- Email: [email protected]
Effect of Mitovirus infection on formation of infection cushions and virulence of Botrytis cinerea
Physiological and Molecular Plant Pathology 75 (2010) 71e80
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
Effect of Mitovirus infection on formation of infection cushions and virulence of Botrytis cinerea Lei Zhang a, Ming De Wu a, Guo Qing Li a, *, Dao Hong Jiang a, Hung Chang Huang b a b
The State Key Laboratory of Agricultural Microbiology and the Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan 430070, China Agriculture and Agri-Food Canada, Research Centre, Lethbridge, Alberta, Canada (Emeritus)
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 7 September 2010
This study was conducted to investigate mechanisms involved in hypovirulence of strain CanBc-1 of Botrytis cinerea. The hypovirulent strain CanBc-1 was compared with the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea for formation of infection cushions on onion bulbs and on leaves of oilseed rape and tomato, as well as for production of pectinase, toxic metabolites, oxalic acid and laccase in different growth media. Results showed that formation of infection cushions was common on epidermis of onion bulbs and on leaves of oilseed rape and tomato inoculated with strains CanBc-1c-66 or CanBc-2, but was rare on these plant tissues inoculated with strain CanBc-1. The three strains could produce pectinase, toxic metabolites, oxalic acid and laccase in pure cultures. Strain CanBc-1 produced less pectinase in 9-day-old cultures in pectin-containing liquid medium than strains CanBc-1c-66 and CanBc-2. The yield of oxalic acid (OA) produced by strain CanBc-1 in 15-day-old cultures in Maxwell liquid medium was lower than that produced by strain CanBc-2, but was higher than that produced by strain CanBc-1c-66. Strain CanBc-1 produced more laccase than strains CanBc-1c-66 and CanBc-2 in 8-day-old cultures in potato dextrose broth (PDB). Cultural filtrates of strains CanBc-1, CanBc-1c-66 and CanBc-2 from 21-dayold PDB cultures suppressed growth of roots and hypocotyls of barley, and the suppressive efficacy was not significantly different (P > 0.05) among the three investigated strains of B. cinerea. These results suggest that rare formation of infection cushions and attenuated mycelial growth are probably responsible for hypovirulence of strain CanBc-1 of B. cinerea infected by the mitovirus BcMV1. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Botrytis cinerea Hypovirulence Mitovirus BcMV1 Infection cushions
1. Introduction Botrytis cinerea Pers.: Fr. [teleomorph: Botryotinia fuckeliana (de Bary) Whetzel] is a cosmopolitan plant pathogenic fungus, causing gray mold disease on mature and senescent plant tissues [1]. It can infect more than 200 species of plants including bulb onions (Allium cepa L.), oilseed rape (Brassica napus L.) and tomato (Lycopersicon esculentum Mill.). The gray mold disease is important on these crops grown in the field or in the greenhouse, especially under cool and humid conditions. B. cinerea infects a plant through direct penetration of epidermis by infection hyphae formed on appressorium-like structures [2] or on infection cushions [2e5], or through wounds [1]. Appressorium-like structures of B. cinerea are usually developed at the tip of conidial germ tubes. They are oval-shaped, but are neither melanized nor septum-separated [2]. Infection cushions of B. cinerea developed at
* Corresponding author. Tel.: þ86 27 87286880. E-mail addresses: [email protected], [email protected] (G.Q. Li). 0885-5765/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2010.09.001
the hyphal tips are multi-cellular, claw-like, densely ramified, domeshaped and highly melanized [6]. As a necrotrophic plant pathogen, B. cinerea uses multiple chemical weapons to kill host cells in penetration of plant epidermis and colonization of plant tissues [7,8]. Previous reports showed that B. cinerea can produce numerous cell wall-degrading enzymes (CWDEs), including cutinase [9], lipase [10], exo- and endo-polygalacturonases [11e15], pectin methylesterases [16], cellulases and hemicellulases [17]. Some of these CWDEs have been found to be closely associated with virulence or aggressiveness of B. cinerea [1,8]. The infection process of B. cinerea also involves secretion of host-nonspecific toxic metabolites produced by the pathogen [18,19] such as botrydial [20e22] and oxalic acid [5], and accumulation of reactive oxygen species such as hydrogen peroxide in appressorium-like structures and in infection cushions of B. cinerea [6]. These chemicals can kill plant cells, thus facilitating infection and colonization of plant tissues by B. cinerea [7,23]. Mycoviruses or fungal viruses are obligate parasites of fungi. They are widespread in all major taxonomic groups of plant pathogenic fungi, and are transmitted vertically through fungal sporulation and
72
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
horizontally through hyphal anastomosis [24,25]. So far, seven families of mycoviruses, namely Chrysoviridae, Endornaviridae, Hypoviridae, Narnaviridae, Partitiviridae, Reoviridae and Totiviridae have been documented [24]. Some mycoviruses can be potentially used for control of fungal diseases, as they are capable of attenuating virulence or pathogenicity of fungal pathogens [26]. Meanwhile, understanding of the interaction between mycoviruses and their fungal hosts, and between plant hosts and mycovirus-infected fungal pathogens can help to unveil mechanisms involved in fungal pathogenesis [26]. A hypovirulent strain CanBc-1 of B. cinerea was isolated from oilseed rape in our previous study [27]. It is severely debilitated in pathogenicity (hypovirulent) on oilseed rape. Hypovirulence of strain CanBc-1 was found to be closely associated with the presence of a species of Mitovirus (family Narnaviridae), designated as B. cinerea debilitation-related RNA virus (BcDRV) [27]. Now, BcDRV was renamed as Botrytis cinerea mitovirus 1 (BcMV1) [28] according to the nomenclature rule of International Committee on Taxonomy of Viruses (ICTV). However, mechanisms responsible for hypovirulence of this mitovirus-infected strain of B. cinerea remain unknown. The objective of this study was to determine mechanisms involved in hypovirulence of strain CanBc-1, including observation of formation of infection cushions on host plants (onion, oilseed rape and tomato) and detection of production of extra-cellular enzymes and toxic metabolites in culture media. 2. Materials and methods 2.1. Fungal strains and culture media Three strains of B. cinerea, hypovirulent strain CanBc-1 and virulent strains CanBc-2 and CanBc-1c-66 were used in this study. In some experiments, another hypovirulent strain CanBc-1c-66a of B. cinerea was used. Strain CanBc-1c-66 was a single-conidium isolate from strain CanBc-1 and strain CanBc-1c-66a was a mycelial derivative of virulent strain CanBc-1c-66 trans-infected by BcDRV or BcMV1 [27]. Infection by BcMV1 was detected in strains CanBc-1 and CanBc-1c-66a, but was not detected in strains CanBc-1c-66 and CanBc-2 [27]. Culture media used in this study were potato dextrose agar (PDA), potato dextrose broth (PDB), Maxwell liquid medium (MLM) and modified Kebede’s liquid medium (MKLM). PDA and PDB were prepared using fresh potato, whereas MLM was prepared according to the description by Maxwell and Lumsden [29]. MKLM was prepared according to the description by Moyo et al. [30] and it was modified by addition of 1% (w/v) citrus pectin (Sigma Chemical Company, St Louis, MO, USA). All culture media were autoclaved at 121e125 C for 20 min. 2.2. Microscopic observation of infection cushions Formation of infection cushions by strains of CanBc-1, CanBc-1c66 and CanBc-2 of B. cinerea on onion, oilseed rape and tomato was investigated using light microscope (LM) and scanning electron microscope (SEM). For LM observation, mycelial agar plugs (MAP, 6 mm diam.) of strains CanBc-1, CanBc-1c-66 or CanBc-2 were removed from 3-day-old PDA cultures and placed face-down on the outer side of detached bulb scales of onion, 2 MAPs per bulb scale. Bulb scales of onion inoculated with PDA alone were used as control. The bulb scales of onion (inoculated with B. cinerea and the control) were placed on moistened paper towels in plastic trays, which were individually covered with transparent plastic films to maintain high humidity. After incubation at 20 C for 12 and 60 h, MAPs of strains CanBc-1, CanBc-1c-66 and CanBc-2 on the bulb scales of onion were removed and the epidermis beneath each MAP was carefully peeled
off using a razor blade, stained with methyl blue and examined for formation of infection cushions under a compound light microscope. Five microscopic fields at the 100 magnification were randomly chosen on each onion epidermal piece for counting the number of infection cushions formed by B. cinerea. A total of five onion epidermal pieces for each strain incubated at 12 or 60 h were examined. For SEM observation, MAPs of strains CanBc-1, CanBc-1c-66 or CanBc-2 were inoculated on true leaves of oilseed rape (B. napus cv. Zhongyou Za No. 4) or tomato (L. esculentum cv. Bing Hong No.2) detached from 40-day-old seedlings. The inoculated leaves were placed on moisturized paper towels in plastic trays, which were then individually covered with transparent plastic films and incubated at 20 C for 16 and 60 h. The leaf tissue from the inoculation spots was cut into small pieces (2 2 mm, length width), which were then immersed in 2.5% (w/v) glutaraldehyde solution in sodium phosphate buffer (0.05 M, pH 7.0) at 4 C for 24 h, washed three times in 0.05 M sodium phosphate buffer, 10 min each time, and dehydrated in a degraded ethanol series. After critical point drying (13200-AB, SPI SUPPLIES, PA, USA) and gold-coating in a sputter coater (JFC-1600, NTC, Japan), the leaf specimens were examined for infection cushions under a scanning electron microscope (JSM-6390/LV, NTC, Japan). To confirm the difference between hypovirulent strain CanBc-1 and virulent strains CanBc-1c-66/CanBc-2 of B. cinerea in formation of infection cushions on leaf surface, hyphae within leaf tissues of oilseed rape caused by infection cushion-mediated penetrations were retrieved by incubation of the surface-sterilized leaf tissues of oilseed rape on PDA. MAPs of each strain of B. cinerea were inoculated on leaves of oilseed rape using the procedures mentioned above. Leaves of oilseed rape inoculated with un-colonized PDA were used as control. After incubation at 20 C under high humidity for 24 h for strains CanBc-2 and CanBc-1c-66, and for 96 h for strain CanBc-1, leaf tissues of oilseed rape (4 4 mm) at the inoculation spots on leaves of oilseed rape were cut off using a pair of sterilized scissors, surfacesterilized in 5% (w/v) NaClO solution for 5 min, rinsed in sterile distilled water three times, 1 min each time, and placed on PDA in Petri dishes. The dishes were then incubated at 20 C for 10 days and the fungal colony formed around each leaf tissue was identified for B. cinerea on the basis of the colony morphology [27]. Sixteen isolates of B. cinerea from leaf tissues of oilseed rape inoculated with strains CanBc-1c-66 (five isolates), CanBc-2 (five isolates) and CanBc-1 (six isolates) were selected for testing the mycelial growth rate on PDA, pathogenicity on detached leaves of oilseed rape and the presence of the 3.0-kb dsRNA (BcMV1) in mycelia using the methods described by Wu et al. [27]. Strains CanBc-1, CanBc-1c-66 and CanBc-2 were used as controls in these tests. An additional experiment was done to test the possibility of infection of plant tissues by strain CanBc-1 of B. cinerea through wounds. A sharp dissecting needle was used to puncture two leaf areas beside the main vein of each oilseed rape leaf. Non-wounded leaves of oilseed rape were used as control. Five wounded leaves and five non-wounded leaves were placed in two rows (five leaves each row) on moisturized paper towels in an enamelware tray. MAPs of strain CanBc-1 were inoculated face down on wounded areas of each wounded leaf or on each non-wounded leaf at the same positions, two MAPs per leaf. The tray was covered with a transparent plastic film and incubated in a growth chamber (20 C) with the regime of 12-h light/12-h dark. Diameter of the leaf lesion developed around each MAP was measured after incubation for 72 h. The experiment was repeated one more time. 2.3. Pectinase activity assay Production of pectinase by strains CanBc-1, CanBc-1c-66a, CanBc-1c-66 and CanBc-2 of B. cinerea in media was determined
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80 Table 1 Oligonucleotide primers used for RT-PCR detection of gene expression in Botrytis cinerea. Target gene
Use Primer (50 / 30 )
Bcpg1a F R Bcpg2 F R Bcpg3 F R Bcpg4 F R Bcpg5 F R Bcpg6 F R Bclcc1 F R Bclcc2 F R BcactAb F R a b
AATATGGTTCAACTTCTCTCAATG TTAACACTTGACACCAGATGGG TTGACCCTGGCTACTCCT CAAACCCTTTCACCTGAT CTTGTGCCAATGCTTTCA TCAGGCTTGTCGGTTCCT TTCAAGGAGTGGGAAGGA CGATGAGGATACCGTATTTAG TCTGCCTGTCTCCTCTTG CGGGTGGGTTGTAGAAGTA GCGGTTCTGGAATCACTG GGTAGTTTCGGAATTTGAC TCTTCGGTCCTCTTGTTATT GTTGGGTCGGTCCAGTTTAG CTACTGCGGACTATGATGAAGATG GCGATATGGCAATGAAGAAGC TGTCTTTGAGACCTTCAACGC GGTGCAATGATCTTGACCTTC
Annealing Ref. DNA sequence Temp. ( C) (GenBank Acc. No.) 58
AY665552
52
U68716
52
U68717
54
U68719
56
U68721
55
U68722
56
AF243854
50
AF243855
55
AJ000335
The primers were modified from those of Kars et al. [15]. The primers referred to Choquer et al. [35].
both qualitatively and quantitatively. The qualitative determination was done in Petri dishes (9 cm diam.) containing 20 ml polygalacturonic acid (PGA) agarose medium [1% agarose (w/v), 0.1% PGA (w/v), pH 4.2]. MAPs (10 mm diam.) were removed from the colony margin of a 9-day-old PDA culture of B. cinerea and placed on PGA-containing medium in Petri dishes (9 cm diam.), four MAPs per dish. A filter paper disc (6 mm diam.) soaked in 20 ml of the
73
standard pectinase solution (125 U/ml) from Aspergillus niger (Sigma Chemical Company) was placed at the center of each dish. There were three dishes (replicates) for each strain of B. cinerea. After incubation at 45 C for 12 h, the MAPs and the filter paper disc were carefully removed from each dish, which was then flooded with ruthenium red solution (0.03%, w/v) for 2 h at 4 C. Strains of B. cinerea with pectinase activity were determined by the presence of clear zones on the PGA-containing medium [31]. The experiment was repeated three times. Pectinase activity in cultural filtrates of each strain of B. cinerea was determined quantitatively by the colorimetric method described by Moyo et al. [30]. MAPs of each strain were inoculated in 100 ml MKLM medium in 250-ml Erlenmeyer flasks, one plug per flask. The flasks were then placed on a shaker and incubated (150 rpm) at 20 C. Three flasks of cultures of each strain were taken out from the shaker after incubation for 3, 6, 9, 12 and 15 days. The cultural filtrates and mycelia in each flask were separated using a piece of pre-weighed filter paper (90 mm diam). The mycelial mats were dried at 60 C for 48 h and weighed to estimate dry mycelial biomass. The cultural filtrate was assayed for pectinase activity using the procedure described by Moyo et al. [30]. One unit (U) of the enzymatic activity was defined as the amount of the enzyme required for catalysis of citrus pectin to produce 1 mmol galacturonic acid. The yield of pectinase was expressed as U/ml cultural filtrate. The experiment was repeated three times. 2.4. Bioassay of toxic metabolites Strains CanBc-1, CanBc-1c-66 and CanBc-2 of B. cinerea were inoculated in PDB in 250-ml Erlenmeyer flasks, 100 ml/flask and
Fig. 1. Comparison of formation of infection cushions by strains CanBc-2 (A, 12 hpi), CanBc-1c-66 (B, 12 hpi) and CanBc-1 (C, 60 hpi) of Botrytis cinerea on epidermis of onion bulbs. The inoculated tissues of onion bulbs inoculated with B. cinerea were stained with methyl blue. Note formation of infection cushions (ic) and infectious hyphae (ih) by strains CanBc2 and CanBc-1c-66, but no formation of infection cushions on growing hyphae (h) by strain CanBc-1. Number of infection cushions (5 microscopic fields under 100) was presented in graph D.
74
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
three flasks for each strain. After incubation at 20 C in the dark for 21 days, the culture of B. cinerea in each flask was filtered to collect the cultural filtrate. To test the toxicity of the cultural filtrates of B. cinerea, barley seeds (Hordeum vulgare L. cv. Zheng 98) were soaked in the culture filtrates of each strain or in water (CK) for 8 h at 20 C, placed on moistened filter papers in Petri dishes, 20 seeds per dish and 3 dishes per treatment. After incubation at 20 C under 12-h light/l2-h dark for 72 h, germinated seeds in each dish were measured for length of the roots and the hypocotyl formed on each barley seed to compare the difference in growth of barley roots ad hypocotyls among treatments. The test was repeated three times.
2.5. Assay of oxalic acid Strains CanBc-1, CanBc-1c-66 and CanBC-2 of B. cinerea were inoculated in 50 ml MLM medium in 250-ml Erlenmeyer flasks,
which were incubated on the shaker (150 rpm) at 20 C. Three flasks of cultures of each strain were retrieved from the shaker after incubation for 3, 6, 9, 12 and 15 days for measuring mycelial dry weight (60 C, 48 h), pH value of the cultural filtrates using a pH meter and the concentration of oxalic acid (OA) in the cultural filtrates using high performance liquid chromatography [32]. The OA yield in each flask of culture was expressed as mg OA/g dry mycelia. The assay was repeated three times.
2.6. Assay of laccase activity Production of laccase by strains CanBc-1, CanBc-1c-66a, CanBc1c-66 and CanBc-2 of B. cinerea was determined both qualitatively and quantitatively. Qualitative determination of the laccase activity was done in Petri dishes. For each strain of B. cinerea, MAPs (10 mm diam.) were removed from the colony margin of an 8-day-old PDA
Fig. 2. Scanning electron micrographs showing difference in formation of infection cushions by strains CanBc-2 (A and B), CanBc-1c-66 (C and D) and CanBc-1 (E and F) of Botrytis cinerea on leaves of oilseed rape. Note the formation of infection cushions by strains CanBc-2 and CanBc-1c-66 at 16 hpi, but no formation of infection cushions by strain CanBc-1 (E, F) at 60 hpi. ic ¼ infection cushion, ec ¼ epidermal cells, h ¼ hyphae.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
75
culture and inoculated on PDA amended with 0.05% (w/v) tannic acid (Sigma Chemical Company) in Petri dishes, four MAPs per dish. After incubation at 37 C for 24 h, the laccase activity of each strain was examined by checking the browning zone surrounding each MAP [33]. Quantitative determination of the laccase activity was done using the method described by Shin and Lee [34]. Strains CanBc-1, CanBc-1c-66, CanBc-1c-66a and CanBc-2 of B. cinerea were separately cultured in PDB on a shaker (15 rpm) at 20 C for 8 days. Each culture of B. cinerea in a flask was filtered through a filter paper to separate mycelial biomass and cultural filtrate. The mycelial biomass was treated at 60 C for 48 h for measuring dry weight. The cultural filtrate was treated as the crude laccase. The laccase activity in the cultural filtrate was measured by determining oxidation of ABTS [2,20 -azino-bis-(3- ethylbenzo- thiazoline-6-sulfonate)]. An aliquot of 2 ml of each cultural filtrate was mixed with 1 ml ABTS (1 mM) and the mixture was incubated at 25 C to produce cation radicals, which were then monitored in a spectrophotometer (BioPhotometer Plus 6132, Eppendorf, Germany) at 420 nm (3max ¼ 3.6 104/cm/M). One laccase unit (U) was defined as the amount of enzyme required to oxidize 1 mmol of ABTS per minute [34]. The laccase yield produced by each strain of B. cinerea in each culture was expressed as units of laccase per liter of cultural filtrate (U/l). The experiment was repeated three times.
then incubated at 20 C for 60 h. Mycelial mats of each strain were harvested from each dish for RNA extraction. Total RNA was extracted from mycelia of each strain of B. cinerea using TRIzolÒ reagent (InvitrogenÔ, USA) following the manufacturer’s instructions. The RNA extracts were treated with RQ1 RNase-free DNase (Promega, WI, USA) to digest contaminated DNA in the RNA mixtures. The quality of the RNA extract was evaluated for the integrity and the size distribution by agarose gel electrophoresis [35], and the RNA concentration was determined in a spectrophotometer by measuring the absorbance value of each RNA solution at 260 nm. A sample of 1 mg of the DNase-treated RNA solution from each strain of B. cinerea was reverse transcribed using PrimescriptÔ 1stStrand cDNA Synthesis Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) following the manufacturer’s instructions. The reverse transcription product (1 ml) was then used as template in PCR for detecting the expression of each gene (Bcpg1-6, Bclcc1, Bclcc2, BcactA) in S1000Ô Thermal Cycler (Bio-Rad Laboratories, Inc., CA, USA) with primer pairs listed in Table 1. The PCR program was set as: 94 C for 5 min (1 cycle); followed by 94 C for 30 s, 50e58 C for 30 s and 72 C for 60 s (30 cycles); finally 72 C for 10 min (1 cycle). The PCR product (7 ml) of each gene was loaded on agarose gel (1%, w/v) for electrophoresis. The gel was stained with ethidium bromide solution (1.5 mg/l) after electrophoresis and viewed on an UV trans-illuminator to show the DNA band for each target gene.
2.7. RT-PCR
2.8. Data analysis
Reverse transcription (RT) PCR was used to detect expression of genes coding for endo-polygalacturonases 1 to 6 (Bcpg1-6) and laccases 1 and 2 (Bclcc1 and Bclcc2) in strains CanBc-1, CanBc-1c66a, CanBc-1c-66 and CanBc-2 of B. cinerea. Detection of the expression of BcactA coding for actin in each strain of B. cinerea was used as control. To detect the expression of Bcpg1-6, MAPs of each strain were inoculated on sterilized cellophane membranes placed on PDA in 20 dishes, four MAPs per dish. The dishes were incubated at 20 C in the dark for 60 h. Mycelial mass of each strain harvested from 4 to 10 dishes was transferred to an Erlenmeyer flask (250 ml) containing 50 ml MLKM medium. The flask was incubated on a shaker (80 rpm) at 20 C for 24 h to induce the expression of Bcpg1-6. Mycelial mats in the flask were harvested, blot-dried on filter papers and stored at 80 C until use for RNA extraction. To detect the expression of Bclcc1 and Bclcc2, strains CanBc-1, CanBc1c-66a, CanBc-1c-66 or CanBc-2 were inoculated on sterilized cellophane membranes placed on PDA in Petri dishes, which were
Analysis of variance (ANOVA) in SAS software (SAS Institute, Cary, NC, USA, Version 8.0, 1999) was used to analyze data on the mycelial growth rate, the lesion diameter, the yield of pectinase and laccase, and on the percentage of the inhibition of growth of barley roots and barley hypocotyls by cultural filtrates of B. cinerea. Data of the same treatment, but collected from different repeats of the same experiment, were pooled when they were not significantly different (P > 0.05) in the F-test of ANOVA. Means of each parameter for different strains of B. cinerea were compared using Least Significant Difference Test at P ¼ 0.05 level. 3. Results 3.1. Formation of infection-cushions Numerous infection cushions were formed by strains CanBc-2 and CanBc-1c-66 of B. cinerea on epidermis of onion bulbs (Fig. 1A, B) after
Fig. 3. Pathogenicity of strains CanBc-2 (A), CanBc-1c-66 (B) and CanBc-1 (C) of Botrytis cinerea on leaves of oilseed rape (20 C, 72 h). Note formation of necrotic lesions by strains CanBc-2 and CanBc-1c-66. Note also profuse mycelial growth, but no formation of visible necrotic lesions by strain CanBc-1.
76
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
Table 2 Radial growth rate, lesion diameter and double-stranded (ds) RNA in different strains/isolates of Botrytis cinerea. Strain/isolate
Radial growth rate (mm/day)a
Lesion diameter (mm)b
dsRNAc
CanBc-1 CanBc-1L1 CanBc-1L2 CanBc-1L3 CanBc-1L4 CanBc-1L5 CanBc-1L6 CanBc-1c-66 CanBc-1c-66L1 CanBc-1c-66L2 CanBc-1c-66L3 CanBc-1c-66L4 CanBc-1c-66L5 CanBc-2 CanBc-2L1 CanBc-2L2 CanBc-2L3 CanBc-2L4 CanBc-2L5 LSD0.05 (df2)e
4.5 id 14.3abc 14.4 ab 13.9 abcd 12.5 fg 10.2 h 11.9 g 12.8 efg 13.7 bcde 13.4 cdef 13.9 abcd 13.0 def 12.9 efg 14.8 a 13.6 bcde 13.9 abcd 14.3 abc 13.4 cdef 13.1 def 0.98 (76)
0h 17.4 f 17.8 ef 17.4 f 14.8 g 12.8 g 14.4 g 18.1 ef 18.4 cdef 18.4 cdef 18.2 def 18.0 ef 18.6 bcdef 20.4 abcd 20.6 abc 20.8 ab 21.2 a 19.8 abcde 20.8 ab 2.2 (171)
þ
a Radial growth rate of each strain was measured daily on cultures grown on PDA at 20 C in dark. b Lesion diameter of each strain on leaves of oilseed rape was measured after inoculation for 72 h. c “þ” ¼ presence of dsRNA in the strain; “” ¼ absence of dsRNA in the strain. d Means followed by the same letter in each column are not significantly different (P > 0.05) by radial growth rate and pathogenicity test. e df ¼ degree of freedom.
incubation for 12 h, and on leaves of oilseed rape (Fig. 2AeD) and tomato (Supplementary Fig. S1) after incubation for 16 h. Formation of infectious hyphae was frequently observed on infection cushions (Fig. 1A, B). The average number of infection cushions within five microscopic fields (100) on each epidermal piece of onion bulb was 152 and 166 for strains CanBc-1c-66 and CanBc-2, respectively (Fig. 1D). After incubation for 72 h, tissues of onion bulbs (data not shown) and leaves of oilseed rape (Fig. 3A, B) and tomato (data not shown) at and around the pathogen inoculation sites became collapsed and disintegrated with the formation of necrotic lesions. In contrast, formation of infection cushions by strain CanBc-1 of B. cinerea was rarely observed on epidermis of onion bulbs (Fig. 1C), and on leaves of oilseed rape (Fig. 2E, F) and tomato (Supplementary Fig. S1) after incubation even for 60 h. The average number of infection cushions within five microscopic fields (100) was 6 on each epidermal piece of onion bulb (Fig. 1D). Tissues of onion bulbs
(data not shown) and oilseed rape (Fig. 3C) in direct contact with the mycelial inoculum of strain CanBc-1 remained healthy without formation of visible necrotic lesions after incubation for 72 h, even on wounded leaf tissues of oilseed rape (Supplementary Table S1). The isolation frequency of B. cinerea was 2.9% from the leaf tissues of oilseed rape inoculated with strain CanBc-1 after incubation for 96 h. In contrast, the isolation frequency was 90.9 and 92.5% for the inoculation treatments of strains CanBc-2 and CanBc-1c-66, respectively, after incubation for 24 h. Six isolates of B. cinerea from the inoculation treatment of strain CanBc-1 (isolates CanBc-1L1 to CanBc-1L6) grew at 11.9e14.4 mm/d on PDA, significantly higher than that of strain CanBc-1 (4.5 mm/d) (Table 2). All of these isolates were virulent on leaves of oilseed rape with the average lesion diameter ranging from 12.8 to 17.8 mm, significantly larger than that of strain CanBc-1, which caused no infection on leaves of oilseed rape (Table 2). The 3.0-kb dsRNA of BcMV1 was detected in strain CanBc-1, but was not detected in all the virulent isolates from the inoculation treatment with strain CanBc-1 (Table 2). Five isolates of B. cinerea from the inoculation treatment of strain CanBc-2 (isolates CanBc-2L1 to CanBc-2L5) and five isolates from the inoculation treatment of strain CanBc-1c-66 (CanBc-1c66L1 to CanBc-1c-66L5) grew rapidly on PDA with the radial growth rates ranging from 12.9 to 14.3 mm/d. All these isolates of B. cinerea were similar to strain CanBc-1c-66 and CanBc-2 in pathogenicity on leaves of oilseed rape with the average lesion diameters ranging from 18.0 to 21.2 mm (Table 2). The 3.0-kb dsRNA of BcMV1 was not detected in strains CanBc-2 and CanBc-1c-66, and in all these virulent isolates from the inoculation treatments of these two strains. 3.2. Pectinase production Results of the qualitative determination showed that on the PGA-containing medium, clear zones were produced by strains CanBc-1 (hypovirulent), CanBc-1c-66a (hypovirulent), CanBc-1c-66 (virulent), CanBc-2 (virulent) and by the standard pectinase from A. niger (Fig. 4A). This result indicates that these strains of B. cinerea can secrete pectinase. Production of pectinase by these strains of B. cinerea was confirmed by the quantitative assay of 3- to 15-dayold cultures in MKLM medium and by RT-PCR. The yield of pectinase of the 3- to 9-day-old cultural filtrates of strain CanBc-2 (0.6 to 1.3 U/ml) was significantly higher (P < 0.05) than the yield of pectinase produced by strains CanBc-1 (0.4 to 1.0 U/ml), CanBc-1c66 (0.5 to 1.0 U/ml) and CanBc-1c-66a (0.4 to 1.0 U/ml). After incubation for 12 and 15 days, the pectinase activity in the cultural filtrates of all these strains of B. cinerea decreased to 0.5e0.6 U/ml
Fig. 4. Qualitative (A) and quantitative (B) determination of pectinase produced by hypovirulent strains of Botrytis cinerea. In Fig. 2A, pectinase (2.5 U) produced by Aspergillus niger was used as standard (CK). Clear zones at the inoculation sites in the Petri dish indicate the pectinase activity. In Fig. 2B, means labeled with same letter at each sampling date are not significantly different (P > 0.05) according to Least Significant Difference Test.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
77
3.4. Production of oxalic acid Dry mycelial biomass from 15-day-old cultures of strain CanBc-1 in MLM was significantly lower (P < 0.05) than that of strains CanBc-1c-66 or CanBc-2 (Fig. 7). Ambient pH was decreased from the initial (day 0) of 6.6 to the final (day 15) of 5.5, 5.6 and 4.2for strains CanBc-1, CanBc-1c-66 and CanBc-2, respectively. The amount of oxalic acid (OA) produced by the strain CanBc-2 was 161 mg OA/g dry mycelia. This yield was significantly higher (P < 0.05) than that for strains CanBc-1 (127 mg/g dry mycelia) and CanBc-1c-66 (47 mg/g dry mycelia) (Fig. 7). 3.5. Production of laccase
Fig. 5. RT-PCR detection of expression of endopolygalacturonase genes (Bcpg1-6) in the hypovirulent strains CanBc-1 and CanBc-1c-66a, and the virulent strains CanBc-2 and CanBc-1c-66 of Botrytis cinerea. Detection of the expression the actin A gene (BcactA) in each strain was used as control. HV ¼ hypovirulent, V ¼ virulent.
with a slight difference among these strains (Fig. 4B). In the RT-PCR assay, expression of the six endo-polygalacturonase genes (Bcpg1-6) was positively detected in mycelia of all investigated strains of B. cinerea (Fig. 5).
Both the hypovirulent strains (CanBc-1 and CanBc-1c-66a) of B. cinerea and the virulent strains (CanBc-1c-66 and CanBc-2) of B. cinerea were detected to be able to produce laccase, as indicated by the brown color around the inoculum of each strain on the tannic acid-containing medium (Fig. 8A). The brown color caused by the hypovirulent strains was darker than the brown color caused by the virulent strains. Production of laccase by these strains of B. cinerea was confirmed by the quantitative assay and by RT-PCR. The laccase yield produced by strains CanBc-1 and CanBc-1c-66a was 11.5 and 14.4 U per liter of cultural filtrate (U/l), respectively. These values were significantly (P < 0.05) higher than those for strains CanBc-2 (7.5 U/l) and CanBc-1c-66 (8.1 U/l) (Fig. 8B). In the RT-PCR assay, expression of two genes coding for laccases (Bclcc1 and Bclcc2) was detected in the four investigated strains of B. cinerea (Fig. 8B).
3.3. Production of toxic metabolites 4. Discussion Compared to the water (CK) treatment, cultural filtrates of B. cinerea (strains CanBc-1 CanBc-1c-66, CanBc-2) suppressed growth of barley hypocotyl and barley roots by 61e69% and 90e93%, respectively (Fig. 6A). No significant differences (P > 0.05) among the three investigated strains of B. cinerea in suppressive efficacy were detected (Fig. 6B).
Mycovirus-associated fungal hypovirulence has been found to be widespread in all taxonomic groups of plant pathogenic fungi [24,25]. Several abnormal traits including suppression of mycelial growth, formation of abnormal colony sectors and reduction of sporulation, as well as suppression of production of phytotoxins,
Fig. 6. Toxicity of metabolites of the hypovirulent strain CanBc-1, and the virulent strains CanBc-2 and CanBc-1c-66 of Botrytis cinerea on roots and hypocotyls of barley. Note no significant difference (P > 0.05) in suppression of growth of roots (n ¼ 9) and hypocotyls (n ¼ 9) by cultural filtrates of the three investigated strains of B. cinerea according to Least Significant Difference Test.
78
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
Fig. 7. Time-course of dry mycelial biomass (A), ambient pH (B) and yield of oxalic acid (C) produced by hypovirulent strain CanBc-1, and by virulent strains CanBc-2 and CanBc-1c-66, of Botrytis cinerea in Maxwell liquid medium. Vertical bars represent standard errors of means (n ¼ 9).
pigments and laccases are reported to be closely associated with hypovirulence of fungi infected by various mycoviruses [24,25,36]. Wu et al. (2007) reported that the hypovirulent strain CanBc-1 of B. cinerea has a few abnormal traits associated with hypovirulence, including suppression of mycelial growth, formation of abnormal colony sectors, and reduction of conidial production and sclerotial formation [27]. Wu et al. (2010) also reported that hypovirulence of strain CanBc-1 of B. cinerea was closely associated with the presence of a species of Mitovirus BcMV1 [28]. This study reveals that infection cushions were frequently formed on host tissues (onion, oilseed rape and tomato) by the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea, but were rarely formed by the hypovirulent strain CanBc-1 of B. cinerea. Therefore, rare formation of infection cushions by strain CanBc-1 of B. cinerea on plant tissues appears closely associated with hypovirulence of strain CanBc-1 of B. cinerea infected by the mitovirus BcMV1. This association suggests the importance of formation of infection cushions in pathogenesis of B. cinerea. However, strain CanBc-1 of B. cinerea failed to infect wounded leaves of oilseed rape according to the present study. It implies that strain CanBc-1 is unable to colonize leaf tissues of oilseed rape. It becomes less aggressive than virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea, although it is similar to these two virulent strains in production of pectinase and toxic metabolites. The loss in aggressiveness in strain CanBc-1 of B. cinerea might be closely associated with, or caused by, suppressed mycelial growth [27]. Wu et al. (2010) reported that BcMV1 can directly attack mitochondria within hyphal cells of B. cinerea, resulting in malformation of mitochondria (swelling and cristae degeneration), thereby attenuating mitochondrial function and at last suppressing mycelial growth of B. cinerea [27]. Taking all the information together, a preliminary conclusion can be made that rare formation of infection cushions and/or suppression of mycelial growth might be responsible for hypovirulence of strain CanBc-1 of B. cinerea. Additional studies by comparing the gene expression profile in strains CanBc-1 and CanBc-1c-66 are necessary for mining molecular mechanisms involved in hypovirulence of strain CanBc-1 of B. cinerea. The information will help to understand pathogenesis mechanisms of B. cinerea at the molecular level. Production of phytotoxins including oxalic acid (OA) by B. cinerea has been proposed to be able to facilitate plant cell death, thus
Fig. 8. A: Qualitative assay of activity of laccase produced by the hypovirulent (HV) strains CanBc-1 and CanBc-1c-66a, and the virulent (V) strains CanBc-1c-66 and CanBc-2 of Botrytis cinerea on a tannic acid-containing medium. The brown color around the inoculum plug of each strain indicates the laccase activity; B: Quantitative determination of the activity of laccase produced in potato dextrose broth and RT-PCR detection of expression of laccase genes (Bclcc1 and Bclcc2) in B. cinerea. In the histogram, results are expressed as means standard errors (n ¼ 9). Bars labeled with different letters indicate significant difference (P < 0.05) according to Least Significant Difference Test. dsRNAþ ¼ dsRNA positive, dsRNA ¼ dsRNA negative.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
promoting B. cinerea to penetrate and to colonize plant tissues [7,8]. Kunz et al. (2006) reported that the oxalate-deficient mutant A336 of B. cinerea is non-pathogenic on intact and wounded plant tissues, although it is able to penetrate plant tissues [5]. This result suggests that OA is an important factor for pathogenesis of B. cinerea. Contrary to the mutant A336, strain CanBc-1 of B. cinerea investigated in this study was detected to be able to produce OA with the yield of OA higher than that for the virulent strain CanBc-1c-66 of B. cinerea. Therefore, hypovirulence of strain CanBc-1 of B. cinerea might not be caused by OA production. This result does not mean that OA production is not important in pathogenesis of B. cinerea, as the mechanisms involved in non-pathogenicity of the mutant A336 and in hypovirulence of strain CanBc-1 might be different. The mutant A336 was generated by insertional mutagenesis [5]. Deficiency in OA production by this mutant might be caused by mutation of some nuclear genes associated with OA biosynthesis. In contrast, strain CanBc-1 of B. cinerea is infected by a species of Mitovirus (BcMV1) [27,28]. Nuclear genes associated with OA biosynthesis in strain CanBc-1 may not be changed, compared to virulent strains of B. cinerea. Further studies to disclose the relationship between OA production and other pathogenesis-related elements in B. cinerea are warranted. This study indicates that the BcMV1-infected hypovirulent strains CanBc-1 and CanBc-1c-66a of B. cinerea produced more laccase than the BcMV1-free virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea. In contrast, Castro et al. (2003) reported that production of laccase by the hypovirulent strain CCg425 of B. cinerea infected with a 6.8-kb dsRNA mycovirus was significantly lower than the laccase produced by the mycovirus-free virulent strain CKg54 of B. cinerea [37]. Whether different mycoviruses in B. cinerea are the cause for the difference in production of laccase between this study and the report by Castro et al. [37] remains unknown and warrants further investigations. Nevertheless, higher laccase production by the hypovirulent strains CanBc-1 and CanBc1c-66a of B. cinerea than the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea in this study suggests that production of laccase may be unimportant for virulence of this pathogen. The absence of the 3.0-kb dsRNA (BcMV1) in the six virulent isolates of B. cinerea derived from leaves of oilseed rape inoculated with the hypovirulent strain CanBc-1 suggests that BcMV1 in the parental hypovirulent strain CanBc-1 may have been eliminated during its infection of leaf tissues of oilseed rape. Uneven distribution of BcMV1 in cytoplasm of hyphal cells of B. cinerea [27,28] may be the reason responsible for elimination of BcMV1 in some hyphal cells. Wu et al. (2007) reported that BcMV1 in the hypovirulent strain CanBc-1 of B. cinerea can be eliminated through the asexual reproduction (conidia) process [27]. Results about the virulence recovery and BcMV1 elimination in isolates of B. cinerea from leaves of oilseed rape inoculated with strain CanBc-1 suggests that plant inoculation and fungal retrieval from plant tissues might be another approach to eliminate BcMV1 from B. cinerea.
Acknowledgements This research was funded by the Natural Science Foundation of China (Grant Nos. 30570079, 31070122). The authors would like to thank Mr. J. B. Cao at the Huazhong Agricultural University,Wuhan, China for technical assistance on scanning electron microscopy.
Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.pmpp.2010.09.001.
79
References [1] Williamson B, Tudzynski B, Tudzynski P, van Kan JAL. Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 2007;8:561e80. [2] Garcia-Arenal F, Sagasta EM. Scanning electron microscopy of Botrytis cinerea penetration of bean (Phaseolus vulgaris) hypocotyls. Phytopathol Z 1980; 99:37e42. [3] Sharman S, Heale JB. Penetration of carrot roots by the grey mould fungus Botrytis cinerea Pers. ex Pers. Physiol Plant Pathol 1977;10:63e71. [4] Backhouse D, Willets HJ. Development and structure of infection cushions of Botrytis cinerea. Trans Br Mycol Soc 1987;89:89e95. [5] Kunz C, Vandelle E, Rolland S, Poinssot B, Bruel C, Cimerman A, et al. Characterization of a new, nonpathogenic mutant of Botrytis cinerea with impaired plant colonization capacity. N Phytol 2006;170:537e50. [6] Choquer M, Fournier E, Kunz C, Levis C, Pradier JM, Simon A, et al. Botrytis cinerea virulence factors: new insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol Lett 2007;277:1e10. [7] Govrin EM, Levine A. The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Curr Biol 2000;10:751e7. [8] van Kan JAL. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends Plant Sci 2006;11:247e53. [9] van Kan JAL, van’t Klooster JW, Wagemakers CA, Dees DC, van der VlugtBergmans CJ. Cutinase A of Botrytis cinerea is expressed, but not essential, during penetration of gerbera and tomato. Mol Plant Microbe Interact 1997;10:30e8. [10] Reis H, Pfiffi S, Hahn M. Molecular and functional characterization of a secreted lipase from Botrytis cinerea. Mol Plant Pathol 2005;6:257e67. [11] Wubben JP, Mulder W, ten Have A, van Kan JAL, Visser J. Cloning and partial characterisation of endopolygalacturonase genes from Botrytis cinerea. Appl Environ Microbiol 1999;65:1596e602. [12] ten Have A, Mulder W, Visser J, van Kan JAL. The endopolygalacturonase gene Bcpg1 is required for full virulence of Botrytis cinerea. Mol Plant-Microbe Interact 1998;11:1009e16. [13] ten Have A, Breuil WO, Wubben JP, Visser J, van Kan JAL. Botrytis cinerea endopolygalacturonase genes are differentially expressed in various plant tissues. Fungal Genet Biol 2001;33:97e105. [14] Rha E, Park HJ, Kim MO, Chung YR, Lee CW, Kim JW. Expression of exopolygalacturonases in Botrytis cinerea. FEMS Microbiol Lett 2001;201:105e9. [15] Kars I, Krooshof GH, Wagemakers L, Joosten R, Benen JAE, van Kan JAL. Necrotizing activity of five Botrytis cinerea endopolygalacturonases produced in Pichia pastoris. Plant J 2005;43:213e25. [16] Valette-Collet O, Cimerman A, Reignault P, Levis C, Boccara M. Disruption of Botrytis cinerea pectin methylesterase gene Bcpme1 reduces virulence on several host plants. Mol Plant Microbe Interact 2003;16:360e7. [17] Brito N, Espino JJ, Gonzalez C. The endo-beta-1, 4-xylanase xyn11A is required for virulence in Botrytis cinerea. Mol Plant-Microbe Interact 2006;19:25e32. [18] Rebordinos L, Cantoral JM, Prieto MV, Hanson JR, Collado IG. The phytotoxic activity of some metabolites of Botrytis cinerea. Phytochemistry 1996; 42:293e307. [19] Reino JL, Hernández-Galán R, Durán-Patrón R, Collado IG. Virulenceetoxin production relationship in isolates of the plant pathogenic fungus Botrytis cinerea. J Phytopathol 2004;152:563e6. [20] Deighton N, Muckenschnabel I, Colmenares AJ, Collado IG, Williamson B. Botrydial is produced in plant tissues infected by Botrytis cinerea. Phytochemistry 2001;57:689e92. [21] Colmenares AJ, Aleu J, Duran-Patron R, Collado IG, Hernandez-Galan R. The putative role of botrydial and related metabolites in the infection mechanism of Botrytis cinerea. J Chem Ecol 2002;28:997e1005. [22] Pinedo C, Wang CM, Pradier JM, Dalmais B, Choquer M, Le Pêcheur P, et al. Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis cinerea. ACS Chem Biol 2008;3:791e801. [23] Rolke Y, Liu S, Quidde T, Williamson B, Schouten A, Weltring KM, et al. Functional analysis of H2O2-generating systems in Botrytis cinerea: the major CueZn-superoxide dismutase (BCSOD1) contributes to virulence on French bean, whereas a glucose oxidase (BCGOD1) is dispensable. Mol Plant Pathol 2004;5:17e27. [24] Ghabrial SA, Suzuki N. Viruses of plant pathogenic fungi. Annu Rev Phytopathol 2009;47:353e84. [25] Pearson MN, Beever RE, Boine B, Arthur K. Mycoviruses of filamentous fungi and their relevance to plant pathology. Mol Plant Pathol 2009;10:115e28. [26] Nuss DL. Hypovirulence: mycoviruses at the fungal-plant interface. Nat Rev Microbiol 2005;3:632e42. [27] Wu MD, Zhang L, Li GQ, Jiang DH, Hou MS, Huang HC. Hypovirulence and double-stranded RNA in Botrytis cinerea. Phytopathology 2007;97:1590e9. [28] Wu MD, Zhang L, Li GQ, Jiang DH, Ghabrial SA. Genome characterization of a debilitation-associated mitovirus infecting the phytopathogenic fungus Botrytis cinerea. Virology 2010;406:117e26. [29] Maxwell DP, Lumsden RD. OA production by Sclerotinia sclerotiorum in infected bean and in culture. Phytopathology 1970;60:1395e8. [30] Moyo S, Gashe BA, Collision EK, Mpuchane S. Optimizing growth for the pectinolytic activity of Kluyveromyces wickerhamii by using response surface methodology. Int J Food Microbiol 2003;85:87e100. [31] Godoy G, Steadman JR, Dickman MB, Dam R. Use of mutants to demonstrate the role of OA in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiol Mol Plant Pathol 1990;37:179e91.
80
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
[32] Ren L, Li GQ, Jiang D. Characterization of some culture factors affecting oxalate degradation by the mycoparasite Coniothyrium minitans. J Appl Microbiol 2010;108:173e80. [33] Rigling D, Heiniger U, Hohl HR. Reduction of laccase activity in dsRNA-containing hypovirulent strains of Cryphonectria parasitica. Phytopathology 1989;79:219e23. [34] Shin KS, Lee YJ. Purification and characterization of a new member of the laccase family from the white-rot basidiomycete Coriolus hirsutus. Arch Biochem Biophys 2000;384:109e15.
[35] Choquer M, Boccara M, Vidal-Cros A. A semi-quantitative RT-PCR method to readily compare expressionlevels within Botrytis cinerea multigenic families in vitro and in planta. Curr Genet 2003;43:303e9. [36] Nuss DL, Koltin Y. Significance of dsRNA genetic elements in plant pathogenic fungi. Annu Rev Phytopathol 1990;28:37e58. [37] Castro M, Kramer K, Valdivia L, Ortiz S, Castillo A. A double-stranded RNA mycovirus confers hypovirulence-associated traits to Botrytis cinerea. FEMS Microbiol Lett 2003;228:89e91.
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
Effect of Mitovirus infection on formation of infection cushions and virulence of Botrytis cinerea Lei Zhang a, Ming De Wu a, Guo Qing Li a, *, Dao Hong Jiang a, Hung Chang Huang b a b
The State Key Laboratory of Agricultural Microbiology and the Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan 430070, China Agriculture and Agri-Food Canada, Research Centre, Lethbridge, Alberta, Canada (Emeritus)
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 7 September 2010
This study was conducted to investigate mechanisms involved in hypovirulence of strain CanBc-1 of Botrytis cinerea. The hypovirulent strain CanBc-1 was compared with the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea for formation of infection cushions on onion bulbs and on leaves of oilseed rape and tomato, as well as for production of pectinase, toxic metabolites, oxalic acid and laccase in different growth media. Results showed that formation of infection cushions was common on epidermis of onion bulbs and on leaves of oilseed rape and tomato inoculated with strains CanBc-1c-66 or CanBc-2, but was rare on these plant tissues inoculated with strain CanBc-1. The three strains could produce pectinase, toxic metabolites, oxalic acid and laccase in pure cultures. Strain CanBc-1 produced less pectinase in 9-day-old cultures in pectin-containing liquid medium than strains CanBc-1c-66 and CanBc-2. The yield of oxalic acid (OA) produced by strain CanBc-1 in 15-day-old cultures in Maxwell liquid medium was lower than that produced by strain CanBc-2, but was higher than that produced by strain CanBc-1c-66. Strain CanBc-1 produced more laccase than strains CanBc-1c-66 and CanBc-2 in 8-day-old cultures in potato dextrose broth (PDB). Cultural filtrates of strains CanBc-1, CanBc-1c-66 and CanBc-2 from 21-dayold PDB cultures suppressed growth of roots and hypocotyls of barley, and the suppressive efficacy was not significantly different (P > 0.05) among the three investigated strains of B. cinerea. These results suggest that rare formation of infection cushions and attenuated mycelial growth are probably responsible for hypovirulence of strain CanBc-1 of B. cinerea infected by the mitovirus BcMV1. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Botrytis cinerea Hypovirulence Mitovirus BcMV1 Infection cushions
1. Introduction Botrytis cinerea Pers.: Fr. [teleomorph: Botryotinia fuckeliana (de Bary) Whetzel] is a cosmopolitan plant pathogenic fungus, causing gray mold disease on mature and senescent plant tissues [1]. It can infect more than 200 species of plants including bulb onions (Allium cepa L.), oilseed rape (Brassica napus L.) and tomato (Lycopersicon esculentum Mill.). The gray mold disease is important on these crops grown in the field or in the greenhouse, especially under cool and humid conditions. B. cinerea infects a plant through direct penetration of epidermis by infection hyphae formed on appressorium-like structures [2] or on infection cushions [2e5], or through wounds [1]. Appressorium-like structures of B. cinerea are usually developed at the tip of conidial germ tubes. They are oval-shaped, but are neither melanized nor septum-separated [2]. Infection cushions of B. cinerea developed at
* Corresponding author. Tel.: þ86 27 87286880. E-mail addresses: [email protected], [email protected] (G.Q. Li). 0885-5765/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2010.09.001
the hyphal tips are multi-cellular, claw-like, densely ramified, domeshaped and highly melanized [6]. As a necrotrophic plant pathogen, B. cinerea uses multiple chemical weapons to kill host cells in penetration of plant epidermis and colonization of plant tissues [7,8]. Previous reports showed that B. cinerea can produce numerous cell wall-degrading enzymes (CWDEs), including cutinase [9], lipase [10], exo- and endo-polygalacturonases [11e15], pectin methylesterases [16], cellulases and hemicellulases [17]. Some of these CWDEs have been found to be closely associated with virulence or aggressiveness of B. cinerea [1,8]. The infection process of B. cinerea also involves secretion of host-nonspecific toxic metabolites produced by the pathogen [18,19] such as botrydial [20e22] and oxalic acid [5], and accumulation of reactive oxygen species such as hydrogen peroxide in appressorium-like structures and in infection cushions of B. cinerea [6]. These chemicals can kill plant cells, thus facilitating infection and colonization of plant tissues by B. cinerea [7,23]. Mycoviruses or fungal viruses are obligate parasites of fungi. They are widespread in all major taxonomic groups of plant pathogenic fungi, and are transmitted vertically through fungal sporulation and
72
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
horizontally through hyphal anastomosis [24,25]. So far, seven families of mycoviruses, namely Chrysoviridae, Endornaviridae, Hypoviridae, Narnaviridae, Partitiviridae, Reoviridae and Totiviridae have been documented [24]. Some mycoviruses can be potentially used for control of fungal diseases, as they are capable of attenuating virulence or pathogenicity of fungal pathogens [26]. Meanwhile, understanding of the interaction between mycoviruses and their fungal hosts, and between plant hosts and mycovirus-infected fungal pathogens can help to unveil mechanisms involved in fungal pathogenesis [26]. A hypovirulent strain CanBc-1 of B. cinerea was isolated from oilseed rape in our previous study [27]. It is severely debilitated in pathogenicity (hypovirulent) on oilseed rape. Hypovirulence of strain CanBc-1 was found to be closely associated with the presence of a species of Mitovirus (family Narnaviridae), designated as B. cinerea debilitation-related RNA virus (BcDRV) [27]. Now, BcDRV was renamed as Botrytis cinerea mitovirus 1 (BcMV1) [28] according to the nomenclature rule of International Committee on Taxonomy of Viruses (ICTV). However, mechanisms responsible for hypovirulence of this mitovirus-infected strain of B. cinerea remain unknown. The objective of this study was to determine mechanisms involved in hypovirulence of strain CanBc-1, including observation of formation of infection cushions on host plants (onion, oilseed rape and tomato) and detection of production of extra-cellular enzymes and toxic metabolites in culture media. 2. Materials and methods 2.1. Fungal strains and culture media Three strains of B. cinerea, hypovirulent strain CanBc-1 and virulent strains CanBc-2 and CanBc-1c-66 were used in this study. In some experiments, another hypovirulent strain CanBc-1c-66a of B. cinerea was used. Strain CanBc-1c-66 was a single-conidium isolate from strain CanBc-1 and strain CanBc-1c-66a was a mycelial derivative of virulent strain CanBc-1c-66 trans-infected by BcDRV or BcMV1 [27]. Infection by BcMV1 was detected in strains CanBc-1 and CanBc-1c-66a, but was not detected in strains CanBc-1c-66 and CanBc-2 [27]. Culture media used in this study were potato dextrose agar (PDA), potato dextrose broth (PDB), Maxwell liquid medium (MLM) and modified Kebede’s liquid medium (MKLM). PDA and PDB were prepared using fresh potato, whereas MLM was prepared according to the description by Maxwell and Lumsden [29]. MKLM was prepared according to the description by Moyo et al. [30] and it was modified by addition of 1% (w/v) citrus pectin (Sigma Chemical Company, St Louis, MO, USA). All culture media were autoclaved at 121e125 C for 20 min. 2.2. Microscopic observation of infection cushions Formation of infection cushions by strains of CanBc-1, CanBc-1c66 and CanBc-2 of B. cinerea on onion, oilseed rape and tomato was investigated using light microscope (LM) and scanning electron microscope (SEM). For LM observation, mycelial agar plugs (MAP, 6 mm diam.) of strains CanBc-1, CanBc-1c-66 or CanBc-2 were removed from 3-day-old PDA cultures and placed face-down on the outer side of detached bulb scales of onion, 2 MAPs per bulb scale. Bulb scales of onion inoculated with PDA alone were used as control. The bulb scales of onion (inoculated with B. cinerea and the control) were placed on moistened paper towels in plastic trays, which were individually covered with transparent plastic films to maintain high humidity. After incubation at 20 C for 12 and 60 h, MAPs of strains CanBc-1, CanBc-1c-66 and CanBc-2 on the bulb scales of onion were removed and the epidermis beneath each MAP was carefully peeled
off using a razor blade, stained with methyl blue and examined for formation of infection cushions under a compound light microscope. Five microscopic fields at the 100 magnification were randomly chosen on each onion epidermal piece for counting the number of infection cushions formed by B. cinerea. A total of five onion epidermal pieces for each strain incubated at 12 or 60 h were examined. For SEM observation, MAPs of strains CanBc-1, CanBc-1c-66 or CanBc-2 were inoculated on true leaves of oilseed rape (B. napus cv. Zhongyou Za No. 4) or tomato (L. esculentum cv. Bing Hong No.2) detached from 40-day-old seedlings. The inoculated leaves were placed on moisturized paper towels in plastic trays, which were then individually covered with transparent plastic films and incubated at 20 C for 16 and 60 h. The leaf tissue from the inoculation spots was cut into small pieces (2 2 mm, length width), which were then immersed in 2.5% (w/v) glutaraldehyde solution in sodium phosphate buffer (0.05 M, pH 7.0) at 4 C for 24 h, washed three times in 0.05 M sodium phosphate buffer, 10 min each time, and dehydrated in a degraded ethanol series. After critical point drying (13200-AB, SPI SUPPLIES, PA, USA) and gold-coating in a sputter coater (JFC-1600, NTC, Japan), the leaf specimens were examined for infection cushions under a scanning electron microscope (JSM-6390/LV, NTC, Japan). To confirm the difference between hypovirulent strain CanBc-1 and virulent strains CanBc-1c-66/CanBc-2 of B. cinerea in formation of infection cushions on leaf surface, hyphae within leaf tissues of oilseed rape caused by infection cushion-mediated penetrations were retrieved by incubation of the surface-sterilized leaf tissues of oilseed rape on PDA. MAPs of each strain of B. cinerea were inoculated on leaves of oilseed rape using the procedures mentioned above. Leaves of oilseed rape inoculated with un-colonized PDA were used as control. After incubation at 20 C under high humidity for 24 h for strains CanBc-2 and CanBc-1c-66, and for 96 h for strain CanBc-1, leaf tissues of oilseed rape (4 4 mm) at the inoculation spots on leaves of oilseed rape were cut off using a pair of sterilized scissors, surfacesterilized in 5% (w/v) NaClO solution for 5 min, rinsed in sterile distilled water three times, 1 min each time, and placed on PDA in Petri dishes. The dishes were then incubated at 20 C for 10 days and the fungal colony formed around each leaf tissue was identified for B. cinerea on the basis of the colony morphology [27]. Sixteen isolates of B. cinerea from leaf tissues of oilseed rape inoculated with strains CanBc-1c-66 (five isolates), CanBc-2 (five isolates) and CanBc-1 (six isolates) were selected for testing the mycelial growth rate on PDA, pathogenicity on detached leaves of oilseed rape and the presence of the 3.0-kb dsRNA (BcMV1) in mycelia using the methods described by Wu et al. [27]. Strains CanBc-1, CanBc-1c-66 and CanBc-2 were used as controls in these tests. An additional experiment was done to test the possibility of infection of plant tissues by strain CanBc-1 of B. cinerea through wounds. A sharp dissecting needle was used to puncture two leaf areas beside the main vein of each oilseed rape leaf. Non-wounded leaves of oilseed rape were used as control. Five wounded leaves and five non-wounded leaves were placed in two rows (five leaves each row) on moisturized paper towels in an enamelware tray. MAPs of strain CanBc-1 were inoculated face down on wounded areas of each wounded leaf or on each non-wounded leaf at the same positions, two MAPs per leaf. The tray was covered with a transparent plastic film and incubated in a growth chamber (20 C) with the regime of 12-h light/12-h dark. Diameter of the leaf lesion developed around each MAP was measured after incubation for 72 h. The experiment was repeated one more time. 2.3. Pectinase activity assay Production of pectinase by strains CanBc-1, CanBc-1c-66a, CanBc-1c-66 and CanBc-2 of B. cinerea in media was determined
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80 Table 1 Oligonucleotide primers used for RT-PCR detection of gene expression in Botrytis cinerea. Target gene
Use Primer (50 / 30 )
Bcpg1a F R Bcpg2 F R Bcpg3 F R Bcpg4 F R Bcpg5 F R Bcpg6 F R Bclcc1 F R Bclcc2 F R BcactAb F R a b
AATATGGTTCAACTTCTCTCAATG TTAACACTTGACACCAGATGGG TTGACCCTGGCTACTCCT CAAACCCTTTCACCTGAT CTTGTGCCAATGCTTTCA TCAGGCTTGTCGGTTCCT TTCAAGGAGTGGGAAGGA CGATGAGGATACCGTATTTAG TCTGCCTGTCTCCTCTTG CGGGTGGGTTGTAGAAGTA GCGGTTCTGGAATCACTG GGTAGTTTCGGAATTTGAC TCTTCGGTCCTCTTGTTATT GTTGGGTCGGTCCAGTTTAG CTACTGCGGACTATGATGAAGATG GCGATATGGCAATGAAGAAGC TGTCTTTGAGACCTTCAACGC GGTGCAATGATCTTGACCTTC
Annealing Ref. DNA sequence Temp. ( C) (GenBank Acc. No.) 58
AY665552
52
U68716
52
U68717
54
U68719
56
U68721
55
U68722
56
AF243854
50
AF243855
55
AJ000335
The primers were modified from those of Kars et al. [15]. The primers referred to Choquer et al. [35].
both qualitatively and quantitatively. The qualitative determination was done in Petri dishes (9 cm diam.) containing 20 ml polygalacturonic acid (PGA) agarose medium [1% agarose (w/v), 0.1% PGA (w/v), pH 4.2]. MAPs (10 mm diam.) were removed from the colony margin of a 9-day-old PDA culture of B. cinerea and placed on PGA-containing medium in Petri dishes (9 cm diam.), four MAPs per dish. A filter paper disc (6 mm diam.) soaked in 20 ml of the
73
standard pectinase solution (125 U/ml) from Aspergillus niger (Sigma Chemical Company) was placed at the center of each dish. There were three dishes (replicates) for each strain of B. cinerea. After incubation at 45 C for 12 h, the MAPs and the filter paper disc were carefully removed from each dish, which was then flooded with ruthenium red solution (0.03%, w/v) for 2 h at 4 C. Strains of B. cinerea with pectinase activity were determined by the presence of clear zones on the PGA-containing medium [31]. The experiment was repeated three times. Pectinase activity in cultural filtrates of each strain of B. cinerea was determined quantitatively by the colorimetric method described by Moyo et al. [30]. MAPs of each strain were inoculated in 100 ml MKLM medium in 250-ml Erlenmeyer flasks, one plug per flask. The flasks were then placed on a shaker and incubated (150 rpm) at 20 C. Three flasks of cultures of each strain were taken out from the shaker after incubation for 3, 6, 9, 12 and 15 days. The cultural filtrates and mycelia in each flask were separated using a piece of pre-weighed filter paper (90 mm diam). The mycelial mats were dried at 60 C for 48 h and weighed to estimate dry mycelial biomass. The cultural filtrate was assayed for pectinase activity using the procedure described by Moyo et al. [30]. One unit (U) of the enzymatic activity was defined as the amount of the enzyme required for catalysis of citrus pectin to produce 1 mmol galacturonic acid. The yield of pectinase was expressed as U/ml cultural filtrate. The experiment was repeated three times. 2.4. Bioassay of toxic metabolites Strains CanBc-1, CanBc-1c-66 and CanBc-2 of B. cinerea were inoculated in PDB in 250-ml Erlenmeyer flasks, 100 ml/flask and
Fig. 1. Comparison of formation of infection cushions by strains CanBc-2 (A, 12 hpi), CanBc-1c-66 (B, 12 hpi) and CanBc-1 (C, 60 hpi) of Botrytis cinerea on epidermis of onion bulbs. The inoculated tissues of onion bulbs inoculated with B. cinerea were stained with methyl blue. Note formation of infection cushions (ic) and infectious hyphae (ih) by strains CanBc2 and CanBc-1c-66, but no formation of infection cushions on growing hyphae (h) by strain CanBc-1. Number of infection cushions (5 microscopic fields under 100) was presented in graph D.
74
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
three flasks for each strain. After incubation at 20 C in the dark for 21 days, the culture of B. cinerea in each flask was filtered to collect the cultural filtrate. To test the toxicity of the cultural filtrates of B. cinerea, barley seeds (Hordeum vulgare L. cv. Zheng 98) were soaked in the culture filtrates of each strain or in water (CK) for 8 h at 20 C, placed on moistened filter papers in Petri dishes, 20 seeds per dish and 3 dishes per treatment. After incubation at 20 C under 12-h light/l2-h dark for 72 h, germinated seeds in each dish were measured for length of the roots and the hypocotyl formed on each barley seed to compare the difference in growth of barley roots ad hypocotyls among treatments. The test was repeated three times.
2.5. Assay of oxalic acid Strains CanBc-1, CanBc-1c-66 and CanBC-2 of B. cinerea were inoculated in 50 ml MLM medium in 250-ml Erlenmeyer flasks,
which were incubated on the shaker (150 rpm) at 20 C. Three flasks of cultures of each strain were retrieved from the shaker after incubation for 3, 6, 9, 12 and 15 days for measuring mycelial dry weight (60 C, 48 h), pH value of the cultural filtrates using a pH meter and the concentration of oxalic acid (OA) in the cultural filtrates using high performance liquid chromatography [32]. The OA yield in each flask of culture was expressed as mg OA/g dry mycelia. The assay was repeated three times.
2.6. Assay of laccase activity Production of laccase by strains CanBc-1, CanBc-1c-66a, CanBc1c-66 and CanBc-2 of B. cinerea was determined both qualitatively and quantitatively. Qualitative determination of the laccase activity was done in Petri dishes. For each strain of B. cinerea, MAPs (10 mm diam.) were removed from the colony margin of an 8-day-old PDA
Fig. 2. Scanning electron micrographs showing difference in formation of infection cushions by strains CanBc-2 (A and B), CanBc-1c-66 (C and D) and CanBc-1 (E and F) of Botrytis cinerea on leaves of oilseed rape. Note the formation of infection cushions by strains CanBc-2 and CanBc-1c-66 at 16 hpi, but no formation of infection cushions by strain CanBc-1 (E, F) at 60 hpi. ic ¼ infection cushion, ec ¼ epidermal cells, h ¼ hyphae.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
75
culture and inoculated on PDA amended with 0.05% (w/v) tannic acid (Sigma Chemical Company) in Petri dishes, four MAPs per dish. After incubation at 37 C for 24 h, the laccase activity of each strain was examined by checking the browning zone surrounding each MAP [33]. Quantitative determination of the laccase activity was done using the method described by Shin and Lee [34]. Strains CanBc-1, CanBc-1c-66, CanBc-1c-66a and CanBc-2 of B. cinerea were separately cultured in PDB on a shaker (15 rpm) at 20 C for 8 days. Each culture of B. cinerea in a flask was filtered through a filter paper to separate mycelial biomass and cultural filtrate. The mycelial biomass was treated at 60 C for 48 h for measuring dry weight. The cultural filtrate was treated as the crude laccase. The laccase activity in the cultural filtrate was measured by determining oxidation of ABTS [2,20 -azino-bis-(3- ethylbenzo- thiazoline-6-sulfonate)]. An aliquot of 2 ml of each cultural filtrate was mixed with 1 ml ABTS (1 mM) and the mixture was incubated at 25 C to produce cation radicals, which were then monitored in a spectrophotometer (BioPhotometer Plus 6132, Eppendorf, Germany) at 420 nm (3max ¼ 3.6 104/cm/M). One laccase unit (U) was defined as the amount of enzyme required to oxidize 1 mmol of ABTS per minute [34]. The laccase yield produced by each strain of B. cinerea in each culture was expressed as units of laccase per liter of cultural filtrate (U/l). The experiment was repeated three times.
then incubated at 20 C for 60 h. Mycelial mats of each strain were harvested from each dish for RNA extraction. Total RNA was extracted from mycelia of each strain of B. cinerea using TRIzolÒ reagent (InvitrogenÔ, USA) following the manufacturer’s instructions. The RNA extracts were treated with RQ1 RNase-free DNase (Promega, WI, USA) to digest contaminated DNA in the RNA mixtures. The quality of the RNA extract was evaluated for the integrity and the size distribution by agarose gel electrophoresis [35], and the RNA concentration was determined in a spectrophotometer by measuring the absorbance value of each RNA solution at 260 nm. A sample of 1 mg of the DNase-treated RNA solution from each strain of B. cinerea was reverse transcribed using PrimescriptÔ 1stStrand cDNA Synthesis Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) following the manufacturer’s instructions. The reverse transcription product (1 ml) was then used as template in PCR for detecting the expression of each gene (Bcpg1-6, Bclcc1, Bclcc2, BcactA) in S1000Ô Thermal Cycler (Bio-Rad Laboratories, Inc., CA, USA) with primer pairs listed in Table 1. The PCR program was set as: 94 C for 5 min (1 cycle); followed by 94 C for 30 s, 50e58 C for 30 s and 72 C for 60 s (30 cycles); finally 72 C for 10 min (1 cycle). The PCR product (7 ml) of each gene was loaded on agarose gel (1%, w/v) for electrophoresis. The gel was stained with ethidium bromide solution (1.5 mg/l) after electrophoresis and viewed on an UV trans-illuminator to show the DNA band for each target gene.
2.7. RT-PCR
2.8. Data analysis
Reverse transcription (RT) PCR was used to detect expression of genes coding for endo-polygalacturonases 1 to 6 (Bcpg1-6) and laccases 1 and 2 (Bclcc1 and Bclcc2) in strains CanBc-1, CanBc-1c66a, CanBc-1c-66 and CanBc-2 of B. cinerea. Detection of the expression of BcactA coding for actin in each strain of B. cinerea was used as control. To detect the expression of Bcpg1-6, MAPs of each strain were inoculated on sterilized cellophane membranes placed on PDA in 20 dishes, four MAPs per dish. The dishes were incubated at 20 C in the dark for 60 h. Mycelial mass of each strain harvested from 4 to 10 dishes was transferred to an Erlenmeyer flask (250 ml) containing 50 ml MLKM medium. The flask was incubated on a shaker (80 rpm) at 20 C for 24 h to induce the expression of Bcpg1-6. Mycelial mats in the flask were harvested, blot-dried on filter papers and stored at 80 C until use for RNA extraction. To detect the expression of Bclcc1 and Bclcc2, strains CanBc-1, CanBc1c-66a, CanBc-1c-66 or CanBc-2 were inoculated on sterilized cellophane membranes placed on PDA in Petri dishes, which were
Analysis of variance (ANOVA) in SAS software (SAS Institute, Cary, NC, USA, Version 8.0, 1999) was used to analyze data on the mycelial growth rate, the lesion diameter, the yield of pectinase and laccase, and on the percentage of the inhibition of growth of barley roots and barley hypocotyls by cultural filtrates of B. cinerea. Data of the same treatment, but collected from different repeats of the same experiment, were pooled when they were not significantly different (P > 0.05) in the F-test of ANOVA. Means of each parameter for different strains of B. cinerea were compared using Least Significant Difference Test at P ¼ 0.05 level. 3. Results 3.1. Formation of infection-cushions Numerous infection cushions were formed by strains CanBc-2 and CanBc-1c-66 of B. cinerea on epidermis of onion bulbs (Fig. 1A, B) after
Fig. 3. Pathogenicity of strains CanBc-2 (A), CanBc-1c-66 (B) and CanBc-1 (C) of Botrytis cinerea on leaves of oilseed rape (20 C, 72 h). Note formation of necrotic lesions by strains CanBc-2 and CanBc-1c-66. Note also profuse mycelial growth, but no formation of visible necrotic lesions by strain CanBc-1.
76
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
Table 2 Radial growth rate, lesion diameter and double-stranded (ds) RNA in different strains/isolates of Botrytis cinerea. Strain/isolate
Radial growth rate (mm/day)a
Lesion diameter (mm)b
dsRNAc
CanBc-1 CanBc-1L1 CanBc-1L2 CanBc-1L3 CanBc-1L4 CanBc-1L5 CanBc-1L6 CanBc-1c-66 CanBc-1c-66L1 CanBc-1c-66L2 CanBc-1c-66L3 CanBc-1c-66L4 CanBc-1c-66L5 CanBc-2 CanBc-2L1 CanBc-2L2 CanBc-2L3 CanBc-2L4 CanBc-2L5 LSD0.05 (df2)e
4.5 id 14.3abc 14.4 ab 13.9 abcd 12.5 fg 10.2 h 11.9 g 12.8 efg 13.7 bcde 13.4 cdef 13.9 abcd 13.0 def 12.9 efg 14.8 a 13.6 bcde 13.9 abcd 14.3 abc 13.4 cdef 13.1 def 0.98 (76)
0h 17.4 f 17.8 ef 17.4 f 14.8 g 12.8 g 14.4 g 18.1 ef 18.4 cdef 18.4 cdef 18.2 def 18.0 ef 18.6 bcdef 20.4 abcd 20.6 abc 20.8 ab 21.2 a 19.8 abcde 20.8 ab 2.2 (171)
þ
a Radial growth rate of each strain was measured daily on cultures grown on PDA at 20 C in dark. b Lesion diameter of each strain on leaves of oilseed rape was measured after inoculation for 72 h. c “þ” ¼ presence of dsRNA in the strain; “” ¼ absence of dsRNA in the strain. d Means followed by the same letter in each column are not significantly different (P > 0.05) by radial growth rate and pathogenicity test. e df ¼ degree of freedom.
incubation for 12 h, and on leaves of oilseed rape (Fig. 2AeD) and tomato (Supplementary Fig. S1) after incubation for 16 h. Formation of infectious hyphae was frequently observed on infection cushions (Fig. 1A, B). The average number of infection cushions within five microscopic fields (100) on each epidermal piece of onion bulb was 152 and 166 for strains CanBc-1c-66 and CanBc-2, respectively (Fig. 1D). After incubation for 72 h, tissues of onion bulbs (data not shown) and leaves of oilseed rape (Fig. 3A, B) and tomato (data not shown) at and around the pathogen inoculation sites became collapsed and disintegrated with the formation of necrotic lesions. In contrast, formation of infection cushions by strain CanBc-1 of B. cinerea was rarely observed on epidermis of onion bulbs (Fig. 1C), and on leaves of oilseed rape (Fig. 2E, F) and tomato (Supplementary Fig. S1) after incubation even for 60 h. The average number of infection cushions within five microscopic fields (100) was 6 on each epidermal piece of onion bulb (Fig. 1D). Tissues of onion bulbs
(data not shown) and oilseed rape (Fig. 3C) in direct contact with the mycelial inoculum of strain CanBc-1 remained healthy without formation of visible necrotic lesions after incubation for 72 h, even on wounded leaf tissues of oilseed rape (Supplementary Table S1). The isolation frequency of B. cinerea was 2.9% from the leaf tissues of oilseed rape inoculated with strain CanBc-1 after incubation for 96 h. In contrast, the isolation frequency was 90.9 and 92.5% for the inoculation treatments of strains CanBc-2 and CanBc-1c-66, respectively, after incubation for 24 h. Six isolates of B. cinerea from the inoculation treatment of strain CanBc-1 (isolates CanBc-1L1 to CanBc-1L6) grew at 11.9e14.4 mm/d on PDA, significantly higher than that of strain CanBc-1 (4.5 mm/d) (Table 2). All of these isolates were virulent on leaves of oilseed rape with the average lesion diameter ranging from 12.8 to 17.8 mm, significantly larger than that of strain CanBc-1, which caused no infection on leaves of oilseed rape (Table 2). The 3.0-kb dsRNA of BcMV1 was detected in strain CanBc-1, but was not detected in all the virulent isolates from the inoculation treatment with strain CanBc-1 (Table 2). Five isolates of B. cinerea from the inoculation treatment of strain CanBc-2 (isolates CanBc-2L1 to CanBc-2L5) and five isolates from the inoculation treatment of strain CanBc-1c-66 (CanBc-1c66L1 to CanBc-1c-66L5) grew rapidly on PDA with the radial growth rates ranging from 12.9 to 14.3 mm/d. All these isolates of B. cinerea were similar to strain CanBc-1c-66 and CanBc-2 in pathogenicity on leaves of oilseed rape with the average lesion diameters ranging from 18.0 to 21.2 mm (Table 2). The 3.0-kb dsRNA of BcMV1 was not detected in strains CanBc-2 and CanBc-1c-66, and in all these virulent isolates from the inoculation treatments of these two strains. 3.2. Pectinase production Results of the qualitative determination showed that on the PGA-containing medium, clear zones were produced by strains CanBc-1 (hypovirulent), CanBc-1c-66a (hypovirulent), CanBc-1c-66 (virulent), CanBc-2 (virulent) and by the standard pectinase from A. niger (Fig. 4A). This result indicates that these strains of B. cinerea can secrete pectinase. Production of pectinase by these strains of B. cinerea was confirmed by the quantitative assay of 3- to 15-dayold cultures in MKLM medium and by RT-PCR. The yield of pectinase of the 3- to 9-day-old cultural filtrates of strain CanBc-2 (0.6 to 1.3 U/ml) was significantly higher (P < 0.05) than the yield of pectinase produced by strains CanBc-1 (0.4 to 1.0 U/ml), CanBc-1c66 (0.5 to 1.0 U/ml) and CanBc-1c-66a (0.4 to 1.0 U/ml). After incubation for 12 and 15 days, the pectinase activity in the cultural filtrates of all these strains of B. cinerea decreased to 0.5e0.6 U/ml
Fig. 4. Qualitative (A) and quantitative (B) determination of pectinase produced by hypovirulent strains of Botrytis cinerea. In Fig. 2A, pectinase (2.5 U) produced by Aspergillus niger was used as standard (CK). Clear zones at the inoculation sites in the Petri dish indicate the pectinase activity. In Fig. 2B, means labeled with same letter at each sampling date are not significantly different (P > 0.05) according to Least Significant Difference Test.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
77
3.4. Production of oxalic acid Dry mycelial biomass from 15-day-old cultures of strain CanBc-1 in MLM was significantly lower (P < 0.05) than that of strains CanBc-1c-66 or CanBc-2 (Fig. 7). Ambient pH was decreased from the initial (day 0) of 6.6 to the final (day 15) of 5.5, 5.6 and 4.2for strains CanBc-1, CanBc-1c-66 and CanBc-2, respectively. The amount of oxalic acid (OA) produced by the strain CanBc-2 was 161 mg OA/g dry mycelia. This yield was significantly higher (P < 0.05) than that for strains CanBc-1 (127 mg/g dry mycelia) and CanBc-1c-66 (47 mg/g dry mycelia) (Fig. 7). 3.5. Production of laccase
Fig. 5. RT-PCR detection of expression of endopolygalacturonase genes (Bcpg1-6) in the hypovirulent strains CanBc-1 and CanBc-1c-66a, and the virulent strains CanBc-2 and CanBc-1c-66 of Botrytis cinerea. Detection of the expression the actin A gene (BcactA) in each strain was used as control. HV ¼ hypovirulent, V ¼ virulent.
with a slight difference among these strains (Fig. 4B). In the RT-PCR assay, expression of the six endo-polygalacturonase genes (Bcpg1-6) was positively detected in mycelia of all investigated strains of B. cinerea (Fig. 5).
Both the hypovirulent strains (CanBc-1 and CanBc-1c-66a) of B. cinerea and the virulent strains (CanBc-1c-66 and CanBc-2) of B. cinerea were detected to be able to produce laccase, as indicated by the brown color around the inoculum of each strain on the tannic acid-containing medium (Fig. 8A). The brown color caused by the hypovirulent strains was darker than the brown color caused by the virulent strains. Production of laccase by these strains of B. cinerea was confirmed by the quantitative assay and by RT-PCR. The laccase yield produced by strains CanBc-1 and CanBc-1c-66a was 11.5 and 14.4 U per liter of cultural filtrate (U/l), respectively. These values were significantly (P < 0.05) higher than those for strains CanBc-2 (7.5 U/l) and CanBc-1c-66 (8.1 U/l) (Fig. 8B). In the RT-PCR assay, expression of two genes coding for laccases (Bclcc1 and Bclcc2) was detected in the four investigated strains of B. cinerea (Fig. 8B).
3.3. Production of toxic metabolites 4. Discussion Compared to the water (CK) treatment, cultural filtrates of B. cinerea (strains CanBc-1 CanBc-1c-66, CanBc-2) suppressed growth of barley hypocotyl and barley roots by 61e69% and 90e93%, respectively (Fig. 6A). No significant differences (P > 0.05) among the three investigated strains of B. cinerea in suppressive efficacy were detected (Fig. 6B).
Mycovirus-associated fungal hypovirulence has been found to be widespread in all taxonomic groups of plant pathogenic fungi [24,25]. Several abnormal traits including suppression of mycelial growth, formation of abnormal colony sectors and reduction of sporulation, as well as suppression of production of phytotoxins,
Fig. 6. Toxicity of metabolites of the hypovirulent strain CanBc-1, and the virulent strains CanBc-2 and CanBc-1c-66 of Botrytis cinerea on roots and hypocotyls of barley. Note no significant difference (P > 0.05) in suppression of growth of roots (n ¼ 9) and hypocotyls (n ¼ 9) by cultural filtrates of the three investigated strains of B. cinerea according to Least Significant Difference Test.
78
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
Fig. 7. Time-course of dry mycelial biomass (A), ambient pH (B) and yield of oxalic acid (C) produced by hypovirulent strain CanBc-1, and by virulent strains CanBc-2 and CanBc-1c-66, of Botrytis cinerea in Maxwell liquid medium. Vertical bars represent standard errors of means (n ¼ 9).
pigments and laccases are reported to be closely associated with hypovirulence of fungi infected by various mycoviruses [24,25,36]. Wu et al. (2007) reported that the hypovirulent strain CanBc-1 of B. cinerea has a few abnormal traits associated with hypovirulence, including suppression of mycelial growth, formation of abnormal colony sectors, and reduction of conidial production and sclerotial formation [27]. Wu et al. (2010) also reported that hypovirulence of strain CanBc-1 of B. cinerea was closely associated with the presence of a species of Mitovirus BcMV1 [28]. This study reveals that infection cushions were frequently formed on host tissues (onion, oilseed rape and tomato) by the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea, but were rarely formed by the hypovirulent strain CanBc-1 of B. cinerea. Therefore, rare formation of infection cushions by strain CanBc-1 of B. cinerea on plant tissues appears closely associated with hypovirulence of strain CanBc-1 of B. cinerea infected by the mitovirus BcMV1. This association suggests the importance of formation of infection cushions in pathogenesis of B. cinerea. However, strain CanBc-1 of B. cinerea failed to infect wounded leaves of oilseed rape according to the present study. It implies that strain CanBc-1 is unable to colonize leaf tissues of oilseed rape. It becomes less aggressive than virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea, although it is similar to these two virulent strains in production of pectinase and toxic metabolites. The loss in aggressiveness in strain CanBc-1 of B. cinerea might be closely associated with, or caused by, suppressed mycelial growth [27]. Wu et al. (2010) reported that BcMV1 can directly attack mitochondria within hyphal cells of B. cinerea, resulting in malformation of mitochondria (swelling and cristae degeneration), thereby attenuating mitochondrial function and at last suppressing mycelial growth of B. cinerea [27]. Taking all the information together, a preliminary conclusion can be made that rare formation of infection cushions and/or suppression of mycelial growth might be responsible for hypovirulence of strain CanBc-1 of B. cinerea. Additional studies by comparing the gene expression profile in strains CanBc-1 and CanBc-1c-66 are necessary for mining molecular mechanisms involved in hypovirulence of strain CanBc-1 of B. cinerea. The information will help to understand pathogenesis mechanisms of B. cinerea at the molecular level. Production of phytotoxins including oxalic acid (OA) by B. cinerea has been proposed to be able to facilitate plant cell death, thus
Fig. 8. A: Qualitative assay of activity of laccase produced by the hypovirulent (HV) strains CanBc-1 and CanBc-1c-66a, and the virulent (V) strains CanBc-1c-66 and CanBc-2 of Botrytis cinerea on a tannic acid-containing medium. The brown color around the inoculum plug of each strain indicates the laccase activity; B: Quantitative determination of the activity of laccase produced in potato dextrose broth and RT-PCR detection of expression of laccase genes (Bclcc1 and Bclcc2) in B. cinerea. In the histogram, results are expressed as means standard errors (n ¼ 9). Bars labeled with different letters indicate significant difference (P < 0.05) according to Least Significant Difference Test. dsRNAþ ¼ dsRNA positive, dsRNA ¼ dsRNA negative.
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
promoting B. cinerea to penetrate and to colonize plant tissues [7,8]. Kunz et al. (2006) reported that the oxalate-deficient mutant A336 of B. cinerea is non-pathogenic on intact and wounded plant tissues, although it is able to penetrate plant tissues [5]. This result suggests that OA is an important factor for pathogenesis of B. cinerea. Contrary to the mutant A336, strain CanBc-1 of B. cinerea investigated in this study was detected to be able to produce OA with the yield of OA higher than that for the virulent strain CanBc-1c-66 of B. cinerea. Therefore, hypovirulence of strain CanBc-1 of B. cinerea might not be caused by OA production. This result does not mean that OA production is not important in pathogenesis of B. cinerea, as the mechanisms involved in non-pathogenicity of the mutant A336 and in hypovirulence of strain CanBc-1 might be different. The mutant A336 was generated by insertional mutagenesis [5]. Deficiency in OA production by this mutant might be caused by mutation of some nuclear genes associated with OA biosynthesis. In contrast, strain CanBc-1 of B. cinerea is infected by a species of Mitovirus (BcMV1) [27,28]. Nuclear genes associated with OA biosynthesis in strain CanBc-1 may not be changed, compared to virulent strains of B. cinerea. Further studies to disclose the relationship between OA production and other pathogenesis-related elements in B. cinerea are warranted. This study indicates that the BcMV1-infected hypovirulent strains CanBc-1 and CanBc-1c-66a of B. cinerea produced more laccase than the BcMV1-free virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea. In contrast, Castro et al. (2003) reported that production of laccase by the hypovirulent strain CCg425 of B. cinerea infected with a 6.8-kb dsRNA mycovirus was significantly lower than the laccase produced by the mycovirus-free virulent strain CKg54 of B. cinerea [37]. Whether different mycoviruses in B. cinerea are the cause for the difference in production of laccase between this study and the report by Castro et al. [37] remains unknown and warrants further investigations. Nevertheless, higher laccase production by the hypovirulent strains CanBc-1 and CanBc1c-66a of B. cinerea than the virulent strains CanBc-1c-66 and CanBc-2 of B. cinerea in this study suggests that production of laccase may be unimportant for virulence of this pathogen. The absence of the 3.0-kb dsRNA (BcMV1) in the six virulent isolates of B. cinerea derived from leaves of oilseed rape inoculated with the hypovirulent strain CanBc-1 suggests that BcMV1 in the parental hypovirulent strain CanBc-1 may have been eliminated during its infection of leaf tissues of oilseed rape. Uneven distribution of BcMV1 in cytoplasm of hyphal cells of B. cinerea [27,28] may be the reason responsible for elimination of BcMV1 in some hyphal cells. Wu et al. (2007) reported that BcMV1 in the hypovirulent strain CanBc-1 of B. cinerea can be eliminated through the asexual reproduction (conidia) process [27]. Results about the virulence recovery and BcMV1 elimination in isolates of B. cinerea from leaves of oilseed rape inoculated with strain CanBc-1 suggests that plant inoculation and fungal retrieval from plant tissues might be another approach to eliminate BcMV1 from B. cinerea.
Acknowledgements This research was funded by the Natural Science Foundation of China (Grant Nos. 30570079, 31070122). The authors would like to thank Mr. J. B. Cao at the Huazhong Agricultural University,Wuhan, China for technical assistance on scanning electron microscopy.
Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.pmpp.2010.09.001.
79
References [1] Williamson B, Tudzynski B, Tudzynski P, van Kan JAL. Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 2007;8:561e80. [2] Garcia-Arenal F, Sagasta EM. Scanning electron microscopy of Botrytis cinerea penetration of bean (Phaseolus vulgaris) hypocotyls. Phytopathol Z 1980; 99:37e42. [3] Sharman S, Heale JB. Penetration of carrot roots by the grey mould fungus Botrytis cinerea Pers. ex Pers. Physiol Plant Pathol 1977;10:63e71. [4] Backhouse D, Willets HJ. Development and structure of infection cushions of Botrytis cinerea. Trans Br Mycol Soc 1987;89:89e95. [5] Kunz C, Vandelle E, Rolland S, Poinssot B, Bruel C, Cimerman A, et al. Characterization of a new, nonpathogenic mutant of Botrytis cinerea with impaired plant colonization capacity. N Phytol 2006;170:537e50. [6] Choquer M, Fournier E, Kunz C, Levis C, Pradier JM, Simon A, et al. Botrytis cinerea virulence factors: new insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol Lett 2007;277:1e10. [7] Govrin EM, Levine A. The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Curr Biol 2000;10:751e7. [8] van Kan JAL. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends Plant Sci 2006;11:247e53. [9] van Kan JAL, van’t Klooster JW, Wagemakers CA, Dees DC, van der VlugtBergmans CJ. Cutinase A of Botrytis cinerea is expressed, but not essential, during penetration of gerbera and tomato. Mol Plant Microbe Interact 1997;10:30e8. [10] Reis H, Pfiffi S, Hahn M. Molecular and functional characterization of a secreted lipase from Botrytis cinerea. Mol Plant Pathol 2005;6:257e67. [11] Wubben JP, Mulder W, ten Have A, van Kan JAL, Visser J. Cloning and partial characterisation of endopolygalacturonase genes from Botrytis cinerea. Appl Environ Microbiol 1999;65:1596e602. [12] ten Have A, Mulder W, Visser J, van Kan JAL. The endopolygalacturonase gene Bcpg1 is required for full virulence of Botrytis cinerea. Mol Plant-Microbe Interact 1998;11:1009e16. [13] ten Have A, Breuil WO, Wubben JP, Visser J, van Kan JAL. Botrytis cinerea endopolygalacturonase genes are differentially expressed in various plant tissues. Fungal Genet Biol 2001;33:97e105. [14] Rha E, Park HJ, Kim MO, Chung YR, Lee CW, Kim JW. Expression of exopolygalacturonases in Botrytis cinerea. FEMS Microbiol Lett 2001;201:105e9. [15] Kars I, Krooshof GH, Wagemakers L, Joosten R, Benen JAE, van Kan JAL. Necrotizing activity of five Botrytis cinerea endopolygalacturonases produced in Pichia pastoris. Plant J 2005;43:213e25. [16] Valette-Collet O, Cimerman A, Reignault P, Levis C, Boccara M. Disruption of Botrytis cinerea pectin methylesterase gene Bcpme1 reduces virulence on several host plants. Mol Plant Microbe Interact 2003;16:360e7. [17] Brito N, Espino JJ, Gonzalez C. The endo-beta-1, 4-xylanase xyn11A is required for virulence in Botrytis cinerea. Mol Plant-Microbe Interact 2006;19:25e32. [18] Rebordinos L, Cantoral JM, Prieto MV, Hanson JR, Collado IG. The phytotoxic activity of some metabolites of Botrytis cinerea. Phytochemistry 1996; 42:293e307. [19] Reino JL, Hernández-Galán R, Durán-Patrón R, Collado IG. Virulenceetoxin production relationship in isolates of the plant pathogenic fungus Botrytis cinerea. J Phytopathol 2004;152:563e6. [20] Deighton N, Muckenschnabel I, Colmenares AJ, Collado IG, Williamson B. Botrydial is produced in plant tissues infected by Botrytis cinerea. Phytochemistry 2001;57:689e92. [21] Colmenares AJ, Aleu J, Duran-Patron R, Collado IG, Hernandez-Galan R. The putative role of botrydial and related metabolites in the infection mechanism of Botrytis cinerea. J Chem Ecol 2002;28:997e1005. [22] Pinedo C, Wang CM, Pradier JM, Dalmais B, Choquer M, Le Pêcheur P, et al. Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis cinerea. ACS Chem Biol 2008;3:791e801. [23] Rolke Y, Liu S, Quidde T, Williamson B, Schouten A, Weltring KM, et al. Functional analysis of H2O2-generating systems in Botrytis cinerea: the major CueZn-superoxide dismutase (BCSOD1) contributes to virulence on French bean, whereas a glucose oxidase (BCGOD1) is dispensable. Mol Plant Pathol 2004;5:17e27. [24] Ghabrial SA, Suzuki N. Viruses of plant pathogenic fungi. Annu Rev Phytopathol 2009;47:353e84. [25] Pearson MN, Beever RE, Boine B, Arthur K. Mycoviruses of filamentous fungi and their relevance to plant pathology. Mol Plant Pathol 2009;10:115e28. [26] Nuss DL. Hypovirulence: mycoviruses at the fungal-plant interface. Nat Rev Microbiol 2005;3:632e42. [27] Wu MD, Zhang L, Li GQ, Jiang DH, Hou MS, Huang HC. Hypovirulence and double-stranded RNA in Botrytis cinerea. Phytopathology 2007;97:1590e9. [28] Wu MD, Zhang L, Li GQ, Jiang DH, Ghabrial SA. Genome characterization of a debilitation-associated mitovirus infecting the phytopathogenic fungus Botrytis cinerea. Virology 2010;406:117e26. [29] Maxwell DP, Lumsden RD. OA production by Sclerotinia sclerotiorum in infected bean and in culture. Phytopathology 1970;60:1395e8. [30] Moyo S, Gashe BA, Collision EK, Mpuchane S. Optimizing growth for the pectinolytic activity of Kluyveromyces wickerhamii by using response surface methodology. Int J Food Microbiol 2003;85:87e100. [31] Godoy G, Steadman JR, Dickman MB, Dam R. Use of mutants to demonstrate the role of OA in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiol Mol Plant Pathol 1990;37:179e91.
80
L. Zhang et al. / Physiological and Molecular Plant Pathology 75 (2010) 71e80
[32] Ren L, Li GQ, Jiang D. Characterization of some culture factors affecting oxalate degradation by the mycoparasite Coniothyrium minitans. J Appl Microbiol 2010;108:173e80. [33] Rigling D, Heiniger U, Hohl HR. Reduction of laccase activity in dsRNA-containing hypovirulent strains of Cryphonectria parasitica. Phytopathology 1989;79:219e23. [34] Shin KS, Lee YJ. Purification and characterization of a new member of the laccase family from the white-rot basidiomycete Coriolus hirsutus. Arch Biochem Biophys 2000;384:109e15.
[35] Choquer M, Boccara M, Vidal-Cros A. A semi-quantitative RT-PCR method to readily compare expressionlevels within Botrytis cinerea multigenic families in vitro and in planta. Curr Genet 2003;43:303e9. [36] Nuss DL, Koltin Y. Significance of dsRNA genetic elements in plant pathogenic fungi. Annu Rev Phytopathol 1990;28:37e58. [37] Castro M, Kramer K, Valdivia L, Ortiz S, Castillo A. A double-stranded RNA mycovirus confers hypovirulence-associated traits to Botrytis cinerea. FEMS Microbiol Lett 2003;228:89e91.