- Email: [email protected]
Effect of orphanin FQ on interleukin-1β mRNA transcripts in the rat CNS
PII: S 0 3 0 6 - 4 5 2 2 ( 0 2 ) 0 0 2 3 3 - 6
Neuroscience Vol. 114, No. 4, pp. 1019^1031, 2002 B 2002 IBRO. Published by Elsevier Science Ltd All rights reserved. Printed in Great Britain 0306-4522 / 02 $22.00+0.00
www.neuroscience-ibro.com
EFFECT OF ORPHANIN FQ ON INTERLEUKIN-1L MRNA TRANSCRIPTS IN THE RAT CNS H. ZHAO,a H.-W. HUANG,b G.-C. WUa and X.-D. CAOa a
National Key Laboratory of Medical Neurobiology, Department of Neurobiology, Shanghai Medical College of Fudan University, Shanghai 200032, PR China b
Department of Hand Surgery, Huashan Hospital a⁄liated Fudan University, Shanghai 200032, PR China
Abstract3To elucidate the mechanism of orphanin FQ on neuroimmune modulation, the relationship between orphanin FQ and interleukin-1L in the rat CNS in vivo and in vitro was investigated. In our experiments, it was found that orphanin FQ and interleukin-1L mRNA transcripts showed a similar distribution in cerebral cortex, hippocampus and hypothalamus. By using the in situ hybridization technique, down-regulation of interleukin-1L mRNA transcripts by central administration of orphanin FQ was further identi¢ed in the traumatic animal model. Similar inhibitory e¡ects were also observed on the number of microglia in the CNS. The e¡ects produced by orphanin FQ were abolished by combination with its receptor (OP4 )-speci¢c antagonist [Phe1 8(CH2 -NH)Gly2 ]nociceptin-(1^13)-NH2 , which suggested that the function of orphanin FQ might be attributable to the OP4 pathway. However, the e¡ect on the number of astrocytes in the CNS remained unchanged, despite evidence that OP4 is expressed on astrocytes as well as on neurons and microglia. When analyzed by reverse transcription-polymerase chain reaction, interleukin-1L gene expression was observed to be enhanced and inhibited in primary neuron and microglial cell cultures exposed to orphanin FQ respectively. Interleukin-1L gene expression in astrocyte cultures was not a¡ected by treatment with orphanin FQ. Our ¢ndings suggest that the neuroimmune function of orphanin FQ might be dependent on interleukin-1L derived from microglia, and the interaction between microglia and neurons. B 2002 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: orphanin FQ, interleukin-1L, neuroimmune, neuron, astrocyte, microglia.
on knockout mice for orphanin FQ have shown a susceptibility to stress-related variables of behavior (Koster et al., 1999). In addition, the anatomical distribution of orphanin FQ and OP4 has been collated with an emphasis on their relation to neuroimmune modulation (Anton et al., 1996; Henderson and McKnight, 1997; Ikeda et al., 1998). The idea was further highlighted by our work concentrated on directly evaluating the neuroimmune modulation of orphanin FQ by demonstrating its reversal of an immune response elicited by trauma following i.c.v. administration (Du et al., 1998). The immune surveillance of the CNS occurs through specialized resident cells, microglia in particular, as well as the interaction between neuropeptides and cytokines. The neuropathological changes are assumed to be characterized by increases in the size of, and interleukin-1 over-expression by, microglia, and by the increase in tissue levels of interleukin-1 mRNA in the brain (Sheng et al., 1998). Interleukin-1 was also demonstrated to mediate glial^neuronal interactions, promote further activation and further stimulation of interleukin-1 expression, which sustained the immunological process (Mrak and Gri⁄n, 2000). Recently it was demonstrated that interleukin-1 could be regulated by central administration of enkephalin (Wang et al., 1996). Here we examine the neuroimmune function of orphanin FQ associated with microglia activity and expression of interleukin-1, and
Interest in orphanin FQ and its receptor OP4 (Calo’ et al., 2000) (formerly known as opioid receptor-like 1 receptor, ORL1) has grown rapidly in recent years. The discovery of the receptor was made in 1994 and the endogenous ligand was identi¢ed 1 year later (Meunier et al., 1995; Reinscheid et al., 1995). Until now, many attempts have been made to elucidate the neuroimmune modulation of this system; it was found that OP4 transcripts were expressed in normal human circulating lymphocytes and monocytes as well as in T and B cells and U937, CEM-T, THP-1, HSB2, MOLT-4 cell lines (Peluso et al., 1998). Also, there is increasing evidence that the orphanin FQ and OP4 system has a signi¢cant impact on immune regulation. For example, speci¢c antisense nucleotides have been demonstrated to inhibit lipopolysaccharide-induced lymphocyte proliferation and production of immunoglobulins G and M (Halford et al., 1995; Meunier, 1997). Data available
*Corresponding author. Tel.: +86-21-64041900-2397; fax: +86-2164174579. E-mail address: [email protected] (X.-D. Cao). Abbreviations : ABC, avidin^biotin^peroxidase complex; FITC, £uorescein isothiocyanate ; GFAP, glial ¢brillary acidic protein ; NSE, neuron-speci¢c enolase; RT-PCR, reverse transcriptionpolymerase chain reaction; SSC, saline sodium citrate. 1019
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1020
H. Zhao et al.
further elucidate its central mechanism on neuroimmune modulation.
EXPERIMENTAL PROCEDURES
Traumatic animal model Wistar adult female rats (Animal Center of Chinese Academy of Sciences, 200^250 g) were used in the present study. Dorsomyotomy and exploratory laparotomy were performed on the rats under anesthesia (sodium pentobarbital 35 mg/kg, i.p.) as the model of traumatic stress. No post-operative infection occurred. The operation was performed 48 h after implanting a cannula, and tissue samples were taken 8 h after the operation. All protocols were approved by the Committee on Research Animal Care of Fudan University, and the principles and procedures outlined in the NIH Guide for the Care and Use of Laboratory Animals were observed.
labeled interleukin-1L mRNA oligonucleotide probe at 37‡C for 18 h, then transferred into £uorescein isothiocyanate (FITC)-conjugated anti-digoxigenin antiserum (Boehringer Mannheim, 1:40) for 1 h. Secondly the section was incubated with anti-orphanin FQ antiserum (Phoenix Pharmaceuticals, 1:500) overnight, then transferred to rhodamine-conjugated antibody (Vector Laboratories, Burlingame, CA, USA; 1:20). Coronal sections were incubated ¢rst with digoxigenin-labeled OP4 mRNA oligonucleotide probe at 37‡C for 18 h, then transferred into FITC-conjugated anti-digoxigenin antiserum for 1 h. The sections were then incubated with neuron-speci¢c enolase (NSE), glial ¢brillary acidic protein (GFAP) or OX42 (Boehringer Mannheim, 1:100) overnight, then transferred to conjugated antibody. Antibodies were diluted in phosphate-bu¡ered saline containing 0.3% Triton X-100, 10% normal horse serum. Data were analyzed by laser confocal scanning microscope (Leica TCS-NT, Germany). The areas chosen for analysis were parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus). Cell cultures and treatment
Intracerebroventricular injection of drugs Implantation of the cannula was performed stereotaxically under anesthesia, the stainless steel guide cannula (0.5 mm in diameter) with an inserted cannula (0.25 mm in diameter) was implanted into the right lateral ventricle (posterior 0.5, lateral 1.5, horizontal 4.5) and ¢xed on the skull with dental cement. The drugs were dissolved in sterilized normal saline. Orphanin FQ (Shanghai Institute of Biochemistry, Chinese Academy of Sciences; 0.55 nmol) and its receptor antagonist ([Phe1 8(CH2 NH)Gly2 ]nociceptin-(1^13)-NH2 ) (Phoenix Pharmaceuticals, Belmont, CA, USA; 0.55 nmol) were added with a protease inhibitor (1 mg/ml) to prevent proteolysis. Drugs were injected over 10 s via the cannula at a volume of 20 Wl. After the experiment, the location of the cannula was veri¢ed. Rats from the control group were injected with normal saline. In situ hybridization Two hours after central administration of orphanin FQ or the OP4 antagonist, in situ hybridization was performed. The probes used in the present study were a 50-mer oligonucleotide antisense to the rat OP4 , 5P-ggggcagggatctccaccaggcactcgatctcttcatcttccacttgtgc-3P, which was complementary to OP4 mRNA 743^796, and a 30-mer oligonucleotide antisense to the rat interleukin-1L, 5P-gaactgtgcagactcaaactccactttggt-3P, which was complementary to interleukin-1L mRNA 746^775 (Shanghai Sangon Company, Shanghai, China). The probe was labeled with digoxigenin according to the digoxigenin labeling and detection kit (Boehringer Mannheim, Mannheim, Germany). Rats were anesthetized with sodium pentobarbital (35 mg/kg, i.p.) and perfused transcardially with ¢xative (4% paraformaldehyde). Brain slices (30 Wm) were hybridized for 18 h at 37‡C in a bu¡er containing 20 pmol digoxigenin-labeled oligonucleotide probe, 50% formaldehyde, 5Usaline sodium citrate (SSC; 1USSC = 150 mM NaCl and 15 mM sodium citrate), 2% blocking reagent, 0.02% sodium dodecylsulfate. After two washes in SSC, the slices were incubated with alkaline phosphatase-labeled anti-digoxigenin antibody at room temperature for 2 h, then transferred into nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate for 6 h. Control was hybridized with sense or missense oligonucleotides or overdosed with unlabeled oligonucleotide probe. The data derived from every group were analyzed by Quantimet 570 software (Leica Q500IW). The areas chosen for analysis were the parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus). In all cases immunopositive cells were semi-quanti¢ed by randomly choosing three areas under photomicrography in these regions. Immuno£uorescent double-labeling The coronal section was incubated ¢rst with digoxigenin-
NSC 5676 25-9-02
Rat fetuses were removed from pregnant rats on embryonic day 18. Cortices were dissected and collected in Hanks’ balanced salt solution on ice. Cells were dissociated and plated at a density of 105 cells per well into 24-well tissue culture plates pretreated with 0.1% polyethyleneimine. The cells were maintained in serum-free Neurobasal medium containing B27 supplement (Gibco, Rockville, MD, USA) (Buzas et al., 1998). After 3^ 4 days in culture, cells of neuronal morphology sent out long processes; by 10 days, lipopolysaccharide (30 mg/l) or orphanin FQ (100 nM) or OP4 antagonist was added. For primary astrocyte cultures, the dissociated cells were plated in untreated 24well tissue culture plates. The culture medium was Dulbecco’s modi¢ed Eagle’s medium supplemented with 10% fetal calf serum, 2 mM glutamine, and 50 U penicillin/50 Wg/ml streptomycin, the adherent cells were puri¢ed after 24 h plating. When cultured for 2 weeks, the cells were treated the same as the neurons. For microglia culture, microglia were isolated from above the non-adherent cells. Cells were grown for 2 weeks with the medium changed twice a week, then the cells were cultured for an additional 10 days without changing the medium to provoke nutritional deprivation, which promotes the appearance of microglia (Giulian et al., 1986; Ban et al., 1993). Loosely adherent cells were recovered by gently £ushing culture medium and plated at a density of 105 cells per well into 24-well tissue culture plates. After 6 days plating, the cells were treated the same as for neurons. Reverse transcription-polymerase chain reaction Total RNA was prepared from cultured cells 2 h after di¡erent treatment (orphanin FQ, OP4 antagonist, lipopolysaccharide), and isolated by guanidine thiocyanate. Interleukin-1L mRNA levels were measured by reverse transcription-polymerase chain reaction (RT-PCR); a site-directed mutant template which substituted A for T480 was employed as internal standard (Lu et al., 1996; Wang et al., 2001). RNA was reverse-transcribed by 100 U of Moloney murine leukemia virus reverse transcriptase in a standard bu¡er containing 3 WM antisense primer, 1 mM of each dNTP, and 20 U RNasin at 37‡C for 60 min. PCR primers were tgtggcagctacctatgtct (sense) and cttgagaggtgctgatgtac (antisense) binding to bp 294^313 and bp 784^803 respectively. PCR conditions were 94‡C for 3 min, 35 cycles of 56‡C, 1 min; 72‡C, 1.5 min; 94‡C, 1 min, then 72‡C, 10 min. Ampli¢cation products were cultivated with XhoI at 37‡C for 60 min and separated on 2% agarose gels, stained with ethidium bromide, and scanned with ultraviolet transilluminator (GDS 8000, Gene Tools from Syngene software). The PCR quantitative method takes advantage of the fact that an amount of template RNA competes with the same amount of site-directed mutant template RNA in the same condition. All the results were expressed as ratios of the intensity of the 510-bp band to that of the 327-bp band.
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 1. Immuno£uorescent double-labeling shows the co-localization of orphanin FQ immunoreactive cells (green) and interleukin-1L mRNA anti-digoxigenin immunopositive cells (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled interleukin-1L oligonucleotide probe, then transferred to £uorescent conjugated anti-digoxigenin antiserum. After that, brain slices were incubated with anti-orphanin FQ (1:500), then transferred to FITC-conjugated secondary antibody. Interleukin-1L mRNA immunoreactive cells are shown by red immuno£uorescence, orphanin FQ immunoreactive cells by green immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1021
1022
H. Zhao et al.
Fig. 2. Light micrography illustrating the distribution of interleukin-1L mRNA immunoreactive cells at low power. Interleukin-1L mRNA was detected by the in situ hybridization technique, and the speci¢city of the method assessed by sense and missense digoxigenin-labeled oligonucleotide probe controls. Interleukin-1L mRNA immunoreactive cells were semi-quanti¢ed in three randomly chosen areas by photomicrography (100U). Anti-digoxigenin immunostainings in parietal lobe (upper) and periventricular region (lower) are shown. Interleukin-1L mRNA immunoreactive cells were only sparsely distributed under normal conditions (A), but they were increased by trauma (B). Orphanin FQ had an inhibitory e¡ect on trauma (C). This e¡ect was antagonized by co-treatment with an OP4 antagonist (D). The same changes also occurred in hippocampal CA1 region.
RESULTS
Co-localization of orphanin FQ and interleukin-1L The overlap of orphanin FQ immunoreactive cells and interleukin-1L mRNA anti-digoxigenin immunopositive cells was analyzed by an immuno£uorescent doublelabeling technique. Under laser confocal scanning photography, orphanin FQ immunoreactive cells were shown by green immuno£uorescence, anti-digoxigenin immunopositive cells representing interleukin-1L mRNA were shown by red immuno£uorescence, and co-localized cells by yellow immuno£uorescence. In the present
NSC 5676 25-9-02
experiment, yellow immuno£uorescence was evident in the cerebral cortex, hippocampus and hypothalamus (Fig. 1), indicating that orphanin FQ immunoreactive cells were co-localized with interleukin-1L mRNA antidigoxigenin immunopositive cells in the CNS. E¡ect of orphanin FQ on interleukin-1L mRNA transcripts in the CNS Interleukin-1L mRNA transcripts were detected by the in situ hybridization technique. The samples were divided into four groups: (1) control, (2) trauma, (3) trauma+orphanin FQ, (4) trauma+orphanin FQ+OP4 antagonist
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 3. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and neurons (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin antiserum. The brain slices were then incubated with NSE and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, NSE immunoreactive cells by red immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1023
1024
H. Zhao et al.
Fig. 4. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and astrocytes (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin antiserum. After that brain slices were incubated with GFAP and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, GFAP immunoreactive cells by red immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 5. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and microglia (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin. After that brain slices were incubated with OX42 and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, OX42 immunoreactive cells by red immuno£uorescence, and double-labeling cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1025
1026
H. Zhao et al.
Fig. 6.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
(n = 6). Anti-digoxigenin immunopositive cells were semiquanti¢ed in three randomly chosen areas by photomicrography (100U). The mean numbers of antidigoxigenin immunopositive cells in parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus) were 7.9 U 3.07, 15.9 U 3.93, 8.6 U 2.41 in the control group, 78.9 U 5.13, 38.1 U 6.33, 49.1 U 9.84 in the trauma group, 31.1 U 7.55, 23.7 U 2.31, 28.4 U 5.19 in the trauma+orphanin FQ group, and 67.6 U 5.36, 43.5 U 5.23, 45.1 U 6.03 in the trauma+orphanin FQ+OP4 antagonist group. This indicated that interleukin-1L mRNA transcripts were expressed at low levels in the CNS under normal conditions. However, these levels were signi¢cantly increased following trauma, and were antagonized by treatment with orphanin FQ (Fig. 2). Expression of OP4 mRNA transcripts in neurons, astrocytes and microglia Overlap of OP4 mRNA anti-digoxigenin immunopositive cells with NSE, GFAP or OX42 immunoreactive cells presented for neurons, astrocytes and microglia was analyzed by the immuno£uorescent double-labeling technique. Under laser confocal scanning photography, OP4 mRNA immunoreactive cells were shown by green immuno£uorescence, and NSE, GFAP or OX42 immunoreactive cells were all shown by red immuno£uorescence, and co-localized cells by yellow immuno£uorescence. We found that yellow immuno£uorescence was widely distributed in the cerebral cortex, hippocampus and hypothalamus (Figs. 3^5). E¡ect of orphanin FQ on microglial cell numbers Microglia was identi¢ed using avidin^biotin^peroxidase complex (ABC). The samples were also divided into four groups: (1) control, (2) trauma, (3) trauma+orphanin FQ, (4) trauma+orphanin FQ+OP4 antagonist (n = 6). Monoclonal OX42 immunoreactive cells were semi-quanti¢ed by randomly choosing three areas by photomicrography (100U). The mean numbers of OX42 immunoreactive cells in parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus) were 7.5 U 3.06, 8.9 U 2.85, 19.2 U 3.97 in the control group, 34.4 U 3.50, 43.1 U 4.63, 77.0 U 6.43 in the trauma group, 14.2 U 3.71, 15.3 U 3.27, 22.9 U 4.93 in the trauma+orphanin FQ group, and 29.5 U 4.41, 33.2 U 2.36, 59.2 U 7.13 in the trauma+orphanin FQ+OP4 antagonist group. These results indicate that similar changes occurred in microglial cell numbers to interleukin-1L mRNA transcripts following trauma and treatment with orphanin FQ (Fig. 6).
Fig. 7. RT-PCR detection of the time course of interleukin-1L gene expression after exposure to lipopolysaccharide. Lipopolysaccharide was reported to be an e¡ective stimulant of interleukin-1L mRNA expression at a concentration of 30 mg/l. After exposure to lipopolysaccharide, interleukin-1L gene expression from cultured cells occurred at 30 min, and was sustained up to 2 h.
E¡ect of orphanin FQ on astrocyte numbers Astrocytes were identi¢ed by immunohistochemistry (ABC) and the mean number of GFAP immunoreactive cells was semi-quanti¢ed in three randomly chosen areas by photomicrography (100U). In the present experiment, astrocytes were shown to be not a¡ected by trauma or orphanin FQ (data not shown). E¡ect of orphanin FQ on interleukin-1L gene expression in cultured microglia and astrocytes Highly enriched populations of astrocytes and microglia were produced. Dissociated brain cells from newborn rat that were cultured for 2 weeks on plastic surfaces developed into pure astrocytes. The monolayer of £at polygonal-shaped cells obtained was composed of astrocytes as identi¢ed by their immunoreactivity with anti-GFAP antiserum (data was not shown). Secondary microglia cultures appear as irregularly shaped cells. They change readily from £at, round to amoeboid cells with extensive ¢nger-like projections (Fig. 8A, upper). They are identi¢ed by their immunoreactivity with anti-OX42 antiserum (Fig. 8B, upper). When we then performed RT-PCR analysis, a speci¢c primer was designed from two distinct exons £anking a large intron, and a site-directed mutant template was employed as an internal standard. The time course of interleukin-1L mRNA transcripts exposed to lipopolysaccharide was ¢rst identi¢ed. Interleukin-1L mRNA could be detected 30 min following exposure to lipopolysaccharide, and was sustained up to 2 h (Fig. 7). Therefore, responses occurring 2 h after treatment with lipopolysaccharide, orphanin FQ or OP4 antagonist were focused on. Cultured cells were divided into three groups: (1) lipopolysaccharide, (2) lipopolysaccharide+ orphanin FQ, (3) lipopolysaccharide+orphanin FQ+ OP4 antagonist (n = 6). For astrocyte cell cultures, data derived from the three groups showed no di¡erence. For microglia cultures, ratios of the intensity of the 510-bp to
Fig. 6. Light micrography illustrating the distribution of OX42 immunoreactive cells at low power. OX42 was detected by immunohistochemical method. The immunoreactive cells were semi-quanti¢ed using three randomly chosen areas by photomicrography (100U). OX42 immunostainings in hippocampal CA1 region (upper), parietal lobe (middle) and periventricular region (lower) are shown. OX42 immunoreactive cells were only sparsely distributed under normal conditions (A), but were increased by trauma (B). Orphanin FQ had an inhibitory e¡ect on trauma (C), whose e¡ect could be antagonized by OP4 antagonist (D). Scale bar = 50 Wm.
NSC 5676 25-9-02
1027
Cyaan Magenta Geel Zwart
1028
H. Zhao et al.
Fig. 8. RT-PCR detection of interleukin-1L gene expression in cultured microglia. Microglia were small in volume and with extensive ¢nger-like projections (A), which showed OX42 immunoreactive (B) in the upper. Interleukin-1L gene expression was analyzed by the RT-PCR technique, and a site-directed mutant template was employed as standard. M: DNA molecular weight marker. Lines 1^3: undigested PCR products from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist. Lines 4^6: PCR products digested by XhoI from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist.
that of the 327-bp band were 0.665 U 0.105 in the lipopolysaccharide group, 0.217 U 0.026 in the lipopolysaccharide+orphanin FQ group, and 0.519 U 0.048 in the lipopolysaccharide+orphanin FQ+OP4 antagonist group. These results indicate that the increased interleukin-1L gene expression induced by lipopolysaccharide could be inhibited by orphanin FQ (Fig. 8, lower). E¡ect of orphanin FQ on interleukin-1L gene expression in cultured neuron Primary cortical neurons derived from 18-day-old rat embryos, and cultured for 10 days in serum-free medium, were used in these studies (Fig. 9A, upper). In immunocytochemical experiments, we con¢rmed that our cultures consisted predominantly of neurons stained positively with antiserum against neuro¢lament 160 (Boehringer Mannheim) which is speci¢c for cultured neurons (Fig. 9B, upper). In subsequent RT-PCR analysis, interleukin-1L gene expression was investigated in cultured neurons. The cells were divided into three groups: (1) lipopolysaccharide, (2) lipopolysaccharide+ orphanin FQ, (3) lipopolysaccharide+orphanin FQ+ OP4 antagonist (n = 6). Ratios of intensity of the 510-bp band to that of the 327-bp band were 0.204 U 0.024 in the lipopolysaccharide group, 0.699 U 0.055 in the lipopolysaccharide+orphanin FQ group, and 0.188 U 0.069 in the lipopolysaccharide+orphanin FQ+ OP4 antagonist group. These results indicate that increased interleukin-1L gene expression induced by lipopolysaccharide was further promoted by orphanin FQ,
NSC 5676 25-9-02
which was contrary to our ¢ndings in cultured microglia (Fig. 9, lower).
DISCUSSION
The circuit of corticotropin-releasing hormone^corticotropic hormone^glycocorticoid^interleukin-1 has been highlighted by many studies (Dinarello, 1991). Interleukin-1 up-regulates the level of corticotropin-releasing hormone, which subsequently alters the active state of lymphocytes and thymocytes. In our previous study where traumatic rats were employed as an animal model, we found that augmentation of macrophage activity induced by trauma could be down-regulated by central administration of the interleukin-1L antibody (Zhao et al., 2001). Combined with the above evidence that interleukin-1L has several consequences in view of the wide range of immunosuppression as a stimulator of the hypothalamus^pituitary^adrenal axis (Dinarello, 1991), these results suggested that interleukin-1L may function as an important neuroimmune modulator. The idea was supported by the present study, which revealed that orphanin FQ immunoreactive cells were co-localized with interleukin-1L mRNA anti-digoxigenin immunopositive cells in the cerebral cortex, hippocampus and hypothalamus, probably re£ecting some correlation between these two substances. An inhibitory e¡ect on interleukin1L mRNA transcripts by orphanin FQ was further identi¢ed in traumatic rats, the e¡ect was attributable to the OP4 pathway. Therefore, ¢ndings concerning neuroim-
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
1029
Fig. 9. RT-PCR detection of interleukin-1L gene expression in cultured neurons. Neurons were cultured in Neurobasal medium, supplemented with B27, which only allows the growth of neurons by inhibiting glial cells. After 10 days of culture, neurons extended long processes (A), and showed neuro¢lament 160 immunoreactive (B) in the upper. Interleukin-1L gene expression was analyzed by the RT-PCR technique, and a site-directed mutant template was employed as standard. M: DNA molecular weight marker. Lines 1^3: undigested PCR products from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist. Lines 4^6: PCR products digested by XhoI from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist.
mune modulation of orphanin FQ (Du et al., 1998) may be in association with interleukin IL-1L in the CNS. It is thought that microglia clearly form a regularly spaced network of resident glial cells that may constitute part of the defense system of the CNS (Stoll and Jander, 1999). As the main cell source of interleukin-1L in the CNS (Giulian et al., 1986), microglia have also been reported to be functionally related to cells of the monocyte/macrophage lineage and have a rapid inducibility for major histocompatibility complex class II antigen (Landis, 1994). So we also observe an e¡ect of orphanin FQ on microglia in the present study. It was shown that microglia undergo a dramatic number transformation, namely an enhancement by trauma and a reduction by central administration of orphanin FQ, similar changes occurred in the expression of interleukin-1L mRNA transcripts in the CNS. An e¡ect of orphanin FQ on astrocytes was also observed. Contrary to microglia, astrocytes were not a¡ected by trauma or orphanin FQ although they also are a cellular source of interleukin-1L. Microglia are characteristically activated at a very early stage in response to injury, this activation often preceding reactions of any other cell type in the brain (Landis, 1994). In contrast, astrocytes are characterized by a twophase response, with a trend toward normalization within a few days, and a second phase of GFAP upregulation a few weeks after injury (Landis, 1994). Our ¢nding was that increased numbers of microglia and interleukin-1L mRNA transcripts occurred 8 h after trauma, which may re£ect the early response. Thus, our results suggest that microglia might be another important factor in neuroimmune modulation of orphanin FQ.
NSC 5676 25-9-02
Within the CNS, interleukin-1L is not only created and released by various types of glia, but by neurons as well. In addition, OP4 mRNA transcripts were demonstrated to be expressed on neurons, astrocytes and microglia. Accordingly, it was necessary to examine the cellular actions of orphanin FQ on the three cell types. By RTPCR analysis, and site-directed mutant template as a reference quantitative, we observed that interleukin-1L gene expression occurs 30 min after lipopolysaccharide treatment, and was sustained up to 2 h. This is in agreement with other reports that when stimulated with endotoxin and other microbial products, interleukin-1L mRNA transcripts occurred rapidly, and the peak accumulation occurred around 3^4 h (Dinarello, 1991). In order to mimic in vivo experiments, responses were observed 2 h after treatment, and the cultured cells were exposed to 100 nM orphanin FQ, a concentration which has been described to inhibit cell activity through membrane hyperpolarization in current clamp (Mogil et al., 1996). As predicted, interleukin-1L gene expression induced by lipopolysaccharide was reduced by orphanin FQ in cultured microglia. In cultured astrocytes, it remained unchanged, which is in agreement with in vivo experiments. However, a con£icting result was obtained from cultured neurons. Here interleukin-1L gene expression was enhanced after treatment with orphanin FQ; this may shed some light on a possible interaction between neurons and microglia. A closer examination suggests that the astrocytic processes typically separate microglia from the adjacent neuronal membrane, whereas microglia have also been claimed to occupy a perineuronal position before astrocytic processes begin to extend along non-synaptic membrane ter-
Cyaan Magenta Geel Zwart
1030
H. Zhao et al.
ritory, and microglia appear to accumulate in the vicinity of postsynaptic structures. This structural arrangement raises intriguing questions about the neuronal ‘signal’ involved in microglia activation (Aldskogius and Kozlova, 1998). Consequently, one cannot exclude a direct inhibitory e¡ect on neurons by microglia in vivo, and when these synapses were disturbed, the genuine reaction was observed. There are numerous observations reporting that major histocompatibility complex class II molecules are associated with the CNS in normal and pathological conditions, and major histocompatibility complex class II expression is necessary for antigen presentation to CDþ 4 T cells. Microglia have long been considered intrinsic antigen-presenting cells of the brain. Several studies have addressed that microglia could release as well as respond to interleukin-1L, which is instrumental in recruitment of T cells into the lesion. The evidence presented in this study shows that microglia and interleukin1L were both under the regulation of orphanin FQ, which, considering the neuroimmune modulatory role of orphanin FQ, suggests that interleukin-1L mainly stemming from microglia might function as the mediator. However, since our data only re£ect the early stage of
response, the mechanism of neuroimmune function of orphanin FQ is still an open question.
CONCLUSION
In summary, the present study suggests that orphanin FQ shares a close relationship with interleukin-1L in the CNS. Overlap of orphanin FQ immunoreactive cells and interleukin-1L mRNA anti-digoxigenin immunopositive cells was found in the cerebral cortex, hippocampus and hypothalamus. Further it was identi¢ed that orphanin FQ had a regulatory e¡ect on interleukin-1L mRNA transcripts, which suggested that neuroimmune modulation of orphanin FQ might be dependent on interleukin1L in the CNS. Microglia also participated in mediating the function of orphanin FQ and provided the main cell source of interleukin-1L. Neurons may receive inhibitory synaptic potential input from microglia in vivo.
Acknowledgements/This project was supported by Grant 39870915, National Nature Science Foundation in China.
REFERENCES
Aldskogius, H., Kozlova, E.N., 1998. Central neuron-glial and glial-glial interactions following axon injury. Prog. Neurobiol. 55, 1^26. Anton, B., Fein, J., To, T., Li, X., Silberstein, L., Evans, C.J., 1996. Immunohistochemical localization of ORL-1 in the central nervous system of the rat. J. Comp. Neurobiol. 368, 229^251. Ban, E.M., Sarlieve, L.L., Haour, F.G., 1993. Interleukin-1 binding sites on astrocytes. Neuroscience 52, 725^733. Buzas, B., Rosenberger, J., Cox, B.M., 1998. Activity and cyclic AMP-dependent regulation of nociceptin/orphanin FQ gene expression in primary neuronal and astrocyte cultures. J. Neurochem. 71, 556^563. Calo’, G., Guerrini, R., Rizzi, A., Salvadori, S., Regoli, D., 2000. Pharmacology of nociceptin and its receptor : a novel therapeutic target. Br. J. Pharmacol. 129, 1261^1283. Dinarello, C.A., 1991. Interleukin-1 and interleukin-1 antagonism. Blood 77, 1627^1652. Du, L.N., Wu, G.C., Cao, X.D., 1998. Modulation of orphanin FQ or electroacupuncture on immune function of traumatic rats. Acupunct. Electrother. Res. Int. J. 23, 1^8. Giulian, D., Baker, T.J., Shih, L.C., Lachman, L.B., 1986. Interleukin-1 of the central nervous system is produced by ameboid microglia. J. Exp. Med. 164, 594^604. Halford, W.P., Gebhardt, B.M., Carr, D.J., 1995. Functional role and sequence analysis of a lymphocyte orphan opioid receptor. J. Neuroimmunol. 59, 91^101. Henderson, G., McKnight, A.T., 1997. The orphan opioid receptor and its endogenous ligand nociceptin/orphanin FQ. Trends Pharmacol. Sci. 18, 293^300. Ikeda, K., Watanabe, M., Ichikawa, T., Kobayashi, T., Yano, R., Kumanishi, T., 1998. Distribution of prepro-nociceptin/orphanin FQ mRNA and its receptor mRNA in developing and adult mouse central nervous systems. J. Comp. Neurobiol. 399, 139^151. Koster, A., Montkowski, A., Schulz, S., Stube, E.M., Knaudt, K., Jenck, F., Moreau, J.L., Nothacker, H.P., Civelli, O., Reinscheid, R.K., 1999. Targeted disruption of the orphanin FQ/nociceptin gene increases stress susceptibility and impairs stress adaptation in mice. Proc. Natl. Acad. Sci. USA 96, 10444^10449. Landis, D.M., 1994. The early reactions of non-neuronal cells to brain injury. Annu. Rev. Neurosci. 17, 133^151. Lu, L.M., Li, H.Y., Wang, R., Yao, T., 1997. Quantitative analysis of mRNA level by PCR method using single base-mutation template as inner standard. Acta Physiol. Sin. 49, 235^240. Meunier, J.C., 1997. Nociceptin/orphanin FQ and the opioid receptor-like ORL1 receptor. Eur. J Pharmacol. 340, 1^15. Meunier, J.C., Mollereau, C., Toll, L., Suandeau, C., Moisand, C., Alvinerie, P., Butour, J.L., Guillemot, J.C., Ferrara, P., Monsarrat, B., Mazarquil, H., Vassart, G., Parmentier, M., Costentin, J., 1995. Isolation and structure of the endogenous agonist of opioid receptor-like ORL-1 receptor. Nature 377, 532^535. Mogil, J.S., Grisel, J.E., Reinscheid, R.K., Civelli, O., Belknap, J.K., Grandy, D.K., 1996. Orphani FQ is a functional anti-opioid peptide. Neuroscience 75, 333^337. Mrak, R.E., Gri⁄n, W.S., 2000. Interleukin-1 and immunogenetics of Alzheimer disease. J. Neuropathol. Exp. Neurol. 59, 471^476. Peluso, J., Laforge, K.S., Matthes, H.W., Kreek, M.J., Kie¡er, B.L., Gaveriaux-Ru¡, C., 1998. Distribution of nociceptin/orphanin FQ receptor transcripts in human central nervous system and immune cells. J. Neuroimmunol. 81, 184^188. Reinscheid, R.K., Nothacker, H.P., Bourson, A., Ardati, A., Henningsen, R.A., Bunzow, J.R., Grandy, D.K., Langen, H., Monsma, F.J., Civelli, O., 1995. Orphanin FQ: a neuropeptide that activates an opioid like G-protein coupled receptor. Science 270, 792^794. Sheng, J.G., Mrak, R.E., Gri⁄n, W.S., 1998. Enlarged and phagocytic, but not primed, IL-1-K-immunoreactive microglia increase with age in normal human brain. Acta Neuropathol. 95, 229^234. Stoll, G., Jander, S., 1999. The role of microglia and macrophage in the pathophysiology of the CNS. Prog. Neurobiol. 58, 233^247.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
1031
Wang, A.J., Yang, Y.Z., Wu, Y.M., 1996. E¡ect of intrahippocampal microinjection of enkephalin on cellular immune function and brain IL-1K gene expression in rat. Acta Physiol. Sin. 48, 348^354. Wang, J., Lu, L.M., Du, L.N., Wu, G.C., Cao, X.D., 2001. In£uence of orphanin FQ on IL-1L mRNA gene expression in hippocampus of traumatic rats. Chin. J. Neurosci. 17, 368^372. Zhao, H., Du, L.N., Jiang, J.W., Wu, G.C., Cao, X.D., 2001. E¡ect of orphanin FQ on IL-1L mRNA transcripts in hippocampus. Acta Physiol. Sin. 53, 209^214. (Accepted 8 April 2002)
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
Neuroscience Vol. 114, No. 4, pp. 1019^1031, 2002 B 2002 IBRO. Published by Elsevier Science Ltd All rights reserved. Printed in Great Britain 0306-4522 / 02 $22.00+0.00
www.neuroscience-ibro.com
EFFECT OF ORPHANIN FQ ON INTERLEUKIN-1L MRNA TRANSCRIPTS IN THE RAT CNS H. ZHAO,a H.-W. HUANG,b G.-C. WUa and X.-D. CAOa a
National Key Laboratory of Medical Neurobiology, Department of Neurobiology, Shanghai Medical College of Fudan University, Shanghai 200032, PR China b
Department of Hand Surgery, Huashan Hospital a⁄liated Fudan University, Shanghai 200032, PR China
Abstract3To elucidate the mechanism of orphanin FQ on neuroimmune modulation, the relationship between orphanin FQ and interleukin-1L in the rat CNS in vivo and in vitro was investigated. In our experiments, it was found that orphanin FQ and interleukin-1L mRNA transcripts showed a similar distribution in cerebral cortex, hippocampus and hypothalamus. By using the in situ hybridization technique, down-regulation of interleukin-1L mRNA transcripts by central administration of orphanin FQ was further identi¢ed in the traumatic animal model. Similar inhibitory e¡ects were also observed on the number of microglia in the CNS. The e¡ects produced by orphanin FQ were abolished by combination with its receptor (OP4 )-speci¢c antagonist [Phe1 8(CH2 -NH)Gly2 ]nociceptin-(1^13)-NH2 , which suggested that the function of orphanin FQ might be attributable to the OP4 pathway. However, the e¡ect on the number of astrocytes in the CNS remained unchanged, despite evidence that OP4 is expressed on astrocytes as well as on neurons and microglia. When analyzed by reverse transcription-polymerase chain reaction, interleukin-1L gene expression was observed to be enhanced and inhibited in primary neuron and microglial cell cultures exposed to orphanin FQ respectively. Interleukin-1L gene expression in astrocyte cultures was not a¡ected by treatment with orphanin FQ. Our ¢ndings suggest that the neuroimmune function of orphanin FQ might be dependent on interleukin-1L derived from microglia, and the interaction between microglia and neurons. B 2002 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: orphanin FQ, interleukin-1L, neuroimmune, neuron, astrocyte, microglia.
on knockout mice for orphanin FQ have shown a susceptibility to stress-related variables of behavior (Koster et al., 1999). In addition, the anatomical distribution of orphanin FQ and OP4 has been collated with an emphasis on their relation to neuroimmune modulation (Anton et al., 1996; Henderson and McKnight, 1997; Ikeda et al., 1998). The idea was further highlighted by our work concentrated on directly evaluating the neuroimmune modulation of orphanin FQ by demonstrating its reversal of an immune response elicited by trauma following i.c.v. administration (Du et al., 1998). The immune surveillance of the CNS occurs through specialized resident cells, microglia in particular, as well as the interaction between neuropeptides and cytokines. The neuropathological changes are assumed to be characterized by increases in the size of, and interleukin-1 over-expression by, microglia, and by the increase in tissue levels of interleukin-1 mRNA in the brain (Sheng et al., 1998). Interleukin-1 was also demonstrated to mediate glial^neuronal interactions, promote further activation and further stimulation of interleukin-1 expression, which sustained the immunological process (Mrak and Gri⁄n, 2000). Recently it was demonstrated that interleukin-1 could be regulated by central administration of enkephalin (Wang et al., 1996). Here we examine the neuroimmune function of orphanin FQ associated with microglia activity and expression of interleukin-1, and
Interest in orphanin FQ and its receptor OP4 (Calo’ et al., 2000) (formerly known as opioid receptor-like 1 receptor, ORL1) has grown rapidly in recent years. The discovery of the receptor was made in 1994 and the endogenous ligand was identi¢ed 1 year later (Meunier et al., 1995; Reinscheid et al., 1995). Until now, many attempts have been made to elucidate the neuroimmune modulation of this system; it was found that OP4 transcripts were expressed in normal human circulating lymphocytes and monocytes as well as in T and B cells and U937, CEM-T, THP-1, HSB2, MOLT-4 cell lines (Peluso et al., 1998). Also, there is increasing evidence that the orphanin FQ and OP4 system has a signi¢cant impact on immune regulation. For example, speci¢c antisense nucleotides have been demonstrated to inhibit lipopolysaccharide-induced lymphocyte proliferation and production of immunoglobulins G and M (Halford et al., 1995; Meunier, 1997). Data available
*Corresponding author. Tel.: +86-21-64041900-2397; fax: +86-2164174579. E-mail address: [email protected] (X.-D. Cao). Abbreviations : ABC, avidin^biotin^peroxidase complex; FITC, £uorescein isothiocyanate ; GFAP, glial ¢brillary acidic protein ; NSE, neuron-speci¢c enolase; RT-PCR, reverse transcriptionpolymerase chain reaction; SSC, saline sodium citrate. 1019
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1020
H. Zhao et al.
further elucidate its central mechanism on neuroimmune modulation.
EXPERIMENTAL PROCEDURES
Traumatic animal model Wistar adult female rats (Animal Center of Chinese Academy of Sciences, 200^250 g) were used in the present study. Dorsomyotomy and exploratory laparotomy were performed on the rats under anesthesia (sodium pentobarbital 35 mg/kg, i.p.) as the model of traumatic stress. No post-operative infection occurred. The operation was performed 48 h after implanting a cannula, and tissue samples were taken 8 h after the operation. All protocols were approved by the Committee on Research Animal Care of Fudan University, and the principles and procedures outlined in the NIH Guide for the Care and Use of Laboratory Animals were observed.
labeled interleukin-1L mRNA oligonucleotide probe at 37‡C for 18 h, then transferred into £uorescein isothiocyanate (FITC)-conjugated anti-digoxigenin antiserum (Boehringer Mannheim, 1:40) for 1 h. Secondly the section was incubated with anti-orphanin FQ antiserum (Phoenix Pharmaceuticals, 1:500) overnight, then transferred to rhodamine-conjugated antibody (Vector Laboratories, Burlingame, CA, USA; 1:20). Coronal sections were incubated ¢rst with digoxigenin-labeled OP4 mRNA oligonucleotide probe at 37‡C for 18 h, then transferred into FITC-conjugated anti-digoxigenin antiserum for 1 h. The sections were then incubated with neuron-speci¢c enolase (NSE), glial ¢brillary acidic protein (GFAP) or OX42 (Boehringer Mannheim, 1:100) overnight, then transferred to conjugated antibody. Antibodies were diluted in phosphate-bu¡ered saline containing 0.3% Triton X-100, 10% normal horse serum. Data were analyzed by laser confocal scanning microscope (Leica TCS-NT, Germany). The areas chosen for analysis were parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus). Cell cultures and treatment
Intracerebroventricular injection of drugs Implantation of the cannula was performed stereotaxically under anesthesia, the stainless steel guide cannula (0.5 mm in diameter) with an inserted cannula (0.25 mm in diameter) was implanted into the right lateral ventricle (posterior 0.5, lateral 1.5, horizontal 4.5) and ¢xed on the skull with dental cement. The drugs were dissolved in sterilized normal saline. Orphanin FQ (Shanghai Institute of Biochemistry, Chinese Academy of Sciences; 0.55 nmol) and its receptor antagonist ([Phe1 8(CH2 NH)Gly2 ]nociceptin-(1^13)-NH2 ) (Phoenix Pharmaceuticals, Belmont, CA, USA; 0.55 nmol) were added with a protease inhibitor (1 mg/ml) to prevent proteolysis. Drugs were injected over 10 s via the cannula at a volume of 20 Wl. After the experiment, the location of the cannula was veri¢ed. Rats from the control group were injected with normal saline. In situ hybridization Two hours after central administration of orphanin FQ or the OP4 antagonist, in situ hybridization was performed. The probes used in the present study were a 50-mer oligonucleotide antisense to the rat OP4 , 5P-ggggcagggatctccaccaggcactcgatctcttcatcttccacttgtgc-3P, which was complementary to OP4 mRNA 743^796, and a 30-mer oligonucleotide antisense to the rat interleukin-1L, 5P-gaactgtgcagactcaaactccactttggt-3P, which was complementary to interleukin-1L mRNA 746^775 (Shanghai Sangon Company, Shanghai, China). The probe was labeled with digoxigenin according to the digoxigenin labeling and detection kit (Boehringer Mannheim, Mannheim, Germany). Rats were anesthetized with sodium pentobarbital (35 mg/kg, i.p.) and perfused transcardially with ¢xative (4% paraformaldehyde). Brain slices (30 Wm) were hybridized for 18 h at 37‡C in a bu¡er containing 20 pmol digoxigenin-labeled oligonucleotide probe, 50% formaldehyde, 5Usaline sodium citrate (SSC; 1USSC = 150 mM NaCl and 15 mM sodium citrate), 2% blocking reagent, 0.02% sodium dodecylsulfate. After two washes in SSC, the slices were incubated with alkaline phosphatase-labeled anti-digoxigenin antibody at room temperature for 2 h, then transferred into nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate for 6 h. Control was hybridized with sense or missense oligonucleotides or overdosed with unlabeled oligonucleotide probe. The data derived from every group were analyzed by Quantimet 570 software (Leica Q500IW). The areas chosen for analysis were the parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus). In all cases immunopositive cells were semi-quanti¢ed by randomly choosing three areas under photomicrography in these regions. Immuno£uorescent double-labeling The coronal section was incubated ¢rst with digoxigenin-
NSC 5676 25-9-02
Rat fetuses were removed from pregnant rats on embryonic day 18. Cortices were dissected and collected in Hanks’ balanced salt solution on ice. Cells were dissociated and plated at a density of 105 cells per well into 24-well tissue culture plates pretreated with 0.1% polyethyleneimine. The cells were maintained in serum-free Neurobasal medium containing B27 supplement (Gibco, Rockville, MD, USA) (Buzas et al., 1998). After 3^ 4 days in culture, cells of neuronal morphology sent out long processes; by 10 days, lipopolysaccharide (30 mg/l) or orphanin FQ (100 nM) or OP4 antagonist was added. For primary astrocyte cultures, the dissociated cells were plated in untreated 24well tissue culture plates. The culture medium was Dulbecco’s modi¢ed Eagle’s medium supplemented with 10% fetal calf serum, 2 mM glutamine, and 50 U penicillin/50 Wg/ml streptomycin, the adherent cells were puri¢ed after 24 h plating. When cultured for 2 weeks, the cells were treated the same as the neurons. For microglia culture, microglia were isolated from above the non-adherent cells. Cells were grown for 2 weeks with the medium changed twice a week, then the cells were cultured for an additional 10 days without changing the medium to provoke nutritional deprivation, which promotes the appearance of microglia (Giulian et al., 1986; Ban et al., 1993). Loosely adherent cells were recovered by gently £ushing culture medium and plated at a density of 105 cells per well into 24-well tissue culture plates. After 6 days plating, the cells were treated the same as for neurons. Reverse transcription-polymerase chain reaction Total RNA was prepared from cultured cells 2 h after di¡erent treatment (orphanin FQ, OP4 antagonist, lipopolysaccharide), and isolated by guanidine thiocyanate. Interleukin-1L mRNA levels were measured by reverse transcription-polymerase chain reaction (RT-PCR); a site-directed mutant template which substituted A for T480 was employed as internal standard (Lu et al., 1996; Wang et al., 2001). RNA was reverse-transcribed by 100 U of Moloney murine leukemia virus reverse transcriptase in a standard bu¡er containing 3 WM antisense primer, 1 mM of each dNTP, and 20 U RNasin at 37‡C for 60 min. PCR primers were tgtggcagctacctatgtct (sense) and cttgagaggtgctgatgtac (antisense) binding to bp 294^313 and bp 784^803 respectively. PCR conditions were 94‡C for 3 min, 35 cycles of 56‡C, 1 min; 72‡C, 1.5 min; 94‡C, 1 min, then 72‡C, 10 min. Ampli¢cation products were cultivated with XhoI at 37‡C for 60 min and separated on 2% agarose gels, stained with ethidium bromide, and scanned with ultraviolet transilluminator (GDS 8000, Gene Tools from Syngene software). The PCR quantitative method takes advantage of the fact that an amount of template RNA competes with the same amount of site-directed mutant template RNA in the same condition. All the results were expressed as ratios of the intensity of the 510-bp band to that of the 327-bp band.
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 1. Immuno£uorescent double-labeling shows the co-localization of orphanin FQ immunoreactive cells (green) and interleukin-1L mRNA anti-digoxigenin immunopositive cells (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled interleukin-1L oligonucleotide probe, then transferred to £uorescent conjugated anti-digoxigenin antiserum. After that, brain slices were incubated with anti-orphanin FQ (1:500), then transferred to FITC-conjugated secondary antibody. Interleukin-1L mRNA immunoreactive cells are shown by red immuno£uorescence, orphanin FQ immunoreactive cells by green immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1021
1022
H. Zhao et al.
Fig. 2. Light micrography illustrating the distribution of interleukin-1L mRNA immunoreactive cells at low power. Interleukin-1L mRNA was detected by the in situ hybridization technique, and the speci¢city of the method assessed by sense and missense digoxigenin-labeled oligonucleotide probe controls. Interleukin-1L mRNA immunoreactive cells were semi-quanti¢ed in three randomly chosen areas by photomicrography (100U). Anti-digoxigenin immunostainings in parietal lobe (upper) and periventricular region (lower) are shown. Interleukin-1L mRNA immunoreactive cells were only sparsely distributed under normal conditions (A), but they were increased by trauma (B). Orphanin FQ had an inhibitory e¡ect on trauma (C). This e¡ect was antagonized by co-treatment with an OP4 antagonist (D). The same changes also occurred in hippocampal CA1 region.
RESULTS
Co-localization of orphanin FQ and interleukin-1L The overlap of orphanin FQ immunoreactive cells and interleukin-1L mRNA anti-digoxigenin immunopositive cells was analyzed by an immuno£uorescent doublelabeling technique. Under laser confocal scanning photography, orphanin FQ immunoreactive cells were shown by green immuno£uorescence, anti-digoxigenin immunopositive cells representing interleukin-1L mRNA were shown by red immuno£uorescence, and co-localized cells by yellow immuno£uorescence. In the present
NSC 5676 25-9-02
experiment, yellow immuno£uorescence was evident in the cerebral cortex, hippocampus and hypothalamus (Fig. 1), indicating that orphanin FQ immunoreactive cells were co-localized with interleukin-1L mRNA antidigoxigenin immunopositive cells in the CNS. E¡ect of orphanin FQ on interleukin-1L mRNA transcripts in the CNS Interleukin-1L mRNA transcripts were detected by the in situ hybridization technique. The samples were divided into four groups: (1) control, (2) trauma, (3) trauma+orphanin FQ, (4) trauma+orphanin FQ+OP4 antagonist
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 3. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and neurons (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin antiserum. The brain slices were then incubated with NSE and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, NSE immunoreactive cells by red immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1023
1024
H. Zhao et al.
Fig. 4. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and astrocytes (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin antiserum. After that brain slices were incubated with GFAP and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, GFAP immunoreactive cells by red immuno£uorescence, and double-labeled cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
Fig. 5. Immuno£uorescent double-labeling shows the co-localization of OP4 mRNA immunopositive cells (green) and microglia (red) in hippocampal CA1 region (A), parietal lobe (B) and periventricular region (C). Brain slices were ¢rst incubated with digoxigenin-labeled OP4 mRNA oligonucleotide probe and then transferred to £uorescent-conjugated anti-digoxigenin. After that brain slices were incubated with OX42 and then transferred to rhodamine-conjugated secondary antibody. OP4 mRNA immunoreactive cells are shown by green immuno£uorescence, OX42 immunoreactive cells by red immuno£uorescence, and double-labeling cells by yellow immuno£uorescence.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
1025
1026
H. Zhao et al.
Fig. 6.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
(n = 6). Anti-digoxigenin immunopositive cells were semiquanti¢ed in three randomly chosen areas by photomicrography (100U). The mean numbers of antidigoxigenin immunopositive cells in parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus) were 7.9 U 3.07, 15.9 U 3.93, 8.6 U 2.41 in the control group, 78.9 U 5.13, 38.1 U 6.33, 49.1 U 9.84 in the trauma group, 31.1 U 7.55, 23.7 U 2.31, 28.4 U 5.19 in the trauma+orphanin FQ group, and 67.6 U 5.36, 43.5 U 5.23, 45.1 U 6.03 in the trauma+orphanin FQ+OP4 antagonist group. This indicated that interleukin-1L mRNA transcripts were expressed at low levels in the CNS under normal conditions. However, these levels were signi¢cantly increased following trauma, and were antagonized by treatment with orphanin FQ (Fig. 2). Expression of OP4 mRNA transcripts in neurons, astrocytes and microglia Overlap of OP4 mRNA anti-digoxigenin immunopositive cells with NSE, GFAP or OX42 immunoreactive cells presented for neurons, astrocytes and microglia was analyzed by the immuno£uorescent double-labeling technique. Under laser confocal scanning photography, OP4 mRNA immunoreactive cells were shown by green immuno£uorescence, and NSE, GFAP or OX42 immunoreactive cells were all shown by red immuno£uorescence, and co-localized cells by yellow immuno£uorescence. We found that yellow immuno£uorescence was widely distributed in the cerebral cortex, hippocampus and hypothalamus (Figs. 3^5). E¡ect of orphanin FQ on microglial cell numbers Microglia was identi¢ed using avidin^biotin^peroxidase complex (ABC). The samples were also divided into four groups: (1) control, (2) trauma, (3) trauma+orphanin FQ, (4) trauma+orphanin FQ+OP4 antagonist (n = 6). Monoclonal OX42 immunoreactive cells were semi-quanti¢ed by randomly choosing three areas by photomicrography (100U). The mean numbers of OX42 immunoreactive cells in parietal lobe (cerebral cortex), CA1 region (hippocampus) and periventricular region (hypothalamus) were 7.5 U 3.06, 8.9 U 2.85, 19.2 U 3.97 in the control group, 34.4 U 3.50, 43.1 U 4.63, 77.0 U 6.43 in the trauma group, 14.2 U 3.71, 15.3 U 3.27, 22.9 U 4.93 in the trauma+orphanin FQ group, and 29.5 U 4.41, 33.2 U 2.36, 59.2 U 7.13 in the trauma+orphanin FQ+OP4 antagonist group. These results indicate that similar changes occurred in microglial cell numbers to interleukin-1L mRNA transcripts following trauma and treatment with orphanin FQ (Fig. 6).
Fig. 7. RT-PCR detection of the time course of interleukin-1L gene expression after exposure to lipopolysaccharide. Lipopolysaccharide was reported to be an e¡ective stimulant of interleukin-1L mRNA expression at a concentration of 30 mg/l. After exposure to lipopolysaccharide, interleukin-1L gene expression from cultured cells occurred at 30 min, and was sustained up to 2 h.
E¡ect of orphanin FQ on astrocyte numbers Astrocytes were identi¢ed by immunohistochemistry (ABC) and the mean number of GFAP immunoreactive cells was semi-quanti¢ed in three randomly chosen areas by photomicrography (100U). In the present experiment, astrocytes were shown to be not a¡ected by trauma or orphanin FQ (data not shown). E¡ect of orphanin FQ on interleukin-1L gene expression in cultured microglia and astrocytes Highly enriched populations of astrocytes and microglia were produced. Dissociated brain cells from newborn rat that were cultured for 2 weeks on plastic surfaces developed into pure astrocytes. The monolayer of £at polygonal-shaped cells obtained was composed of astrocytes as identi¢ed by their immunoreactivity with anti-GFAP antiserum (data was not shown). Secondary microglia cultures appear as irregularly shaped cells. They change readily from £at, round to amoeboid cells with extensive ¢nger-like projections (Fig. 8A, upper). They are identi¢ed by their immunoreactivity with anti-OX42 antiserum (Fig. 8B, upper). When we then performed RT-PCR analysis, a speci¢c primer was designed from two distinct exons £anking a large intron, and a site-directed mutant template was employed as an internal standard. The time course of interleukin-1L mRNA transcripts exposed to lipopolysaccharide was ¢rst identi¢ed. Interleukin-1L mRNA could be detected 30 min following exposure to lipopolysaccharide, and was sustained up to 2 h (Fig. 7). Therefore, responses occurring 2 h after treatment with lipopolysaccharide, orphanin FQ or OP4 antagonist were focused on. Cultured cells were divided into three groups: (1) lipopolysaccharide, (2) lipopolysaccharide+ orphanin FQ, (3) lipopolysaccharide+orphanin FQ+ OP4 antagonist (n = 6). For astrocyte cell cultures, data derived from the three groups showed no di¡erence. For microglia cultures, ratios of the intensity of the 510-bp to
Fig. 6. Light micrography illustrating the distribution of OX42 immunoreactive cells at low power. OX42 was detected by immunohistochemical method. The immunoreactive cells were semi-quanti¢ed using three randomly chosen areas by photomicrography (100U). OX42 immunostainings in hippocampal CA1 region (upper), parietal lobe (middle) and periventricular region (lower) are shown. OX42 immunoreactive cells were only sparsely distributed under normal conditions (A), but were increased by trauma (B). Orphanin FQ had an inhibitory e¡ect on trauma (C), whose e¡ect could be antagonized by OP4 antagonist (D). Scale bar = 50 Wm.
NSC 5676 25-9-02
1027
Cyaan Magenta Geel Zwart
1028
H. Zhao et al.
Fig. 8. RT-PCR detection of interleukin-1L gene expression in cultured microglia. Microglia were small in volume and with extensive ¢nger-like projections (A), which showed OX42 immunoreactive (B) in the upper. Interleukin-1L gene expression was analyzed by the RT-PCR technique, and a site-directed mutant template was employed as standard. M: DNA molecular weight marker. Lines 1^3: undigested PCR products from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist. Lines 4^6: PCR products digested by XhoI from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist.
that of the 327-bp band were 0.665 U 0.105 in the lipopolysaccharide group, 0.217 U 0.026 in the lipopolysaccharide+orphanin FQ group, and 0.519 U 0.048 in the lipopolysaccharide+orphanin FQ+OP4 antagonist group. These results indicate that the increased interleukin-1L gene expression induced by lipopolysaccharide could be inhibited by orphanin FQ (Fig. 8, lower). E¡ect of orphanin FQ on interleukin-1L gene expression in cultured neuron Primary cortical neurons derived from 18-day-old rat embryos, and cultured for 10 days in serum-free medium, were used in these studies (Fig. 9A, upper). In immunocytochemical experiments, we con¢rmed that our cultures consisted predominantly of neurons stained positively with antiserum against neuro¢lament 160 (Boehringer Mannheim) which is speci¢c for cultured neurons (Fig. 9B, upper). In subsequent RT-PCR analysis, interleukin-1L gene expression was investigated in cultured neurons. The cells were divided into three groups: (1) lipopolysaccharide, (2) lipopolysaccharide+ orphanin FQ, (3) lipopolysaccharide+orphanin FQ+ OP4 antagonist (n = 6). Ratios of intensity of the 510-bp band to that of the 327-bp band were 0.204 U 0.024 in the lipopolysaccharide group, 0.699 U 0.055 in the lipopolysaccharide+orphanin FQ group, and 0.188 U 0.069 in the lipopolysaccharide+orphanin FQ+ OP4 antagonist group. These results indicate that increased interleukin-1L gene expression induced by lipopolysaccharide was further promoted by orphanin FQ,
NSC 5676 25-9-02
which was contrary to our ¢ndings in cultured microglia (Fig. 9, lower).
DISCUSSION
The circuit of corticotropin-releasing hormone^corticotropic hormone^glycocorticoid^interleukin-1 has been highlighted by many studies (Dinarello, 1991). Interleukin-1 up-regulates the level of corticotropin-releasing hormone, which subsequently alters the active state of lymphocytes and thymocytes. In our previous study where traumatic rats were employed as an animal model, we found that augmentation of macrophage activity induced by trauma could be down-regulated by central administration of the interleukin-1L antibody (Zhao et al., 2001). Combined with the above evidence that interleukin-1L has several consequences in view of the wide range of immunosuppression as a stimulator of the hypothalamus^pituitary^adrenal axis (Dinarello, 1991), these results suggested that interleukin-1L may function as an important neuroimmune modulator. The idea was supported by the present study, which revealed that orphanin FQ immunoreactive cells were co-localized with interleukin-1L mRNA anti-digoxigenin immunopositive cells in the cerebral cortex, hippocampus and hypothalamus, probably re£ecting some correlation between these two substances. An inhibitory e¡ect on interleukin1L mRNA transcripts by orphanin FQ was further identi¢ed in traumatic rats, the e¡ect was attributable to the OP4 pathway. Therefore, ¢ndings concerning neuroim-
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
1029
Fig. 9. RT-PCR detection of interleukin-1L gene expression in cultured neurons. Neurons were cultured in Neurobasal medium, supplemented with B27, which only allows the growth of neurons by inhibiting glial cells. After 10 days of culture, neurons extended long processes (A), and showed neuro¢lament 160 immunoreactive (B) in the upper. Interleukin-1L gene expression was analyzed by the RT-PCR technique, and a site-directed mutant template was employed as standard. M: DNA molecular weight marker. Lines 1^3: undigested PCR products from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist. Lines 4^6: PCR products digested by XhoI from the three groups of lipopolysaccharide, lipopolysaccharide+orphanin FQ and lipopolysaccharide+orphanin FQ+OP4 antagonist.
mune modulation of orphanin FQ (Du et al., 1998) may be in association with interleukin IL-1L in the CNS. It is thought that microglia clearly form a regularly spaced network of resident glial cells that may constitute part of the defense system of the CNS (Stoll and Jander, 1999). As the main cell source of interleukin-1L in the CNS (Giulian et al., 1986), microglia have also been reported to be functionally related to cells of the monocyte/macrophage lineage and have a rapid inducibility for major histocompatibility complex class II antigen (Landis, 1994). So we also observe an e¡ect of orphanin FQ on microglia in the present study. It was shown that microglia undergo a dramatic number transformation, namely an enhancement by trauma and a reduction by central administration of orphanin FQ, similar changes occurred in the expression of interleukin-1L mRNA transcripts in the CNS. An e¡ect of orphanin FQ on astrocytes was also observed. Contrary to microglia, astrocytes were not a¡ected by trauma or orphanin FQ although they also are a cellular source of interleukin-1L. Microglia are characteristically activated at a very early stage in response to injury, this activation often preceding reactions of any other cell type in the brain (Landis, 1994). In contrast, astrocytes are characterized by a twophase response, with a trend toward normalization within a few days, and a second phase of GFAP upregulation a few weeks after injury (Landis, 1994). Our ¢nding was that increased numbers of microglia and interleukin-1L mRNA transcripts occurred 8 h after trauma, which may re£ect the early response. Thus, our results suggest that microglia might be another important factor in neuroimmune modulation of orphanin FQ.
NSC 5676 25-9-02
Within the CNS, interleukin-1L is not only created and released by various types of glia, but by neurons as well. In addition, OP4 mRNA transcripts were demonstrated to be expressed on neurons, astrocytes and microglia. Accordingly, it was necessary to examine the cellular actions of orphanin FQ on the three cell types. By RTPCR analysis, and site-directed mutant template as a reference quantitative, we observed that interleukin-1L gene expression occurs 30 min after lipopolysaccharide treatment, and was sustained up to 2 h. This is in agreement with other reports that when stimulated with endotoxin and other microbial products, interleukin-1L mRNA transcripts occurred rapidly, and the peak accumulation occurred around 3^4 h (Dinarello, 1991). In order to mimic in vivo experiments, responses were observed 2 h after treatment, and the cultured cells were exposed to 100 nM orphanin FQ, a concentration which has been described to inhibit cell activity through membrane hyperpolarization in current clamp (Mogil et al., 1996). As predicted, interleukin-1L gene expression induced by lipopolysaccharide was reduced by orphanin FQ in cultured microglia. In cultured astrocytes, it remained unchanged, which is in agreement with in vivo experiments. However, a con£icting result was obtained from cultured neurons. Here interleukin-1L gene expression was enhanced after treatment with orphanin FQ; this may shed some light on a possible interaction between neurons and microglia. A closer examination suggests that the astrocytic processes typically separate microglia from the adjacent neuronal membrane, whereas microglia have also been claimed to occupy a perineuronal position before astrocytic processes begin to extend along non-synaptic membrane ter-
Cyaan Magenta Geel Zwart
1030
H. Zhao et al.
ritory, and microglia appear to accumulate in the vicinity of postsynaptic structures. This structural arrangement raises intriguing questions about the neuronal ‘signal’ involved in microglia activation (Aldskogius and Kozlova, 1998). Consequently, one cannot exclude a direct inhibitory e¡ect on neurons by microglia in vivo, and when these synapses were disturbed, the genuine reaction was observed. There are numerous observations reporting that major histocompatibility complex class II molecules are associated with the CNS in normal and pathological conditions, and major histocompatibility complex class II expression is necessary for antigen presentation to CDþ 4 T cells. Microglia have long been considered intrinsic antigen-presenting cells of the brain. Several studies have addressed that microglia could release as well as respond to interleukin-1L, which is instrumental in recruitment of T cells into the lesion. The evidence presented in this study shows that microglia and interleukin1L were both under the regulation of orphanin FQ, which, considering the neuroimmune modulatory role of orphanin FQ, suggests that interleukin-1L mainly stemming from microglia might function as the mediator. However, since our data only re£ect the early stage of
response, the mechanism of neuroimmune function of orphanin FQ is still an open question.
CONCLUSION
In summary, the present study suggests that orphanin FQ shares a close relationship with interleukin-1L in the CNS. Overlap of orphanin FQ immunoreactive cells and interleukin-1L mRNA anti-digoxigenin immunopositive cells was found in the cerebral cortex, hippocampus and hypothalamus. Further it was identi¢ed that orphanin FQ had a regulatory e¡ect on interleukin-1L mRNA transcripts, which suggested that neuroimmune modulation of orphanin FQ might be dependent on interleukin1L in the CNS. Microglia also participated in mediating the function of orphanin FQ and provided the main cell source of interleukin-1L. Neurons may receive inhibitory synaptic potential input from microglia in vivo.
Acknowledgements/This project was supported by Grant 39870915, National Nature Science Foundation in China.
REFERENCES
Aldskogius, H., Kozlova, E.N., 1998. Central neuron-glial and glial-glial interactions following axon injury. Prog. Neurobiol. 55, 1^26. Anton, B., Fein, J., To, T., Li, X., Silberstein, L., Evans, C.J., 1996. Immunohistochemical localization of ORL-1 in the central nervous system of the rat. J. Comp. Neurobiol. 368, 229^251. Ban, E.M., Sarlieve, L.L., Haour, F.G., 1993. Interleukin-1 binding sites on astrocytes. Neuroscience 52, 725^733. Buzas, B., Rosenberger, J., Cox, B.M., 1998. Activity and cyclic AMP-dependent regulation of nociceptin/orphanin FQ gene expression in primary neuronal and astrocyte cultures. J. Neurochem. 71, 556^563. Calo’, G., Guerrini, R., Rizzi, A., Salvadori, S., Regoli, D., 2000. Pharmacology of nociceptin and its receptor : a novel therapeutic target. Br. J. Pharmacol. 129, 1261^1283. Dinarello, C.A., 1991. Interleukin-1 and interleukin-1 antagonism. Blood 77, 1627^1652. Du, L.N., Wu, G.C., Cao, X.D., 1998. Modulation of orphanin FQ or electroacupuncture on immune function of traumatic rats. Acupunct. Electrother. Res. Int. J. 23, 1^8. Giulian, D., Baker, T.J., Shih, L.C., Lachman, L.B., 1986. Interleukin-1 of the central nervous system is produced by ameboid microglia. J. Exp. Med. 164, 594^604. Halford, W.P., Gebhardt, B.M., Carr, D.J., 1995. Functional role and sequence analysis of a lymphocyte orphan opioid receptor. J. Neuroimmunol. 59, 91^101. Henderson, G., McKnight, A.T., 1997. The orphan opioid receptor and its endogenous ligand nociceptin/orphanin FQ. Trends Pharmacol. Sci. 18, 293^300. Ikeda, K., Watanabe, M., Ichikawa, T., Kobayashi, T., Yano, R., Kumanishi, T., 1998. Distribution of prepro-nociceptin/orphanin FQ mRNA and its receptor mRNA in developing and adult mouse central nervous systems. J. Comp. Neurobiol. 399, 139^151. Koster, A., Montkowski, A., Schulz, S., Stube, E.M., Knaudt, K., Jenck, F., Moreau, J.L., Nothacker, H.P., Civelli, O., Reinscheid, R.K., 1999. Targeted disruption of the orphanin FQ/nociceptin gene increases stress susceptibility and impairs stress adaptation in mice. Proc. Natl. Acad. Sci. USA 96, 10444^10449. Landis, D.M., 1994. The early reactions of non-neuronal cells to brain injury. Annu. Rev. Neurosci. 17, 133^151. Lu, L.M., Li, H.Y., Wang, R., Yao, T., 1997. Quantitative analysis of mRNA level by PCR method using single base-mutation template as inner standard. Acta Physiol. Sin. 49, 235^240. Meunier, J.C., 1997. Nociceptin/orphanin FQ and the opioid receptor-like ORL1 receptor. Eur. J Pharmacol. 340, 1^15. Meunier, J.C., Mollereau, C., Toll, L., Suandeau, C., Moisand, C., Alvinerie, P., Butour, J.L., Guillemot, J.C., Ferrara, P., Monsarrat, B., Mazarquil, H., Vassart, G., Parmentier, M., Costentin, J., 1995. Isolation and structure of the endogenous agonist of opioid receptor-like ORL-1 receptor. Nature 377, 532^535. Mogil, J.S., Grisel, J.E., Reinscheid, R.K., Civelli, O., Belknap, J.K., Grandy, D.K., 1996. Orphani FQ is a functional anti-opioid peptide. Neuroscience 75, 333^337. Mrak, R.E., Gri⁄n, W.S., 2000. Interleukin-1 and immunogenetics of Alzheimer disease. J. Neuropathol. Exp. Neurol. 59, 471^476. Peluso, J., Laforge, K.S., Matthes, H.W., Kreek, M.J., Kie¡er, B.L., Gaveriaux-Ru¡, C., 1998. Distribution of nociceptin/orphanin FQ receptor transcripts in human central nervous system and immune cells. J. Neuroimmunol. 81, 184^188. Reinscheid, R.K., Nothacker, H.P., Bourson, A., Ardati, A., Henningsen, R.A., Bunzow, J.R., Grandy, D.K., Langen, H., Monsma, F.J., Civelli, O., 1995. Orphanin FQ: a neuropeptide that activates an opioid like G-protein coupled receptor. Science 270, 792^794. Sheng, J.G., Mrak, R.E., Gri⁄n, W.S., 1998. Enlarged and phagocytic, but not primed, IL-1-K-immunoreactive microglia increase with age in normal human brain. Acta Neuropathol. 95, 229^234. Stoll, G., Jander, S., 1999. The role of microglia and macrophage in the pathophysiology of the CNS. Prog. Neurobiol. 58, 233^247.
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart
E¡ect of orphanin OFQ on interleukin-1L mRNA transcripts in the rat CNS
1031
Wang, A.J., Yang, Y.Z., Wu, Y.M., 1996. E¡ect of intrahippocampal microinjection of enkephalin on cellular immune function and brain IL-1K gene expression in rat. Acta Physiol. Sin. 48, 348^354. Wang, J., Lu, L.M., Du, L.N., Wu, G.C., Cao, X.D., 2001. In£uence of orphanin FQ on IL-1L mRNA gene expression in hippocampus of traumatic rats. Chin. J. Neurosci. 17, 368^372. Zhao, H., Du, L.N., Jiang, J.W., Wu, G.C., Cao, X.D., 2001. E¡ect of orphanin FQ on IL-1L mRNA transcripts in hippocampus. Acta Physiol. Sin. 53, 209^214. (Accepted 8 April 2002)
NSC 5676 25-9-02
Cyaan Magenta Geel Zwart