Winston, G.P., Sidhu, M., Bonelli, S., Centeno, M., Vollmar, C., Cleary, R.A., Williams, E., Symms, M.R., Koepp, M.J., Thompson, P.J., Duncan, J.S., 2013. Disrupted segregation of working memory networks in temporal lobe epilepsy. Neuroimage Clin. 2, 273–281. Sutherland, R.J., Whishaw, I.Q., Kolb, B., 1983. A behavioural analysis of spatial localization following electrolytic, kainate- or colchicine-induced damage to the hippocampal formation in the rat. Behav. Brain Res. 7, 133–153. Takaishi, T., Saito, N., Kuno, T., Tanaka, C., 1991. Differential distribution of the mRNA encoding two isoforms of the catalytic subunit of calcineurin in the rat brain. Biochem. Biophys. Res. Commun. 174, 393–398. Wang, J.H., Stelzer, A., 1994. Inhibition of phosphatase 2 B prevents expression of hippocampal long-term potentiation. Neuroreport 5, 2377–2380. Yang, L.X., Jin, C.L., Zhu-Ge, Z.B., Wang, S., Wei, E.Q., Bruce, I.C., Chen, Z., 2006. Unilateral low-frequency stimulation of central piriform cortex delays seizure development induced by amygdaloid kindling in rats. Neuroscience 138, 1089–1096. Zhang, B.W., Zimmer, G., Chen, J., Ladd, D., Li, E., Alt, F.W., Wiederrecht, G., Cryan, J., O’Neill, E.A., Seidman, C.E., Abbas, A.K., Seidman, J.G., 1996. T cell responses in calcineurin A alpha-deficient mice. J. Exp. Med. 183, 413–420. Zhuo, M., Zhang, W., Son, H., Mansuy, I., Sobel, R.A., Seidman, J., Kandel, E.R., 1999. A selective role of calcineurin aalpha in synaptic depotentiation in hippocampus. Proc. Natl. Acad. Sci. U. S. A. 96, 4650–4655. van Rijckevorsel, K., 2006. Cognitive problems related to epilepsy syndromes, especially malignant epilepsies. Seizure 15, 227–234.