- Email: [email protected]
Effect of marbofloxacin on mycoplasma carrier state and sperm quality in goat bucks
Small Ruminant Research 112 (2013) 186–190
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Effect of marbofloxacin on mycoplasma carrier state and sperm quality in goat bucks Ángel Gómez-Martín, Antonio Sánchez, Joaquín Amores, Juan C. Corrales, Antonio Contreras, Christian De la Fe ∗ Departamento de Sanidad Animal, Facultad de Veterinaria, Campus de Excelencia Internacional Regional “Campus Mare Nostrum”, Universidad de Murcia, Campus de Espinardo s/n, Murcia 30100, Spain
a r t i c l e
i n f o
Article history: Received 3 July 2012 Received in revised form 26 October 2012 Accepted 29 October 2012 Available online 23 November 2012 Keywords: Contagious agalactia Goat bucks Carriers Marbofloxacin Semen quality
a b s t r a c t The presence of goat males carriers of the main causal agents of contagious agalactia, Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc), is a high risk factor for the spread of the infection in artificial insemination centres. The present study was designed to assess the efficacy of a 5 day course of marbofloxacin given intramuscularly (2 mg kg−1 day−1 ) in terms of its capacity to reverse the carrier state of goat buck populations naturally infected with one or both mycoplasmas (Mmc, n = 25; Mmc + Ma, n = 2). Before and after treatment, ear swabs and semen samples were culture- and PCR-checked for both mycoplasmas. We also evaluated the impact of this treatment on semen quality (sperm count, motility and daily sperm production) by monitoring these variables of 594 semen samples collected during pre- and post-treatment periods of 48 days each. All bucks examined tested positive for the presence of Ma and Mmc before and after treatment though Mycoplasma spp. never was identified in semen. Sperm motility was significantly reduced in response to treatment (from 72.9% to 56.9%), although some recovery was observed at the end of the study (40 days after treatment). Ejaculate volume and concentration remained unchanged throughout the study. Our findings indicate that systemic marbofloxacin therapy is unable to eliminate mycoplasmas from the external auditory canal of male goats, and that it also causes a transient detrimental effect on sperm motility. Other strategies to control the presence of mycoplasma carriers in goat artificial insemination centres need to be assessed. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Contagious agalactia (CA) is a serious disease that affects small dairy ruminants causing mastitis, arthritis, conjunctivitis, abortion and pneumonia. CA is listed by the World Organization for Animal Health (OIE) and results in high economic losses in all affected areas (Bergonier et al., 1997). The epidemiological situation is particularly complex in chronically infected goat herds reared in CA endemic
∗ Corresponding author. Tel.: +34 868887259; fax: +34 868884147. E-mail address: [email protected] (C. De la Fe). 0921-4488/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2012.10.012
areas, where a high number of asymptomatic carriers of Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc) in the external auditory canal are reported (Mercier et al., 2007), even in semen-collection centres (Amores et al., 2011). In some of these carriers, the presence of Ma and Mmc in goat semen has been recently reported (De la Fe et al., 2009; Gómez-Martín et al., 2012a). Also, these findings seem to confirm the ability of both bacteria to colonize several others anatomical locations including testicle, bulbourethral gland and urethra in the auricular carriers (Gómez-Martín et al., 2012b). Based on the demonstrated pathogenic capacity of mycoplasma isolates from the ears in goats (Tardy et al., 2011), the systemic
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
presence of Mmc and Ma in auricular carriers represents an added risk factor to spread the infection (Gómez-Martín et al., 2012b). Mycoplasmas could colonize the auditory canal via the existing communication between the respiratory system and the middle ear (Gómez-Martín et al., 2012b). In calves (Walz et al., 1997) and swine (Kazama et al., 1994), colonization of nasopharynx by mycoplasma was suggested to precede eustachitis, sinusitis and otitis media. Also it is postulated that otitis media could be secondary to bacteraemia resulting from infection of lungs by mycoplasma (Walz et al., 1997). In clinically normal goats, Cottew and Yeats (1982) found simultaneous infections of mycoplasmas associated with CA in the external ear canal, middle ears and tonsillar crypts which is in agreement with the recent detection of systemic infection and pathology in male goats that were auricular carriers of Mmc (Gómez-Martín et al., 2012b). Previously, the capacity of Ma, Mmc and Mc to colonize external ear in goats and lambs during or after mycoplasmaemia was shown experimentally (De la Fe et al., 2011; Damassa and Brooks, 1991). All these data could justify the need to evaluate a systemic treatment in the auricular goat male carriers. Antibiotic therapy is the current approach to CA clinical outbreaks and among the treatments of choice are fluoroquinolones (Bergonier et al., 1997). Also, in vitro study has revealed the greater effect of quinolones against Ma compared to the antibiotics more commonly used to treat CA (Loria et al., 2003). Marbofloxacin, a new synthetic fluoroquinolone, has an intense in vivo anti-mycoplasmal effect against Mycoplasma capricolum subsp. capripneumoniae (Balikci et al., 2008) or against respiratory infections by Mycoplasma spp. of lambs (Skoufos et al., 2007). The pharmacokinetic behaviour of marbofloxacin in goats has been evaluated (Waxman et al., 2001) and its wide tissue distribution, high bioavailability and long half-life have made this antibiotic a promising candidate for CA control. In this sense, the high capacity shown by quinolones to penetrate testicular tissues and fluids makes them ideal for the treatment of goat males auricular carriers with systemic infections. Although, as observed for other therapeutic agents, their use may influence semen quality (Abd-Allah et al., 2000). Adverse effects of quinolones on the quality of goat semen have not been extensively studied, and there is
187
a need for this to be investigated, especially in animals of high genetic value. Based on these data, we hypothesized that the systemic use of this antibiotic could be effective to eliminate the mycoplasmas located in the auricular canal and the probable systemic infection associated. Their effectiveness could avoid control measures such as culling infected semenproviding bucks or other strategies with repercussions on the physiology of these animals, with the associated loss of genetic potential. This study was designed to evaluate the capacity of marbofloxacin to eliminate mycoplasmas causing CA (Mmc and Ma) from the auricular canal of asymptomatic goats male and the effects of treatment on semen quality. 2. Materials and methods 2.1. Population The study population comprised 27 bucks aged 2–7, weighing 50–70 kg of a native goat breed (Murciano-Granadina), taken from a semen collection centre. All animals were diagnosed by culture and PCR as auricular carriers of Mmc (n = 25) and two of the bucks were coinfected with Ma (n = 2) (Table 1). Animals were tested free of tuberculosis, paratuberculosis, contagious caprine pleuropneumonia, scrapie, brucellosis, bluetongue, caprine arthritis encephalitis virus and border disease. During the study period, the bucks were not subjected to changes in dietary habits and stressful conditions. 2.2. Design of the study and sample collection The study period was 101 days long. Table 1 shows the timecourse of the experiment indicating the sampling times. All bucks were administered a 10% aqueous solution of marbofloxacin intramusculary, Marbocyl® (Vetoquinol, Madrid, Spain) daily (2 mg/kg bodyweight) for five consecutive days (days 0–4), following the manufacturer recommends. Mycoplasma infection was confirmed 12 days prior to treatment onset by examination of two ear swab samples and one semen sample from each animal. To assess the efficacy of treatment, two ear swab samples and one semen sample were taken 4 days post-treatment. Ear swabs were placed in semi-solid transport medium (Sterile Transport Swab, Copan, Brescia, Italy). Samples were transported to the laboratory at 4 ◦ C, where they were processed on the day of collection. All ear swabs (n = 108) and semen samples (n = 54) collected over the study period were processed as previously described (Amores et al., 2011) and aliquots obtained for culture or PCR. The effect of antibiotic treatment on semen quality was also analyzed (Table 1). In a defined reproductive season, pre- and post-treatment periods of 48 days each were established. Each of these 48-day periods was divided into four 12-day intervals (days −48 to −36, −36 to −24, −24 to −12 and −12 to 0 pre-treatment; and days 4–16, 16–28, 28–40, and 40–52 post-treatment). During these intervals, we determined semen
Table 1 Time-line for sample collection and testing according to treatment.a Time interval (days)
Sample
Determinations
−48 to −36 −36 to −24 −24 to −12 −12 to 0 4–16 16–28 28–40 40–52
Semenb Semen Semen Semen Ear swabs Semen Ear swabs Semen Semen Semen
Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility. Culture and PCRc , d Semen volume, concentration and sperm motility. Culture and PCRc , e Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility
a b c d e
Treatment consisted of 5 daily doses of marbofloxacin intramuscularly (2 mg/kg) given on days 0–4. At least one sample per 12-day interval per animal. Culture and PCR on semen and ear swabs. 12 days pre-treatment. 4 days post-treatment.
188
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
quality variables (sperm count, motility and daily sperm production) in all animals for 594 semen samples. The mean squares of each variable were calculated based on the results obtained in all valid semen samples for each 12-day period.
Table 2 Frequency of Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc) detected during the study. Samplesa
Method
Ear swabs
Culture PCR
Semen
Culture PCR
2.3. Mycoplasma cultures Solid and liquid mycoplasma media (Gómez-Martín et al., 2012b) were inoculated with 0.2 ml of each semen sample and incubated at 37 ◦ C in a 5% CO2 humid atmosphere. The swabs were twirled and left in mycoplasma culture. After discarded the swabs, aliquots were taken for culture following the procedure previously described (Amores et al., 2010). In all samples, isolates from previously cloned single colonies were used for preliminary identification based on biochemical tests as previously described (Poveda and Nicholas, 1998). Final identification was performed by PCR (Tola et al., 1996; Manso-Silvan et al., 2007; Woubit et al., 2007). 2.4. DNA extraction and PCR DNA was extracted from the fluid obtained from the ear swab samples using a previously described method based on silica (Amores et al., 2011). For the semen samples, a commercial genomic DNA extraction kit was used on 25 g of each tissue sample (High Pure PCR Template Preparation Kit, Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions. Ma was detected using specific PCR procedures (Tola et al., 1996). To detect the presence of Mmc, an initial PCR was conducted to detect all members of the M. mycoides cluster (Woubit et al., 2007). Next, all samples yielding a positive result were confirmed using a primer pair to amplify the fusA gene (Manso-Silvan et al., 2007). All PCR products obtained with this primer pair were sequenced at our university’s Molecular Biology facility (Universidad de Murcia, Murcia, Spain). Sequences were aligned using MEGA 4.0 software (Tamura et al., 2007) and trimmed to the same size, providing fragments of 561 bp for phylogenetic analyses. DNA extracted from the reference strains of Ma (PG2, NCTC 10123) and Mmc (PG3, NCTC 10137) was included as positive control. 2.5. Semen quality Morning semen samples were obtained from all animals using a teaser goat, and ejaculates collected into sterile vials by the artificial vagina method (Roca et al., 1992). The sperm count was performed by photometry (SDM5, Minitüb, Tiefenbach, Germany). Percentage total motility was determined by computer-assisted sperm analysis (CASA), IVOS (Hamilton Thorne, Hamilton Thorne, Biosciences, Inc., Beverly, MA, USA). Two series of six microscopic fields were video recorded for each evaluation. Daily semen volume was also measured. 2.6. Statistical analysis Statistical analysis was performed using the GLM procedures implemented in the SAS 6.11 Software package (1996). In the model, the effects of the goat buck (n = 27) and antibiotic treatment (two levels: before and after treatment) and 12-day time interval (eight levels) were considered as independent variables. Semen volume (ml), concentration (×103 /ml) and sperm motility (%) were entered as dependent variables. The means of the variables examined were compared using Tukey’s honestly significant difference (HSD) test.
3. Results The presence of mycoplasmas was confirmed in all the animals (n = 27) before and after treatment. Thus, all ear swab samples scored positive for Mmc before and after treatment (108/108, 100%) (Table 2) as confirmed by the same fusA gene sequence obtained in all isolates (Table 3). The presence of Ma was also confirmed in swab samples taken from the same two animals before and after the treatment (4/108, 3.7%). PCR was able to detect all Mmc and Ma positive samples. Our culture results indicated 13 (13/54, 24%) and 11 (11/54, 20.3%) samples positive for Mmc before
Before treatment
After treatment
Ma
Mmc
Ma
Mmc
2/54 2/54
13/54 54/54
2/54 2/54
11/54 54/54
0/27 0/27
0/27 0/27
0/27 0/27
0/27 0/27
a Two ear swabs and one semen sample were collected before and after treatment from each goat males (n = 27).
and after treatment respectively. Positive culture results for Ma were also obtained in the four samples in which Ma was identified by PCR. Mycoplasmas were not detected in any semen samples (Table 2). The factors goat buck, antibiotic treatment and time interval had a significant effect on sperm motility. Semen volume and sperm concentration were only significant effect by the goat buck factor. Compared to pretreatment, mean sperm motility decreased significantly (p < 0.05) after marbofloxacin treatment (72.927 ± 7.733 and 56.989 ± 14.712 respectively). Semen volume and sperm concentration means were unaffected by treatment (Table 4). Mean sperm motility did not vary between the four 12-day intervals leading up to treatment while values significantly decreased from post-treatment days 4–16 to days 28–40. Sperm motility decreased continuously until post treatment period 28–40, and a slight increase (p < 0.05) in motility was recorded between post-treatment days 40–52. However, this was still much significantly lower than those recorded pre-treatment. 4. Discussion In this study, we examined the efficacy of a 5-day course of intramuscular marbofloxacin for eliminating CAassociated mycoplasmas (Ma and Mmc) from the external auditory canal of naturally infected asymptomatic goat bucks. The persistence of mycoplasmas after treatment, suggests that under our experimental conditions, the systemic antibiotherapy is not a useful tool to eliminate these bacteria from the external auditory canal. Table 3 561-bp fusA gene sequence observed in all the samples testing positive for the M. mycoides cluster. Sequence obtained >fusA samples 1–108 AAAGGTGTTAAATTATTATTAGATGCTGTTGTTGATTATTTACCATCACC TTTAGATATCCCATCAATTAAAGGAATTTTACCAACAGGTGAAGAAGTT GAAAGACATGCTGATGATACTGAACCATTTTCAGCATTAGCATTCAAAG TTATGACTGATCCATTTGTTGGAAAATTAACATTCTTTAGAGTATATTCA GGAATTTTAACTAAAGGTAGTTATGTATTAAATTCAACTAAACAACAAA AAGAACGTGTTGGACGTATTTTACAAATGCATGCAAATAACCGTACTGA AATTGAAGAAGTTTATTCAGGTGATATTGCTGCAGCTGTTGGGTTAAAA AATACTACAACTGGTGATACTTTATGTGATGAAAAAGGAGAAATCATTT TAGAATCAATGGTCTTTCCTGAACCTGTTATCCAATTAGCATTAGAACCA AAAACTAAAGCTGACCAAGAAAAAATGAGTATTGCTTTATCAAAATTAG CTGAAGAAGATCCAACTTTTAGAACTTATACAGACGATGAAACTGGACA AACAATTATTGCTGGTATG
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
189
Table 4 Arithmetical means and standard deviations of the variables recorded for the goat buck semen in each 12-day time interval before and after treatment. Time interval daysd
Semen volume (ml)
−48 to −36 −36 to −24 −24 to −12 −12 to 0 4–16 16–28 28–40 40–52
1.297 1.268 1.175 1.215 1.198 1.349 1.334 1.229
a,b,c d
± ± ± ± ± ± ± ±
0.599a 0.654a 0.505a 0.528a 0.468a 0.615a 0.664a 0.448a
Sperm concentration (×103 /ml) 3041.385 2996.520 3166.417 3562.963 3107.6111 2903.419 3323.609 3356.885
± ± ± ± ± ± ± ±
1005.958a 1007.315a 1090.441a 1316.690a 886.858a 918.905a 1078.033a 943.186a
Sperm motility (%) 75.577 73.200 73.444 69.259 60.417 56.759 50.333 58.843
± ± ± ± ± ± ± ±
6.217a 9.987a 6.291a 7.930a 12.061b 17.352cb 15.916c 11.922b
Means with different superscripts in a column differ significantly (P < 0.05). Treatment consisted of 5 daily doses of marbofloxacin intramuscularly (2 mg/kg) given on days 0–4.
Several factors as the pharmacokinetic and pharmacodynamics behaviour of marbofloxacin in goats, dose used, and efficacy against mycoplasmas could influence the success of treatment. In small ruminants, the treatment with marbofloxacin has been effective against respiratory system infections caused by mycoplasmas and has been reported to have a high bioavailability, a good tissue penetration and rapid distribution to the respiratory tissue with high concentrations (Skoufos et al., 2007; Waxman et al., 2001). Moreover, it was reported that pharmacokinetic parameters of marbofloxacin are not significantly different between intravenous and intramuscular administration in goats (Waxman et al., 2001). The total duration of treatment administration in our study (2 mg/kg bodyweight for five consecutive days) was greater than used in other studies investigating efficacy in small ruminants (Balikci et al., 2008; Skoufos et al., 2007). Those studies concluded that 2 mg/kg for three consecutive days was effective against respiratory infections by mycoplasmas in lambs and goats. Although in vitro studies have demonstrated greater susceptibility of Ma to quinolones when compared to other antibiotics commonly used to treat CA (Antunes et al., 2008; Loria et al., 2003), our results identified the inability of marbofloxacin to eliminate latent natural infection of mycoplasmas in goats. A good in vitro inhibitory effect against Mmc was also reported to ciprofloxacin and enrofloxacin (Antunes et al., 2007). Our research also investigated the presence of mycoplasmas in semen of male goats that were auricular carriers of Mmc, and the possible effect of marbofloxacin on semen quality. The absence of mycoplasmas in semen samples of all animals is in agreement with the low frequency of mycoplasmas detected in semen samples of infected males (De la Fe et al., 2009; Amores et al., 2011; Gómez-Martín et al., 2012a) suggesting that should not be considered as an ideal sample for routinely diagnostic. It could be necessary to check several samples to detect mycoplasmas in semen of infected bucks (Gómez-Martín et al., 2012a) due to the apparent intermittent excretion (De la Fe et al., 2009). On the other hand, sperm motility was found to decrease significantly after treatment (Table 4) while sperm volume and concentration were unaffected. The semen quality varies in exposure to drugs (Mayer, 1987; Schlegel et al., 1991), and in goat bucks may be also influenced by the season (Roca et al., 1992). In our study, seasonal variations in semen quality are unlikely because the experiment was conducted in winter
to avoid possible adverse effects of high temperatures. Furthermore, the goat breed Murciano-Granadina used in this study is known to have limited seasonal variation in semen quality than in others breeds, probably because of the smaller variation in day length in our geographical region compared to more northern areas (Roca et al., 1992). Thus, the mean baseline sperm motility recorded here (72.9%) (Table 4) was similar to the rate observed by Roca et al. (1992) during the same period for the semen of healthy Murciano-Granadina goats in the same region of Spain. In contrast, sperm motility post-treatment (56.9%) was lower than the values normally reported for this breed by these authors. In line with the high concentrations of quinolones achievable in prostate tissues and seminal fluids (Abd-Allah et al., 2000), the use of these antibiotics has been linked to spermatogenesis alterations, and testicular damage has been observed in several animal species (Schlegel et al., 1991). Mayer (1987) observed that pefloxacin caused azoospermia and testicular damage in dogs, and enoxacin caused testicular atrophy in rats and reduced spermatogenesis in dogs. The increase in the motility sperm observed in the last time interval (days 40–52) showed a change in the decreasing trend of this parameter until day 40 post-treatment. However it cannot be ignored that it was similar to that observed immediately after treatment (days 4–16) and significantly lower than that of pre-treatment (Table 4). The fact that treatment with marbofloxacin has been used satisfactorily in small ruminants for the treatment of respiratory infections (Balikci et al., 2008; Skoufos et al., 2007), requires the realization of further studies that evaluate if the systemic marbofloxacin treatment may cause irreversible damage in the sperm quality of bucks, as has been reported in others animal species (Mayer, 1987). Inconsistent with our observations, Abd-Allah et al. (2000) reported marked effects of quinolones on semen volume and concentration in rats. This difference may however be attributed to the higher doses used and longer duration of their study. Our sperm motility results are consistent with those described by Abd-Allah et al. (2000) for the use of higher doses in 15-day courses of ofloxacin, ciprofloxacin and pefloxacin. Similar results were observed by Aral et al. (2008) in a study in which male mice were given enrofloxacin. The mechanism for this effect remains to be elucidated. In conclusion, systemic marbofloxacin treatment is not effective at eliminating mycoplasmas from the external
190
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
auditory canal of asymptomatic goat male carriers. Under our experimental conditions, the antibiotic significantly reduced sperm motility over the four weeks following treatment. Our findings indicate a need to investigate other strategies to control the presence of asymptomatic carriers of CA-causing mycoplasmas in populations of high genetic value. Acknowledgements Funding for this study was provided by the Fundación SENECA (Agencia Regional de Ciencia y Tecnología de la Región de Murcia, Project 11785/PI/09) and the Spanish Ministry of Science and Innovation, Government of Spain (Project AGL2009-09128). The authors thank Mrs. Silvia Porras and Mr. Daniel Riquelme for technical assistance and ACRIMUR (Spanish Association of breeders of the Murciano-Granadina goat) for their collaboration in the study. Ángel Gómez-Martín was awarded a research fellowship by the University de Murcia, Spain. References Abd-Allah, A.R., Aly, H.A., Moustafa, A.M., Abdel-Aziz, A.A., Hamada, F.M., 2000. Adverse testicular effects of some quinolone members in rats. Pharmacol. Res. 41, 211–219. Amores, J., Corrales, J.C., Martín, A.G., Sánchez, A., Contreras, A., De la Fe, C., 2010. Comparison of culture and PCR to detect Mycoplasma agalactiae and Mycoplasma mycoides subsp. capri in ear swabs taken from goats. Vet. Microbiol. 140, 105–108. Amores, J., Gómez-Martín, A., Corrales, J.C., Sánchez, A., Contreras, A., De la Fe, C., 2011. Presence of contagious agalactia causing mycoplasmas in Spanish goat artificial insemination centres. Theriogenology 75, 1265–1270. Antunes, N.T., Tavío, M.M., Assunc¸ão, P., Rosales, R.S., Aquili, V., De la Fe, C., Poveda, J.B., 2007. In vitro susceptibilities of field isolates of Mycoplasma mycoides subsp. mycoides large colony type to 15 antimicrobials. Vet. Microbiol. 119, 72–75. Antunes, N.T., Tavío, M.M., Assunc¸ão, P., Rosales, R.S., Poveda, C., De la Fe, C., Gil, M.C., Poveda, J.B., 2008. In vitro susceptibilities of field isolates of Mycoplasma agalactiae. Vet. J. 177, 436–438. Aral, F., Karacal, F., Baba, F., 2008. The effect of enrofloxacin on sperm quality in male mice. Res. Vet. Sci. 84, 95–99. Balikci, E., Kizil, O., Karapinar, T., Karahan, M., Ozdemir, H., Dabak, M., 2008. Efficacy of marbofloxacin for naturally occurring contagious caprine pleuropneumonia. Small Rumin. Res. 77, 75–79. Bergonier, D., Berthelot, X., Poumarat, F., 1997. Contagious agalactia of small ruminants: current knowledge concerning epidemiology, diagnosis and control. Rev. Sci. Tech. Off. Int. Epiz. 16, 848–873. Cottew, G.S., Yeats, F.R., 1982. Mycoplasmas and mites in the ears of clinically normal goats. Aust. Vet. J. 59, 77–81. Damassa, A.J., Brooks, D.L., 1991. The external ear canal of the goats and other animals as a mycoplasma habitat. Small Rumin. Res. 4, 85–93. De la Fe, C., Amores, J., Martin, A.G., Sánchez, A., Contreras, A., Corrales, J.C., 2009. Mycoplasma agalactiae detected in the semen of goat bucks. Theriogenology 72, 1278–1281.
De la Fe, C., Castro-Alonso, A., Herráez, P., Poveda, J.B., 2011. Recovery of Mycoplasma agalactiae from the ears of goats experimentally infected by the intramammary route. Vet. J. 190, 94–97. Gómez-Martín, A., Corrales, J.C., Amores, J., Sánchez, A., Contreras, A., Paterna, A., De la Fe, C., 2012a. Controlling contagious agalactia in artificial insemination centers for goats and detection of Mycoplasma mycoides subspecies capri in semen. Theriogenology 77, 1252–1256. Gómez-Martín, A., De la Fe, C., Amores, J., Sánchez, A., Contreras, A., Paterna, A., Buendía, A.J., Corrales, J.C., 2012b. Anatomic location of Mycoplasma mycoides subsp. capri and Mycoplasma agalactiae in naturally infected goat male auricular carriers. Vet. Microbiol. 157, 355–362. Kazama, S., Yagihashi, T., Morita, T., Awakura, T., Shimada, A., Umemura, T., 1994. Isolation of Mycoplasma hyorhinis and Mycoplasma arginini from the ears of pigs with otitis media. Res. Vet. Sci. 56, 108–110. Loria, G.R., Sammartino, C., Nicholas, R.A., Ayling, R.D., 2003. In vitro susceptibilities of field isolates of Mycoplasma agalactiae to oxytetracycline, tylosin, enrofloxacin, spiramycin and lincomycinspectinomycin. Res. Vet. Sci. 75, 3–7. Manso-Silvan, L., Perrier, X., Thiaucourt, F., 2007. Phylogeny of the Mycoplasma mycoides cluster based on analysis of five conserved protein-coding sequences and possible implications for the taxonomy of the group. Int. J. Syst. Evol. Microbiol. 57, 2247–2258. Mayer, D.G., 1987. Overview of toxicological studies. Drugs 34 Suppl. (1), 150–153. Mercier, P., Pellet, M.P., Morignat, E., Calavas, D., Poumarat, F., 2007. Prevalence of mycoplasmas in external ear canal of goats: influence of the sanitary status of the herd. Small Rumin. Res. 73, 296–299. Poveda, J.B., Nicholas, R.A.J., 1998. Serological identification of mycoplasmas by growth and metabolism inhibition test. In: Miles, R.J., Nicholas, R.A.J. (Eds.), Methods in Molecular Medicine: Mycoplasma Protocols. Humana Press Inc., Totowa, NJ. Roca, J., Martínez, E., Vázquez, J.M., Coy, P., 1992. Characteristics and seasonal variations in the semen of Murciano-Granadina goats in the Mediterranean area. Anim. Reprod. Sci. 29, 255–262. SAS/STAT Software, 1996. Changes and Enhancements Through Release 6.11, SAS Inst., Inc., Cary, NC. Schlegel, P.N., Chang, T.S., Marshall, F.F., 1991. Antibiotics: potential hazards to male fertility. Fertil. Steril. 55, 235–242. Skoufos, J., Christodoulopoulos, G., Fragkou, I.A., Tzora, A., Gougoulis, D.A., Orfanou, D.C., Tsiolaki, K., Fthenakis, G.C., 2007. Efficacy of marbofloxacin against respiratory infections of lambs. Small Rumin. Res. 71, 304–309. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tardy, F., Maigre, L., Tricot, A., Poumarat, F., Nguyen, L., Le, G.D., 2011. Comparison of isolates of Mycoplasma mycoides subspecies capri from asymptomatic and septicaemic goats. J. Comp. Pathol. 144, 70–77. Tola, S., Idini, G., Manunta, D., Galleri, G., Angioi, A., Rocchigiani, A.M., Leori, G., 1996. Rapid and specific detection of Mycoplasma agalactiae by polymerase chain reaction. Vet. Microbiol. 51, 77–84. Walz, P.H., Mullaney, T.P., Render, J.A., Walker, R.D., Mosser, T., Baker, J.C., 1997. Otitis media in preweaned Holstein dairy calves in Michigan due to Mycoplasma bovis. J. Vet. Diagn. Invest. 9, 250–254. Waxman, S., Rodríguez, C., González, F., De Vicente, M.L., San Andres, M.I., San Andres, M.D., 2001. Pharmacokinetic behavior of marbofloxacin after intravenous and intramuscular administrations in adult goats. J. Vet. Pharmacol. Ther. 24, 375–378. Woubit, S., Manso-Silván, L., Lorenzon, S., Gaurivaud, P., Poumarat, F., Pellet, M.P., Singh, V.P., Thiaucourt, F., 2007. A PCR for the detection of mycoplasmas belonging to the Mycoplasma mycoides cluster: application to the diagnosis of contagious agalactia. Mol. Cell. Probes 21, 391–399.
Contents lists available at SciVerse ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Effect of marbofloxacin on mycoplasma carrier state and sperm quality in goat bucks Ángel Gómez-Martín, Antonio Sánchez, Joaquín Amores, Juan C. Corrales, Antonio Contreras, Christian De la Fe ∗ Departamento de Sanidad Animal, Facultad de Veterinaria, Campus de Excelencia Internacional Regional “Campus Mare Nostrum”, Universidad de Murcia, Campus de Espinardo s/n, Murcia 30100, Spain
a r t i c l e
i n f o
Article history: Received 3 July 2012 Received in revised form 26 October 2012 Accepted 29 October 2012 Available online 23 November 2012 Keywords: Contagious agalactia Goat bucks Carriers Marbofloxacin Semen quality
a b s t r a c t The presence of goat males carriers of the main causal agents of contagious agalactia, Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc), is a high risk factor for the spread of the infection in artificial insemination centres. The present study was designed to assess the efficacy of a 5 day course of marbofloxacin given intramuscularly (2 mg kg−1 day−1 ) in terms of its capacity to reverse the carrier state of goat buck populations naturally infected with one or both mycoplasmas (Mmc, n = 25; Mmc + Ma, n = 2). Before and after treatment, ear swabs and semen samples were culture- and PCR-checked for both mycoplasmas. We also evaluated the impact of this treatment on semen quality (sperm count, motility and daily sperm production) by monitoring these variables of 594 semen samples collected during pre- and post-treatment periods of 48 days each. All bucks examined tested positive for the presence of Ma and Mmc before and after treatment though Mycoplasma spp. never was identified in semen. Sperm motility was significantly reduced in response to treatment (from 72.9% to 56.9%), although some recovery was observed at the end of the study (40 days after treatment). Ejaculate volume and concentration remained unchanged throughout the study. Our findings indicate that systemic marbofloxacin therapy is unable to eliminate mycoplasmas from the external auditory canal of male goats, and that it also causes a transient detrimental effect on sperm motility. Other strategies to control the presence of mycoplasma carriers in goat artificial insemination centres need to be assessed. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Contagious agalactia (CA) is a serious disease that affects small dairy ruminants causing mastitis, arthritis, conjunctivitis, abortion and pneumonia. CA is listed by the World Organization for Animal Health (OIE) and results in high economic losses in all affected areas (Bergonier et al., 1997). The epidemiological situation is particularly complex in chronically infected goat herds reared in CA endemic
∗ Corresponding author. Tel.: +34 868887259; fax: +34 868884147. E-mail address: [email protected] (C. De la Fe). 0921-4488/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.smallrumres.2012.10.012
areas, where a high number of asymptomatic carriers of Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc) in the external auditory canal are reported (Mercier et al., 2007), even in semen-collection centres (Amores et al., 2011). In some of these carriers, the presence of Ma and Mmc in goat semen has been recently reported (De la Fe et al., 2009; Gómez-Martín et al., 2012a). Also, these findings seem to confirm the ability of both bacteria to colonize several others anatomical locations including testicle, bulbourethral gland and urethra in the auricular carriers (Gómez-Martín et al., 2012b). Based on the demonstrated pathogenic capacity of mycoplasma isolates from the ears in goats (Tardy et al., 2011), the systemic
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
presence of Mmc and Ma in auricular carriers represents an added risk factor to spread the infection (Gómez-Martín et al., 2012b). Mycoplasmas could colonize the auditory canal via the existing communication between the respiratory system and the middle ear (Gómez-Martín et al., 2012b). In calves (Walz et al., 1997) and swine (Kazama et al., 1994), colonization of nasopharynx by mycoplasma was suggested to precede eustachitis, sinusitis and otitis media. Also it is postulated that otitis media could be secondary to bacteraemia resulting from infection of lungs by mycoplasma (Walz et al., 1997). In clinically normal goats, Cottew and Yeats (1982) found simultaneous infections of mycoplasmas associated with CA in the external ear canal, middle ears and tonsillar crypts which is in agreement with the recent detection of systemic infection and pathology in male goats that were auricular carriers of Mmc (Gómez-Martín et al., 2012b). Previously, the capacity of Ma, Mmc and Mc to colonize external ear in goats and lambs during or after mycoplasmaemia was shown experimentally (De la Fe et al., 2011; Damassa and Brooks, 1991). All these data could justify the need to evaluate a systemic treatment in the auricular goat male carriers. Antibiotic therapy is the current approach to CA clinical outbreaks and among the treatments of choice are fluoroquinolones (Bergonier et al., 1997). Also, in vitro study has revealed the greater effect of quinolones against Ma compared to the antibiotics more commonly used to treat CA (Loria et al., 2003). Marbofloxacin, a new synthetic fluoroquinolone, has an intense in vivo anti-mycoplasmal effect against Mycoplasma capricolum subsp. capripneumoniae (Balikci et al., 2008) or against respiratory infections by Mycoplasma spp. of lambs (Skoufos et al., 2007). The pharmacokinetic behaviour of marbofloxacin in goats has been evaluated (Waxman et al., 2001) and its wide tissue distribution, high bioavailability and long half-life have made this antibiotic a promising candidate for CA control. In this sense, the high capacity shown by quinolones to penetrate testicular tissues and fluids makes them ideal for the treatment of goat males auricular carriers with systemic infections. Although, as observed for other therapeutic agents, their use may influence semen quality (Abd-Allah et al., 2000). Adverse effects of quinolones on the quality of goat semen have not been extensively studied, and there is
187
a need for this to be investigated, especially in animals of high genetic value. Based on these data, we hypothesized that the systemic use of this antibiotic could be effective to eliminate the mycoplasmas located in the auricular canal and the probable systemic infection associated. Their effectiveness could avoid control measures such as culling infected semenproviding bucks or other strategies with repercussions on the physiology of these animals, with the associated loss of genetic potential. This study was designed to evaluate the capacity of marbofloxacin to eliminate mycoplasmas causing CA (Mmc and Ma) from the auricular canal of asymptomatic goats male and the effects of treatment on semen quality. 2. Materials and methods 2.1. Population The study population comprised 27 bucks aged 2–7, weighing 50–70 kg of a native goat breed (Murciano-Granadina), taken from a semen collection centre. All animals were diagnosed by culture and PCR as auricular carriers of Mmc (n = 25) and two of the bucks were coinfected with Ma (n = 2) (Table 1). Animals were tested free of tuberculosis, paratuberculosis, contagious caprine pleuropneumonia, scrapie, brucellosis, bluetongue, caprine arthritis encephalitis virus and border disease. During the study period, the bucks were not subjected to changes in dietary habits and stressful conditions. 2.2. Design of the study and sample collection The study period was 101 days long. Table 1 shows the timecourse of the experiment indicating the sampling times. All bucks were administered a 10% aqueous solution of marbofloxacin intramusculary, Marbocyl® (Vetoquinol, Madrid, Spain) daily (2 mg/kg bodyweight) for five consecutive days (days 0–4), following the manufacturer recommends. Mycoplasma infection was confirmed 12 days prior to treatment onset by examination of two ear swab samples and one semen sample from each animal. To assess the efficacy of treatment, two ear swab samples and one semen sample were taken 4 days post-treatment. Ear swabs were placed in semi-solid transport medium (Sterile Transport Swab, Copan, Brescia, Italy). Samples were transported to the laboratory at 4 ◦ C, where they were processed on the day of collection. All ear swabs (n = 108) and semen samples (n = 54) collected over the study period were processed as previously described (Amores et al., 2011) and aliquots obtained for culture or PCR. The effect of antibiotic treatment on semen quality was also analyzed (Table 1). In a defined reproductive season, pre- and post-treatment periods of 48 days each were established. Each of these 48-day periods was divided into four 12-day intervals (days −48 to −36, −36 to −24, −24 to −12 and −12 to 0 pre-treatment; and days 4–16, 16–28, 28–40, and 40–52 post-treatment). During these intervals, we determined semen
Table 1 Time-line for sample collection and testing according to treatment.a Time interval (days)
Sample
Determinations
−48 to −36 −36 to −24 −24 to −12 −12 to 0 4–16 16–28 28–40 40–52
Semenb Semen Semen Semen Ear swabs Semen Ear swabs Semen Semen Semen
Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility. Culture and PCRc , d Semen volume, concentration and sperm motility. Culture and PCRc , e Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility Semen volume, concentration and sperm motility
a b c d e
Treatment consisted of 5 daily doses of marbofloxacin intramuscularly (2 mg/kg) given on days 0–4. At least one sample per 12-day interval per animal. Culture and PCR on semen and ear swabs. 12 days pre-treatment. 4 days post-treatment.
188
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
quality variables (sperm count, motility and daily sperm production) in all animals for 594 semen samples. The mean squares of each variable were calculated based on the results obtained in all valid semen samples for each 12-day period.
Table 2 Frequency of Mycoplasma agalactiae (Ma) and Mycoplasma mycoides subsp. capri (Mmc) detected during the study. Samplesa
Method
Ear swabs
Culture PCR
Semen
Culture PCR
2.3. Mycoplasma cultures Solid and liquid mycoplasma media (Gómez-Martín et al., 2012b) were inoculated with 0.2 ml of each semen sample and incubated at 37 ◦ C in a 5% CO2 humid atmosphere. The swabs were twirled and left in mycoplasma culture. After discarded the swabs, aliquots were taken for culture following the procedure previously described (Amores et al., 2010). In all samples, isolates from previously cloned single colonies were used for preliminary identification based on biochemical tests as previously described (Poveda and Nicholas, 1998). Final identification was performed by PCR (Tola et al., 1996; Manso-Silvan et al., 2007; Woubit et al., 2007). 2.4. DNA extraction and PCR DNA was extracted from the fluid obtained from the ear swab samples using a previously described method based on silica (Amores et al., 2011). For the semen samples, a commercial genomic DNA extraction kit was used on 25 g of each tissue sample (High Pure PCR Template Preparation Kit, Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions. Ma was detected using specific PCR procedures (Tola et al., 1996). To detect the presence of Mmc, an initial PCR was conducted to detect all members of the M. mycoides cluster (Woubit et al., 2007). Next, all samples yielding a positive result were confirmed using a primer pair to amplify the fusA gene (Manso-Silvan et al., 2007). All PCR products obtained with this primer pair were sequenced at our university’s Molecular Biology facility (Universidad de Murcia, Murcia, Spain). Sequences were aligned using MEGA 4.0 software (Tamura et al., 2007) and trimmed to the same size, providing fragments of 561 bp for phylogenetic analyses. DNA extracted from the reference strains of Ma (PG2, NCTC 10123) and Mmc (PG3, NCTC 10137) was included as positive control. 2.5. Semen quality Morning semen samples were obtained from all animals using a teaser goat, and ejaculates collected into sterile vials by the artificial vagina method (Roca et al., 1992). The sperm count was performed by photometry (SDM5, Minitüb, Tiefenbach, Germany). Percentage total motility was determined by computer-assisted sperm analysis (CASA), IVOS (Hamilton Thorne, Hamilton Thorne, Biosciences, Inc., Beverly, MA, USA). Two series of six microscopic fields were video recorded for each evaluation. Daily semen volume was also measured. 2.6. Statistical analysis Statistical analysis was performed using the GLM procedures implemented in the SAS 6.11 Software package (1996). In the model, the effects of the goat buck (n = 27) and antibiotic treatment (two levels: before and after treatment) and 12-day time interval (eight levels) were considered as independent variables. Semen volume (ml), concentration (×103 /ml) and sperm motility (%) were entered as dependent variables. The means of the variables examined were compared using Tukey’s honestly significant difference (HSD) test.
3. Results The presence of mycoplasmas was confirmed in all the animals (n = 27) before and after treatment. Thus, all ear swab samples scored positive for Mmc before and after treatment (108/108, 100%) (Table 2) as confirmed by the same fusA gene sequence obtained in all isolates (Table 3). The presence of Ma was also confirmed in swab samples taken from the same two animals before and after the treatment (4/108, 3.7%). PCR was able to detect all Mmc and Ma positive samples. Our culture results indicated 13 (13/54, 24%) and 11 (11/54, 20.3%) samples positive for Mmc before
Before treatment
After treatment
Ma
Mmc
Ma
Mmc
2/54 2/54
13/54 54/54
2/54 2/54
11/54 54/54
0/27 0/27
0/27 0/27
0/27 0/27
0/27 0/27
a Two ear swabs and one semen sample were collected before and after treatment from each goat males (n = 27).
and after treatment respectively. Positive culture results for Ma were also obtained in the four samples in which Ma was identified by PCR. Mycoplasmas were not detected in any semen samples (Table 2). The factors goat buck, antibiotic treatment and time interval had a significant effect on sperm motility. Semen volume and sperm concentration were only significant effect by the goat buck factor. Compared to pretreatment, mean sperm motility decreased significantly (p < 0.05) after marbofloxacin treatment (72.927 ± 7.733 and 56.989 ± 14.712 respectively). Semen volume and sperm concentration means were unaffected by treatment (Table 4). Mean sperm motility did not vary between the four 12-day intervals leading up to treatment while values significantly decreased from post-treatment days 4–16 to days 28–40. Sperm motility decreased continuously until post treatment period 28–40, and a slight increase (p < 0.05) in motility was recorded between post-treatment days 40–52. However, this was still much significantly lower than those recorded pre-treatment. 4. Discussion In this study, we examined the efficacy of a 5-day course of intramuscular marbofloxacin for eliminating CAassociated mycoplasmas (Ma and Mmc) from the external auditory canal of naturally infected asymptomatic goat bucks. The persistence of mycoplasmas after treatment, suggests that under our experimental conditions, the systemic antibiotherapy is not a useful tool to eliminate these bacteria from the external auditory canal. Table 3 561-bp fusA gene sequence observed in all the samples testing positive for the M. mycoides cluster. Sequence obtained >fusA samples 1–108 AAAGGTGTTAAATTATTATTAGATGCTGTTGTTGATTATTTACCATCACC TTTAGATATCCCATCAATTAAAGGAATTTTACCAACAGGTGAAGAAGTT GAAAGACATGCTGATGATACTGAACCATTTTCAGCATTAGCATTCAAAG TTATGACTGATCCATTTGTTGGAAAATTAACATTCTTTAGAGTATATTCA GGAATTTTAACTAAAGGTAGTTATGTATTAAATTCAACTAAACAACAAA AAGAACGTGTTGGACGTATTTTACAAATGCATGCAAATAACCGTACTGA AATTGAAGAAGTTTATTCAGGTGATATTGCTGCAGCTGTTGGGTTAAAA AATACTACAACTGGTGATACTTTATGTGATGAAAAAGGAGAAATCATTT TAGAATCAATGGTCTTTCCTGAACCTGTTATCCAATTAGCATTAGAACCA AAAACTAAAGCTGACCAAGAAAAAATGAGTATTGCTTTATCAAAATTAG CTGAAGAAGATCCAACTTTTAGAACTTATACAGACGATGAAACTGGACA AACAATTATTGCTGGTATG
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
189
Table 4 Arithmetical means and standard deviations of the variables recorded for the goat buck semen in each 12-day time interval before and after treatment. Time interval daysd
Semen volume (ml)
−48 to −36 −36 to −24 −24 to −12 −12 to 0 4–16 16–28 28–40 40–52
1.297 1.268 1.175 1.215 1.198 1.349 1.334 1.229
a,b,c d
± ± ± ± ± ± ± ±
0.599a 0.654a 0.505a 0.528a 0.468a 0.615a 0.664a 0.448a
Sperm concentration (×103 /ml) 3041.385 2996.520 3166.417 3562.963 3107.6111 2903.419 3323.609 3356.885
± ± ± ± ± ± ± ±
1005.958a 1007.315a 1090.441a 1316.690a 886.858a 918.905a 1078.033a 943.186a
Sperm motility (%) 75.577 73.200 73.444 69.259 60.417 56.759 50.333 58.843
± ± ± ± ± ± ± ±
6.217a 9.987a 6.291a 7.930a 12.061b 17.352cb 15.916c 11.922b
Means with different superscripts in a column differ significantly (P < 0.05). Treatment consisted of 5 daily doses of marbofloxacin intramuscularly (2 mg/kg) given on days 0–4.
Several factors as the pharmacokinetic and pharmacodynamics behaviour of marbofloxacin in goats, dose used, and efficacy against mycoplasmas could influence the success of treatment. In small ruminants, the treatment with marbofloxacin has been effective against respiratory system infections caused by mycoplasmas and has been reported to have a high bioavailability, a good tissue penetration and rapid distribution to the respiratory tissue with high concentrations (Skoufos et al., 2007; Waxman et al., 2001). Moreover, it was reported that pharmacokinetic parameters of marbofloxacin are not significantly different between intravenous and intramuscular administration in goats (Waxman et al., 2001). The total duration of treatment administration in our study (2 mg/kg bodyweight for five consecutive days) was greater than used in other studies investigating efficacy in small ruminants (Balikci et al., 2008; Skoufos et al., 2007). Those studies concluded that 2 mg/kg for three consecutive days was effective against respiratory infections by mycoplasmas in lambs and goats. Although in vitro studies have demonstrated greater susceptibility of Ma to quinolones when compared to other antibiotics commonly used to treat CA (Antunes et al., 2008; Loria et al., 2003), our results identified the inability of marbofloxacin to eliminate latent natural infection of mycoplasmas in goats. A good in vitro inhibitory effect against Mmc was also reported to ciprofloxacin and enrofloxacin (Antunes et al., 2007). Our research also investigated the presence of mycoplasmas in semen of male goats that were auricular carriers of Mmc, and the possible effect of marbofloxacin on semen quality. The absence of mycoplasmas in semen samples of all animals is in agreement with the low frequency of mycoplasmas detected in semen samples of infected males (De la Fe et al., 2009; Amores et al., 2011; Gómez-Martín et al., 2012a) suggesting that should not be considered as an ideal sample for routinely diagnostic. It could be necessary to check several samples to detect mycoplasmas in semen of infected bucks (Gómez-Martín et al., 2012a) due to the apparent intermittent excretion (De la Fe et al., 2009). On the other hand, sperm motility was found to decrease significantly after treatment (Table 4) while sperm volume and concentration were unaffected. The semen quality varies in exposure to drugs (Mayer, 1987; Schlegel et al., 1991), and in goat bucks may be also influenced by the season (Roca et al., 1992). In our study, seasonal variations in semen quality are unlikely because the experiment was conducted in winter
to avoid possible adverse effects of high temperatures. Furthermore, the goat breed Murciano-Granadina used in this study is known to have limited seasonal variation in semen quality than in others breeds, probably because of the smaller variation in day length in our geographical region compared to more northern areas (Roca et al., 1992). Thus, the mean baseline sperm motility recorded here (72.9%) (Table 4) was similar to the rate observed by Roca et al. (1992) during the same period for the semen of healthy Murciano-Granadina goats in the same region of Spain. In contrast, sperm motility post-treatment (56.9%) was lower than the values normally reported for this breed by these authors. In line with the high concentrations of quinolones achievable in prostate tissues and seminal fluids (Abd-Allah et al., 2000), the use of these antibiotics has been linked to spermatogenesis alterations, and testicular damage has been observed in several animal species (Schlegel et al., 1991). Mayer (1987) observed that pefloxacin caused azoospermia and testicular damage in dogs, and enoxacin caused testicular atrophy in rats and reduced spermatogenesis in dogs. The increase in the motility sperm observed in the last time interval (days 40–52) showed a change in the decreasing trend of this parameter until day 40 post-treatment. However it cannot be ignored that it was similar to that observed immediately after treatment (days 4–16) and significantly lower than that of pre-treatment (Table 4). The fact that treatment with marbofloxacin has been used satisfactorily in small ruminants for the treatment of respiratory infections (Balikci et al., 2008; Skoufos et al., 2007), requires the realization of further studies that evaluate if the systemic marbofloxacin treatment may cause irreversible damage in the sperm quality of bucks, as has been reported in others animal species (Mayer, 1987). Inconsistent with our observations, Abd-Allah et al. (2000) reported marked effects of quinolones on semen volume and concentration in rats. This difference may however be attributed to the higher doses used and longer duration of their study. Our sperm motility results are consistent with those described by Abd-Allah et al. (2000) for the use of higher doses in 15-day courses of ofloxacin, ciprofloxacin and pefloxacin. Similar results were observed by Aral et al. (2008) in a study in which male mice were given enrofloxacin. The mechanism for this effect remains to be elucidated. In conclusion, systemic marbofloxacin treatment is not effective at eliminating mycoplasmas from the external
190
Á. Gómez-Martín et al. / Small Ruminant Research 112 (2013) 186–190
auditory canal of asymptomatic goat male carriers. Under our experimental conditions, the antibiotic significantly reduced sperm motility over the four weeks following treatment. Our findings indicate a need to investigate other strategies to control the presence of asymptomatic carriers of CA-causing mycoplasmas in populations of high genetic value. Acknowledgements Funding for this study was provided by the Fundación SENECA (Agencia Regional de Ciencia y Tecnología de la Región de Murcia, Project 11785/PI/09) and the Spanish Ministry of Science and Innovation, Government of Spain (Project AGL2009-09128). The authors thank Mrs. Silvia Porras and Mr. Daniel Riquelme for technical assistance and ACRIMUR (Spanish Association of breeders of the Murciano-Granadina goat) for their collaboration in the study. Ángel Gómez-Martín was awarded a research fellowship by the University de Murcia, Spain. References Abd-Allah, A.R., Aly, H.A., Moustafa, A.M., Abdel-Aziz, A.A., Hamada, F.M., 2000. Adverse testicular effects of some quinolone members in rats. Pharmacol. Res. 41, 211–219. Amores, J., Corrales, J.C., Martín, A.G., Sánchez, A., Contreras, A., De la Fe, C., 2010. Comparison of culture and PCR to detect Mycoplasma agalactiae and Mycoplasma mycoides subsp. capri in ear swabs taken from goats. Vet. Microbiol. 140, 105–108. Amores, J., Gómez-Martín, A., Corrales, J.C., Sánchez, A., Contreras, A., De la Fe, C., 2011. Presence of contagious agalactia causing mycoplasmas in Spanish goat artificial insemination centres. Theriogenology 75, 1265–1270. Antunes, N.T., Tavío, M.M., Assunc¸ão, P., Rosales, R.S., Aquili, V., De la Fe, C., Poveda, J.B., 2007. In vitro susceptibilities of field isolates of Mycoplasma mycoides subsp. mycoides large colony type to 15 antimicrobials. Vet. Microbiol. 119, 72–75. Antunes, N.T., Tavío, M.M., Assunc¸ão, P., Rosales, R.S., Poveda, C., De la Fe, C., Gil, M.C., Poveda, J.B., 2008. In vitro susceptibilities of field isolates of Mycoplasma agalactiae. Vet. J. 177, 436–438. Aral, F., Karacal, F., Baba, F., 2008. The effect of enrofloxacin on sperm quality in male mice. Res. Vet. Sci. 84, 95–99. Balikci, E., Kizil, O., Karapinar, T., Karahan, M., Ozdemir, H., Dabak, M., 2008. Efficacy of marbofloxacin for naturally occurring contagious caprine pleuropneumonia. Small Rumin. Res. 77, 75–79. Bergonier, D., Berthelot, X., Poumarat, F., 1997. Contagious agalactia of small ruminants: current knowledge concerning epidemiology, diagnosis and control. Rev. Sci. Tech. Off. Int. Epiz. 16, 848–873. Cottew, G.S., Yeats, F.R., 1982. Mycoplasmas and mites in the ears of clinically normal goats. Aust. Vet. J. 59, 77–81. Damassa, A.J., Brooks, D.L., 1991. The external ear canal of the goats and other animals as a mycoplasma habitat. Small Rumin. Res. 4, 85–93. De la Fe, C., Amores, J., Martin, A.G., Sánchez, A., Contreras, A., Corrales, J.C., 2009. Mycoplasma agalactiae detected in the semen of goat bucks. Theriogenology 72, 1278–1281.
De la Fe, C., Castro-Alonso, A., Herráez, P., Poveda, J.B., 2011. Recovery of Mycoplasma agalactiae from the ears of goats experimentally infected by the intramammary route. Vet. J. 190, 94–97. Gómez-Martín, A., Corrales, J.C., Amores, J., Sánchez, A., Contreras, A., Paterna, A., De la Fe, C., 2012a. Controlling contagious agalactia in artificial insemination centers for goats and detection of Mycoplasma mycoides subspecies capri in semen. Theriogenology 77, 1252–1256. Gómez-Martín, A., De la Fe, C., Amores, J., Sánchez, A., Contreras, A., Paterna, A., Buendía, A.J., Corrales, J.C., 2012b. Anatomic location of Mycoplasma mycoides subsp. capri and Mycoplasma agalactiae in naturally infected goat male auricular carriers. Vet. Microbiol. 157, 355–362. Kazama, S., Yagihashi, T., Morita, T., Awakura, T., Shimada, A., Umemura, T., 1994. Isolation of Mycoplasma hyorhinis and Mycoplasma arginini from the ears of pigs with otitis media. Res. Vet. Sci. 56, 108–110. Loria, G.R., Sammartino, C., Nicholas, R.A., Ayling, R.D., 2003. In vitro susceptibilities of field isolates of Mycoplasma agalactiae to oxytetracycline, tylosin, enrofloxacin, spiramycin and lincomycinspectinomycin. Res. Vet. Sci. 75, 3–7. Manso-Silvan, L., Perrier, X., Thiaucourt, F., 2007. Phylogeny of the Mycoplasma mycoides cluster based on analysis of five conserved protein-coding sequences and possible implications for the taxonomy of the group. Int. J. Syst. Evol. Microbiol. 57, 2247–2258. Mayer, D.G., 1987. Overview of toxicological studies. Drugs 34 Suppl. (1), 150–153. Mercier, P., Pellet, M.P., Morignat, E., Calavas, D., Poumarat, F., 2007. Prevalence of mycoplasmas in external ear canal of goats: influence of the sanitary status of the herd. Small Rumin. Res. 73, 296–299. Poveda, J.B., Nicholas, R.A.J., 1998. Serological identification of mycoplasmas by growth and metabolism inhibition test. In: Miles, R.J., Nicholas, R.A.J. (Eds.), Methods in Molecular Medicine: Mycoplasma Protocols. Humana Press Inc., Totowa, NJ. Roca, J., Martínez, E., Vázquez, J.M., Coy, P., 1992. Characteristics and seasonal variations in the semen of Murciano-Granadina goats in the Mediterranean area. Anim. Reprod. Sci. 29, 255–262. SAS/STAT Software, 1996. Changes and Enhancements Through Release 6.11, SAS Inst., Inc., Cary, NC. Schlegel, P.N., Chang, T.S., Marshall, F.F., 1991. Antibiotics: potential hazards to male fertility. Fertil. Steril. 55, 235–242. Skoufos, J., Christodoulopoulos, G., Fragkou, I.A., Tzora, A., Gougoulis, D.A., Orfanou, D.C., Tsiolaki, K., Fthenakis, G.C., 2007. Efficacy of marbofloxacin against respiratory infections of lambs. Small Rumin. Res. 71, 304–309. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tardy, F., Maigre, L., Tricot, A., Poumarat, F., Nguyen, L., Le, G.D., 2011. Comparison of isolates of Mycoplasma mycoides subspecies capri from asymptomatic and septicaemic goats. J. Comp. Pathol. 144, 70–77. Tola, S., Idini, G., Manunta, D., Galleri, G., Angioi, A., Rocchigiani, A.M., Leori, G., 1996. Rapid and specific detection of Mycoplasma agalactiae by polymerase chain reaction. Vet. Microbiol. 51, 77–84. Walz, P.H., Mullaney, T.P., Render, J.A., Walker, R.D., Mosser, T., Baker, J.C., 1997. Otitis media in preweaned Holstein dairy calves in Michigan due to Mycoplasma bovis. J. Vet. Diagn. Invest. 9, 250–254. Waxman, S., Rodríguez, C., González, F., De Vicente, M.L., San Andres, M.I., San Andres, M.D., 2001. Pharmacokinetic behavior of marbofloxacin after intravenous and intramuscular administrations in adult goats. J. Vet. Pharmacol. Ther. 24, 375–378. Woubit, S., Manso-Silván, L., Lorenzon, S., Gaurivaud, P., Poumarat, F., Pellet, M.P., Singh, V.P., Thiaucourt, F., 2007. A PCR for the detection of mycoplasmas belonging to the Mycoplasma mycoides cluster: application to the diagnosis of contagious agalactia. Mol. Cell. Probes 21, 391–399.