- Email: [email protected]
Effect of peptidoglycan amidase MSMEG_6281 on fatty acid metabolism in Mycobacterium smegmatis
Microbial Pathogenesis 140 (2020) 103939
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Effect of peptidoglycan amidase MSMEG_6281 on fatty acid metabolism in Mycobacterium smegmatis
T
Jiatong Miaoa,1, Hanrui Liua,1, Yushan Qub, Weizhe Fua, Kangwei Qia, Shizhu Zanga, Jiajia Hea, Shijia Zhaoa, Shixing Chenc, Tao Jianga,∗ a
Department of Biotechnology, Dalian Medical University, Dalian, 116044, China Business School, Rutgers, The State University of New Jersey, Piscataway, 08854, NJ, USA c Key Laboratory of Science and Technology on Microsystem, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Mycobacterium smegmatis PG amidase MSMEG_6281 Proteomes Fatty acid metabolism
Mycobacterium smegmatis MSMEG_6281, a peptidoglycan (PG) amidase, is essential in maintaining cell wall integrity. To address the potential roles during the MSMEG_6281-mediated biological process, we compared proteomes from wild-type M.smegmatis and MSMEG_6281 gene knockout strain (M.sm-ΔM_6281) using LC-MS/ MS analysis. Peptide analysis revealed that 851 proteins were differentially produced with at least 1.2-fold changes, including some proteins involved in fatty acid metabolism such as acyl-CoA synthase, acyl-CoA dehydrogenase, MCE-family proteins, ATP-binding cassette (ABC) transporters, and MmpL4. Some proteins related to fatty acid degradation were enriched through protein-protein interaction analysis. Therefore, proteomic data showed that a lack of MSMEG_6281 affected fatty acid metabolism. Mycobacteria can produce diverse lipid molecules ranging from single fatty acids to highly complex mycolic acids, and mycobacterial surface-exposed lipids may impact biofilm formation. In this study, we also assessed the effects of MSMEG_6281 on biofilm phenotype using semi-quantitative and morphology analysis methods. These results found that M.sm-ΔM_6281 exhibited a delayed biofilm phenotype compared to that of the wild-type M.smegmatis, and the changes were recovered when PG amidase was rescued in a ΔM_6281::Rv3717 strain. Our results demonstrated that MSMEG_6281 impacts fatty acid metabolism and further interferes with biofilm formation. These results provide a clue to study the effects of PG amidase on mycobacterial pathogenicity.
1. Introduction Tuberculosis (TB) is one of the most fatal infectious diseases with one or two million deaths recorded annually worldwide [1]. Mycobacterium tuberculosis (M.tb) is the known causative agent of TB. The specific pathogenesis of M.tb depends on unique cell wall structures including an inner plasma membrane and an outer cell wall, forming mycolyl-arabinogalactan-peptidoglycan (mAGP) complexes which play essential roles in M.tb survival [2]. Peptidoglycan (PG) is a major component of the mycobacterial cell wall, and PG amidases play important roles in maintaining cell wall permeability and antibiotic sensitivity [3–6]. M.tb Rv3717, as a kind of PG amidase, may control the balance between cell autolysis and cell wall biosynthesis [7–9]. In previous studies, we found that PG amidase not only regulated mycobacterial cell division and cell wall permeability, but also affected adherence and survival in host cells [9,10].
Sassetti CM et al. showed that a total of 194 genes were specifically required for mycobacterial growth in vivo, one of which is Rv3717 [11]. Rv3717 is considered a mycobacterial virulence factor and is associated with host-pathogen interaction. We also previously investigated the potential roles of Rv3717 in mycobacterial growth, division, and virulence, and generated a MSMEG_6281 gene (the ortholog gene of Rv3717) knockout strain using M.smegmatis mc2155 as surrogated strain. To address the potential roles of PG amidase in the biological process, we first compared proteomes from wild-type M.smegmatis and from the MSMEG_6281 gene knockout strain (M.sm-ΔM_6281) in this study and further assessed the changes of biofilm phenotype. The results demonstrated that a lack of MSMEG_6281 impacted fatty acid metabolism and exhibited a delayed biofilm phenotype. These results provide a clue to study the effects of PG amidase on mycobacterial pathogenicity.
∗
Corresponding author. E-mail address: [email protected] (T. Jiang). 1 The authors contributed equally to this work. https://doi.org/10.1016/j.micpath.2019.103939 Received 25 July 2019; Received in revised form 13 December 2019; Accepted 16 December 2019 Available online 20 December 2019 0882-4010/ © 2019 Published by Elsevier Ltd.
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
2. Materials and methods
Table 1 Sequences and conditions of the mentioned primers in this study.
2.1. Quantitative proteomic analysis through LC-MS/MS M.smegmatis MSMEG_6281 gene knockout strain, named M. smΔM_6281, was constructed and identified as mentioned in a previous paper [9]. Here, wild type M.smegmatis mc2155 and M. sm-ΔM_6281 were grown to logarithmic phase and then collected. The bacteria were sonicated on ice using a high intensity ultrasonic processor in a lysis buffer (8 M urea, 2 mM EDTA, 10 mM DTT, and 1% Protease Inhibitor Cocktail). The remaining debris was removed by centrifugation at 20,000 g at 4 °C for 10 min. The protein was precipitated with cold 15% TCA for 4 h at −20 °C. After centrifugation at 4°Cfor 3 min, the supernatant was discarded. The remaining precipitate was washed with cold acetone three times. The protein was re-dissolved in buffer (8 M urea, 100 mM TEAB, pH 8.0) and the protein concentration in the supernatant was determined with a 2-D Quant kit (GE Healthcare). 100 μg protein for each sample was digested with trypsin and desalted by Strata XC18 SPE column (Phenomenex, California, USA) and vacuumdried. Peptide was reconstituted in 1 M TEAB and processed according to the manufacturer's protocol for 6-plex TMT kit (Thermo Scientific, Massachusetts, USA), and then fractionated by high pH reverse-phase HPLC using Agilent 300Extend C18 column (5 μm particles, 4.6 mm ID, 250 mm length). The peptides were combined into 18 fractions and dried by vacuum centrifuging, dissolved in 0.1% FA, and directly loaded onto a reversed-phase pre-column (Acclaim PepMap 100, Thermo Scientific, Bremen, Germany). Peptide separation was performed using a reversed-phase analytical column (Acclaim PepMap RSLC, ThermoScientific, Bremen, Germany). The gradient was comprised of an increase from 7% to 25% solvent B (0.1% FA in 98% ACN) over 24 min, 25%–40% in 8 min, and climbing to 80% in 4 min, then holding at 80% for the last 4 min, all at a constant flow rate of 350 nl/ min on an EASY-nLC 1000 UPLC system. The peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Q ExactiveTM (Thermo Scientific, Bremen, Germany) coupled online to the UPLC. Intact peptides were detected in the orbitrap at a resolution of 70,000. Peptides were selected for MS/ MS using a NCE setting of 28; ion fragments were detected in the Orbitrap at a resolution of 17,500. A data-dependent procedure that alternated between one MS scan followed by 20 MS/MS scans was applied for the top 20 precursor ions above a threshold ion count of 1E4 in the MS survey scan with 30.0s dynamic exclusion. The electrospray voltage applied was 2.0 kV. Automatic gain control was used to prevent overfilling of the Orbitrap; 5E4 ions were accumulated for generation of the MS/MS spectra. For MS scans, the m/z scan range was 350–1800. Fixed first mass was set as 100 m/z.
Genes
primer sequence(5'- 3')
Annealing temperature(°C)
Product size (bp)
fadD32
ctcgacaactgccacccgtc ccggggtcatgaaggtgaagtag gtacgacgtgtccagcctcaag cccgagatgatcatgtggtgcc gatgatgcacctgttcaccacgg ggtagagcacggtcggaacac gtcgatccggagaaggccaagac gatgaagcggatgatcgactcgg atgccagaacgcacgccgga tgacgcaccaacggtcacc agttacctgcactcgttgaacac cgtctcggtcatgccccaag gtcaccccggagaagtcgttc ctggtctgccgcgaacttctc gaggagatcaccgacaccgc cggactccgcattctggaagc gactgacaatccggccgacac gaccgacccgatgaagatgatgc ctgggagcagttcgacgcac ttgcgcggacaggttctcg catctgcggtggtgtcgagac cgttgacgtggtcgatgtccg atgtgtccaagggcatccacatc cgtcgggtccttcatgttccag gcacgccatcgtgtcgatccac gattgagcccgccctgcccg ctgccaggccagcggaacgt agttgacgtggaatccgcgg ggaaagctgtggcgtgatgg gtaggccatgaggtccacca
58
394
58
417
57.5
137
58
312
58
274
56
393
57
219
52
646
58
439
58
373
57.5
335
58
365
60
191
60
256
60
393
fadD4 MSMEG_0131 MSMEG_2201 MSMEG_2446 MSMEG_5291 acpM fabD fabG mmaA1 kasB inhA MSMEG_6281 Rv3717 gap
UniProt-GOA database (http://www.ebi.ac.uk/GOA/). Proteins were classified by Gene Ontology annotation based on three categories: biological process, cellular component, and molecular function. For each category, a two-tailed Fisher's exact test was employed to test the enrichment of the differentially expressed protein against all identified proteins. Kyoto Encyclopedia of Genes and Genomes (KEGG) database was used to identify enriched pathways which were classified into hierarchical categories. The enrichments with a corrected p-value < 0.05 were considered significant. All differentially expressed proteins were searched against the STRING database version 10.5 for protein-protein interactions (PPI). Only interactions between the proteins belonging to the searched data set were selected, thereby excluding external candidates. STRING uses a metric called “confidence score” to define interaction confidence; we noted all interactions that had a confidence score ≥0.9.
2.2. Data search and validation 2.4. Quantitative detection to determine the differences of gene expression The resulting MS/MS data was processed using MaxQuant with an integrated Andromeda search engine (version.1.5.2.8). Tandem mass spectra were searched against the uniprot M.smegmatis (ATCC 700084) database. Trypsin (Promega, Wisconsin, USA) was specified as a cleavage enzyme allowing up to 2 missing cleavages. Mass error was set to 10 ppm for precursor ions and 0.02 Da for fragment ions. Carbamidomethyl on Cys was specified as fixed modification, and oxidation on Met and acetylation on protein N-term was specified as variable modification. For the protein quantification method, TMT 6plex was selected in Mascot. FDR was adjusted to < 1% at protein, peptide, and PSM level. Proteins that varied by 1.2-fold in the average abundances were retained.
We picked up some genes related to fatty acid metabolism, and further detected their expression changes through RT-PCR. The corresponding primer sequences were listed in Table 1. In brief, M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 cells were cultured to logarithmic stages at 30 °C and then collected bacteria to extract RNA using Trizol regent (Sangon Tech., Shanghai, China), removing DNA using DNaseІ (3 μg/ml). 1 μg RNA was first reversed into cDNA using RT kit (TaKaRa, Japan) and then PCR was performed by corresponding cDNA as template; the ratio of the objected gene to internal control gene (gap) was used to assess the differences in gene expression levels. ΔM_6281::Rv3717, a complemented strain containing the rescue plasmid pCG76_ Phsp60_Rv3717, was constructed as mentioned in a previous paper [9]. To determine the expression level of Rv3717, the Stratagene Mx3005P QPCR System (Agilent, California, USA) was used for quantitative real time polymerase chain reaction (Q-PCR). 100 ng RNA was first reversed into cDNA using RT kit (TaKaRa, Japan), and
2.3. Functional classification, enrichment and protein-protein interactions analysis Gene Ontology (GO) annotation proteome was derived from the 2
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 1. Functional classification of the differentially expressed proteins. (A) biological process; (B) cellular component; (C) molecular function; (D) Functional protein groups were established according to the classification, and the identified proteins were showed as increased (fold change > 1.2,p < 0.01), decreased (fold change < 1/1.2, p < 0.01) or unchanged proteins (M sm-ΔM_6281 vs M.smegmatis).
Fig. 2. Functional enrichment analysis of differentially expressed proteins.
3
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 3. KEGG pathway-base enrichment analysis. (A) KEGG pathway-based enrichment analysis of up-regulated proteins; (B) KEGG pathway-based enrichment analysis of down-regulated proteins.
then cDNA was a series of diluted from 101 to 104 fold to make standard curves. Each PCR reaction was performed using responding primers for gap, MSMEG_6281, and Rv3717 (Table 1) through TransStart Top Green Q-PCR Super Mix kit (TransGen Biotech). The relative gene expression for M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 strains was determined on the base of the corresponding standard curve. The data was analyzed and assessed for the differences in gene expressions of M. sm-ΔM_6281 and ΔM_6281::Rv3717 strains compared to wild type M.smegmatis. The data were presented as the mean ± standard error (SEM). All data about gene expression and biofilm analysis was plotted and analyzed using GraphPad Prism5 (GraphPad software). p < 0.05 is considered statistically significant according to t-test.
90 × 15 mm2 polystyrene was inoculated with 1 ml saturated culture and incubated at 30 °C for 5 d. Moreover, morphology of biofilm was determined by scan electron microscope (SEM) [13]. First, the coupons made from silicone were prepared for sterilization. The coupons treated were plated in the bottom of a distilled 12-well plate which was inoculated with 100 μl saturated culture in 2 ml M63 medium in each well and incubated at 30°Cfor 5 d. After the silicone coupons were washed using PBS to remove the medium, they were fixed by 2.5% glutaraldehyde solution for overnight at 4 °C. The samples were exposed to a series ethanol dehydration to make gold-thin film for SEM [14]. The images from three independent coupons were analyzed.
2.5. Quantitative analysis biofilm formation
3.1. MSMEG_6281-mediated potential biological process
3. Results
M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 cells were cultured to about OD600 = 1. The cultures were centrifuged at 4500 rpm for 10 min, and the precipitated bacteria were collected and diluted by 100 times using M63 medium to create cell suspension [12]. Each well of sterile polyvinylchloride flat-bottomed 96-well plates was filled with 150 μl of cell suspension. To promote biofilm formation, the plates were incubated at 30°Cfor 6 d. During the growth of biofilm, one group was separated every 24 h, removing generally the medium and washed three times with PBS buffer, then stained by 150 μl 0.01% crystal violet for 15 min, and then 95% ethanol was added to dissolve them after washing using PBS. The absorbance was measured at 589 nm.
To address the potential roles during the MSMEG_6281-mediated biological process, the total proteins from M.smegmatis mc2155 and M.sm-ΔM_6281were digested into peptides and labelled by TMT6-plex, separated by HPLC, and then we applied mass spectrometry analysis. 4383 proteins were identified, among which 4,197 proteins could be quantified. The data showed that 407 proteins were up-regulated and 444 proteins were down-regulated when quantitative ratios were above 1.2 or below 1/1.2, respectively. 64 proteins were up-regulated by 2fold and 70 proteins were down-regulated by 0.5 (Supplemental Table 1). These differentially expressed proteins are classified by functional category according to biological process, cellular component, and molecular function. The majority of those in the biological process category represent metabolic process, single-organism, and cellular process; ones related to molecular function display catalytic and binding activity; and those in the cellular component category are more
2.6. Morphology analysis of biofilm To observe biofilm formation, 20 ml M63 medium in a 4
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 4. Protein-protein interaction networks analysis. (A) Ribosome networks from PPIs analysis; (B) ABC transporters network from PPIs analysis; (C) fatty acid degradation analysis.
3.3. The expression changes of genes related to fatty acid metabolism due to lack of MSMEG_6281
distributed in macromolecular complex and cell membrane (Fig. 1A–C). To further understand the proportion of the changed expression in total proteins quantified, the proteins data was further divided into unchanged, up-regulated, and down-regulated proteins (Fig. 1-D). 32.6% of proteins related to metabolic process, 31.5% of catalytic proteins, and 29.6% of proteins related binding activity were expressed differentially. The majority of up-regulated and down-regulated proteins are distributed in the metabolism process, catalytic, and binding activities.
Mycolic acids (MAs), a distinct class of long-chain fatty acids, are distributed to the outer sides of the mycobacterial cell wall. We selected genes related to fatty acid degradation from PPI analysis in order to confirm the expression changes of genes due to a lack of MSMEG_6281. The genes are potentially involved in fatty acid degradation, including fatty acid degradation protein D32 (fadD32), FadD4; AMP-binding enzyme (MSMEG_0131); dehydradase MSMEG_2201, MSMEG_2446; and acyl-CoA synthase MSMEG_5291. RT-PCR results revealed fadD32 was up-regulated, while MSMEG_0131, MSMEG_2201, and MSMEG_2446 were significantly down-regulated (Fig. 5-A). The changes were consistent with LC-MS/MS data. In addition, the gene expression changes were recovered in a complemented strain. We investigated several genes that are essential for MAs biosynthesis which are not identified by LC-MS/MS such as AcpM, FabD, FabG, KasB, and InhA. The results showed that fabD, kasB, and inhA were significantly up-regulated, and fabG was down-regulated in M. sm-ΔM_6281. The changes were also recovered in the ΔM_6281::Rv3717 strain (Fig. 5-B). Thus, the results demonstrated that some of the genes related to fatty acid metabolism were significantly altered due to a lack of MSMEG_6281. We quantified the gene expression of the PG amidase using Q-PCR analysis. The results showed that the relative gene expression in ΔM_6281::Rv3717 was up-regulated significantly 1.46-folds compared to M.smegmatis; M. sm-ΔM_6281was down-regulated 0.4-folds, which is consistent with LC-MS/MS data (the ratio of M. sm-ΔM_6281 to M.smegmatis is 0.12 as showed in Supplemental Table 1) (Fig. 5-C).
3.2. Enrichment data analysis of the differently expressed proteins To search significant enrichment of the differently expressed proteins, GO-based enrichment analysis was performed. 1100 changed proteins had matched in GO, and the significant changes (p < 0.05) in GO categories between M. sm-ΔM_6281 and M.smegmatis were classified and listed in Fig. 2. The proteins related to oxidoreductase, transporter, and O-acyltransferase activities were down-regulated, and structural constituents of ribosome were up-regulated in the M. sm-ΔM_6281 strain. KEGG pathway-based enrichment showed that the most interesting of the down-regulated pathways was ATP-binding cassette (ABC) transporters, which was consisted of ATP-binding protein SugC, MCEfamily protein mce1C, 2D, 4C, 4F, and LprK (Fig. 3). Saccharine and lipid transporters, which might be related to antibiotic resistance of M.tb, were down-regulated. According to protein-protein interactions (PPIs) analysis, we found that the significant proteins constituted three important pathways: ribosome, ABC transporter, and fatty acid degradation (Fig. 4).
5
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 5. The relative expression analysis of genes in M.smegmatis, M sm-ΔM_6281, and ΔM_6281::Rv3717 strains. (A-B) RT-PCR analysis exhibited the relative gene expressions of candidate genes related fatty acid metabolism. PCR products were identified by 1% agrose gel electrophoresis, and the size of the bands was consistence with the length of corresponding PCR product, “M” represents 250 bp DNA ladder, and gap was regarded as internal control. Relative expression analysis of the genes and gap was performed by Quantity One, n = 3. p < 0.05 was considered statistical significant: *p < 0.05, **p < 0.01.(C) Relative gene expression of M sm-ΔM_6281and ΔM_6281::Rv3717 compared to M.smegmatis was identified through Q-PCR.
of biofilm was performed at different time intervals. The results found that biofilm did not appear in the first two days in all experimental strains. Biofilm along the well wall was exhibited clearly at day 3, and gradually increased until day 6 (Fig. 6-A). Quantitative results showed
3.4. Quantitative and morphology analysis of biofilm To explore the difference of biofilm formation among M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 strains, a quantitative analysis
6
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 6. Analysis of biofilm formation of M.smegmatis, M sm-ΔM_6281, and ΔM_6281::Rv3717 strains. (A) Detecting biofilm formation via crystalline violet staining; (B) Quantitative analysis of biofilm formation, n = 3. p < 0.05 was considered statistical significant: *p < 0.05, **p < 0.01. (C) Dishes containing M63 liquid medium were inoculated at day 5 during biofilm growth; (D) Scan electron microscopy analysis at day 5 during biofilm growth (×10000), bars = 1 μm.
less number of adhered cells arranged in the separating form for M. smΔM_6281, while there were more number of adhered cells for wild-type M.smegmatis, and some extracellular matrix secretions as well as cells aggregates (Fig. 6-D). The ΔM_6281::Rv3717 strain showed higher cell aggregates and extracellular matrix secretions compared to M.smegmatis, which might result from the over-expression of Rv3717 in the ΔM_6281::Rv3717 complemented strain and needs further investigation.
that the intensity of M. sm-ΔM_6281 was about 70.7% of M.smegmatis and 69.2% of ΔM_6281::Rv3717 at day 5 (Fig. 6-B). Thus, our results indicated that the capability of biofilm formation was retarded in the M. sm-ΔM_6281 strain. We also observed that biofilm formation on plates for M. smΔM_6281 is likely to be less compared to the other strains at day 5 (Fig. 6-C). SEM was considered to be a more suitable tool to observe the morphology of biofilm, thus we further investigated the biofilm on silicone coupons using SEM. Our results demonstrated that there were 7
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
4. Discussion
References
M.tb Rv3717, a PG amidase, is involved in PG degradation and plays a role in maintaining cell wall integrity and permeability [7–9]. In the present study, we performed comparative proteomic analysis between M.sm-ΔM_6281 and wild type M.smegmatis strain through the LC-MS/ MS method. The results exhibited that 134 proteins were up or downregulated over 2-folds. According to PPIs analysis, we found that the significant proteins constituted three important pathways: ribosome, ABC transporter, and fatty acid degradation. Intriguingly, we noted that the most obvious changes of proteins were related to fatty acid metabolism. In fact, there are about 250 distinct enzymes involved in fatty acid metabolism in M.tb compared with 50 genes in E.coli [15]. Under the enzymes’ action, mycobacteria produce diverse lipids including single fatty acids and long-chain mycolic acids (MAs) [12,16]. In vivo-grown mycobacteria depend on lipids as a carbon source for mycobacterial survival through fatty acid β-oxidation systems which contain 36 acylCoA synthase, 21 acyl-CoA dehydrogenase, and 3-hydroxy dehydrogenase [15,17]. MAs are the major lipids of a protective layer of cell wall, serving as structural units of the cell envelope [18–20]. During M.tb infection, these internalized C16/C18 fatty acids could enter the FAS- ІІ system to be used for MAs biosynthesis [19]. In this study, we confirmed the expression changes of some genes involved in fatty acid degradation and MAs biosynthesis due to lack of MSMEG_6281, such as fadD32, FadD4, AMP-binding enzyme (MSMEG_0131), dehydradase MSMEG_2201, MSMEG_2446, fabD, kasB and inhA. But, we did not find an obvious difference in the composition and structure of MAs under planktonic condition through TLC analysis. MAs are not only covalently bound to the arabinogalactan layer but also freely presented in outer-sides released by cell wall glycolipids, such as trehalose monomycolate (TMM) and trehalosedimycolate (TDM) [21,22]. Ojha A.K et al. demonstrated that the short chain free MAs may be critical to biofilm formation [23]. FAS-І and FAS-ІІ systems of M.smegmatis were shown to be similar to those of M.tb, and so M.smegmatis was often used as a model organism to study mycobacterial biofilm formation [19,24,25]. Our results revealed a delayed biofilm formation due to a lack of MSMEG_6281, while biofilm phenotype was recovered in a complemented strain. Combining the above results, we suggest that PG amidase MSMEG_6281 may impact fatty acid metabolism and biofilm formation. However, how PG amidase affects biofilm formation remains to be further explored.
[1] Organization, WH. Global Tuberculosis Report, (2019) 2019. [2] C.E. Barry, D.C. Crick, M.R. McNeil, Targeting the formation of the cell wall core of M. tuberculosis, Infect. Disord. Drug Targets 7 (2007) 182–202. [3] G. Torrens, M. Perez-Gallego, B. Moya, M. Munar-Bestard, L. Zamorano, G. Cabot, et al., Targeting the permeability barrier and peptidoglycan recycling pathways to disarm Pseudomonas aeruginosa against the innate immune system, PLoS One 12 (2017) e0181932. [4] M.J. Nasiri, M. Haeili, M. Ghazi, H. Goudarzi, A. Pormohammad, A.A. Imani Fooladi, et al., New insights in to the intrinsic and acquired drug resistance mechanisms in mycobacteria, Front. Microbiol. 8 (2017) 681. [5] D.L. Garcia, J.P. Dillard, AmiC functions as an N-acetylmuramyl-l-alanine amidase necessary for cell separation and can promote autolysis in Neisseria gonorrhoeae, J. Bacteriol. 188 (2006) 7211–7221. [6] C.C. Boutte, C.E. Baer, K. Papavinasasundaram, W. Liu, M.R. Chase, X. Meniche, et al., A cytoplasmic peptidoglycan amidase homologue controls mycobacterial cell wall synthesis, eLife 5 (2016). [7] S. Senzani, D. Li, A. Bhaskar, C. Ealand, J. Chang, B. Rimal, et al., An Amidase_3 domain-containing N-acetylmuramyl-L-alanine amidase is required for mycobacterial cell division, Sci. Rep. 7 (2017) 1140. [8] A. Kumar, S. Kumar, D. Kumar, A. Mishra, R.P. Dewangan, P. Shrivastava, et al., The structure of Rv3717 reveals a novel amidase from Mycobacterium tuberculosis, Acta Crystallogr. Sect. D Biol. Crystallogr. 69 (2013) 2543–2554. [9] J. He, W. Fu, S. Zhao, C. Zhang, T. Sun, T. Jiang, Lack of MSMEG_6281, a peptidoglycan amidase, affects cell wall integrity and virulence of Mycobacterium smegmatis, Microb. Pathog. 128 (2019) 405–413. [10] X. Li, J. He, W. Fu, P. Cao, S. Zhang, T. Jiang, Effect of Mycobacterium tuberculosis Rv3717 on cell division and cell adhesion, Microb. Pathog. 117 (2018) 184–190. [11] C.M. Sassetti, E.J. Rubin, Genetic requirements for mycobacterial survival during infection, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 12989–12994. [12] J. Recht, R. Kolter, Glycopeptidolipid acetylation affects sliding motility and biofilm formation in Mycobacterium smegmatis, J. Bacteriol. 183 (2001) 5718–5724. [13] C.W. Wu, S.K. Schmoller, J.P. Bannantine, T.M. Eckstein, J.M. Inamine, M. Livesey, et al., A novel cell wall lipopeptide is important for biofilm formation and pathogenicity of Mycobacterium avium subspecies paratuberculosis, Microb. Pathog. 46 (2009) 222–230. [14] L.C. Gomes, F.J. Mergulhao, SEM analysis of surface impact on biofilm antibiotic treatment, Scanning 2017 (2017) 2960194. [15] S.T. Cole, R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, et al., Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence, Nature 393 (1998) 537–544. [16] K.Y. Dunphy, R.H. Senaratne, M. Masuzawa, L.V. Kendall, L.W. Riley, Attenuation of Mycobacterium tuberculosis functionally disrupted in a fatty acyl-coenzyme A synthetase gene fadD5, J. Infect. Dis. 201 (2010) 1232–1239. [17] M. Jain, C.J. Petzold, M.W. Schelle, M.D. Leavell, J.D. Mougous, C.R. Bertozzi, et al., Lipidomics reveals control of Mycobacterium tuberculosis virulence lipids via metabolic coupling, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 5133–5138. [18] Y. Yuan, D. Mead, B.G. Schroeder, Y. Zhu, C.E. Barry 3rd, The biosynthesis of mycolic acids in Mycobacterium tuberculosis. Enzymatic methyl(ene) transfer to acyl carrier protein bound meromycolic acid in vitro, J. Biol. Chem. 273 (1998) 21282–21290. [19] K. Takayama, C. Wang, G.S. Besra, Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis, Clin. Microbiol. Rev. 18 (2005) 81–101. [20] A. Queiroz, L.W. Riley, Bacterial immunostat: Mycobacterium tuberculosis lipids and their role in the host immune response, Rev. Soc. Bras. Med. Trop. 50 (2017) 9–18. [21] C.C. Wright, F.F. Hsu, E. Arnett, J.L. Dunaj, P.M. Davidson, S.A. Pacheco, et al., The Mycobacterium tuberculosis MmpL11 cell wall lipid transporter is important for biofilm formation, intracellular growth, and nonreplicating persistence, Infect. Immun. 85 (2017). [22] E. Rafidinarivo, M.A. Laneelle, H. Montrozier, P. Valero-Guillen, J. Astola, M. Luquin, et al., Trafficking pathways of mycolic acids: structures, origin, mechanism of formation, and storage form of mycobacteric acids, J. Lipid Res. 50 (2009) 477–490. [23] A.K. Ojha, X. Trivelli, Y. Guerardel, L. Kremer, G.F. Hatfull, Enzymatic hydrolysis of trehalose dimycolate releases free mycolic acids during mycobacterial growth in biofilms, J. Biol. Chem. 285 (2010) 17380–17389. [24] P. Chakraborty, A. Kumar, The extracellular matrix of mycobacterial biofilms: could we shorten the treatment of mycobacterial infections? Microb. Cell 6 (2019) 105–122. [25] J. Recht, A. Martinez, S. Torello, R. Kolter, Genetic analysis of sliding motility in Mycobacterium smegmatis, J. Bacteriol. 182 (2000) 4348–4351.
Acknowledgements This study was financially supported by grants from National Natural Science Foundation of China (31300672, 31900937), Liaoning Province Natural Science Foundation of China (20180550231) and Young Scholar Support Project sponsored by the college of basic medical science of Dalian Medical University.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2019.103939.
8
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Effect of peptidoglycan amidase MSMEG_6281 on fatty acid metabolism in Mycobacterium smegmatis
T
Jiatong Miaoa,1, Hanrui Liua,1, Yushan Qub, Weizhe Fua, Kangwei Qia, Shizhu Zanga, Jiajia Hea, Shijia Zhaoa, Shixing Chenc, Tao Jianga,∗ a
Department of Biotechnology, Dalian Medical University, Dalian, 116044, China Business School, Rutgers, The State University of New Jersey, Piscataway, 08854, NJ, USA c Key Laboratory of Science and Technology on Microsystem, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Mycobacterium smegmatis PG amidase MSMEG_6281 Proteomes Fatty acid metabolism
Mycobacterium smegmatis MSMEG_6281, a peptidoglycan (PG) amidase, is essential in maintaining cell wall integrity. To address the potential roles during the MSMEG_6281-mediated biological process, we compared proteomes from wild-type M.smegmatis and MSMEG_6281 gene knockout strain (M.sm-ΔM_6281) using LC-MS/ MS analysis. Peptide analysis revealed that 851 proteins were differentially produced with at least 1.2-fold changes, including some proteins involved in fatty acid metabolism such as acyl-CoA synthase, acyl-CoA dehydrogenase, MCE-family proteins, ATP-binding cassette (ABC) transporters, and MmpL4. Some proteins related to fatty acid degradation were enriched through protein-protein interaction analysis. Therefore, proteomic data showed that a lack of MSMEG_6281 affected fatty acid metabolism. Mycobacteria can produce diverse lipid molecules ranging from single fatty acids to highly complex mycolic acids, and mycobacterial surface-exposed lipids may impact biofilm formation. In this study, we also assessed the effects of MSMEG_6281 on biofilm phenotype using semi-quantitative and morphology analysis methods. These results found that M.sm-ΔM_6281 exhibited a delayed biofilm phenotype compared to that of the wild-type M.smegmatis, and the changes were recovered when PG amidase was rescued in a ΔM_6281::Rv3717 strain. Our results demonstrated that MSMEG_6281 impacts fatty acid metabolism and further interferes with biofilm formation. These results provide a clue to study the effects of PG amidase on mycobacterial pathogenicity.
1. Introduction Tuberculosis (TB) is one of the most fatal infectious diseases with one or two million deaths recorded annually worldwide [1]. Mycobacterium tuberculosis (M.tb) is the known causative agent of TB. The specific pathogenesis of M.tb depends on unique cell wall structures including an inner plasma membrane and an outer cell wall, forming mycolyl-arabinogalactan-peptidoglycan (mAGP) complexes which play essential roles in M.tb survival [2]. Peptidoglycan (PG) is a major component of the mycobacterial cell wall, and PG amidases play important roles in maintaining cell wall permeability and antibiotic sensitivity [3–6]. M.tb Rv3717, as a kind of PG amidase, may control the balance between cell autolysis and cell wall biosynthesis [7–9]. In previous studies, we found that PG amidase not only regulated mycobacterial cell division and cell wall permeability, but also affected adherence and survival in host cells [9,10].
Sassetti CM et al. showed that a total of 194 genes were specifically required for mycobacterial growth in vivo, one of which is Rv3717 [11]. Rv3717 is considered a mycobacterial virulence factor and is associated with host-pathogen interaction. We also previously investigated the potential roles of Rv3717 in mycobacterial growth, division, and virulence, and generated a MSMEG_6281 gene (the ortholog gene of Rv3717) knockout strain using M.smegmatis mc2155 as surrogated strain. To address the potential roles of PG amidase in the biological process, we first compared proteomes from wild-type M.smegmatis and from the MSMEG_6281 gene knockout strain (M.sm-ΔM_6281) in this study and further assessed the changes of biofilm phenotype. The results demonstrated that a lack of MSMEG_6281 impacted fatty acid metabolism and exhibited a delayed biofilm phenotype. These results provide a clue to study the effects of PG amidase on mycobacterial pathogenicity.
∗
Corresponding author. E-mail address: [email protected] (T. Jiang). 1 The authors contributed equally to this work. https://doi.org/10.1016/j.micpath.2019.103939 Received 25 July 2019; Received in revised form 13 December 2019; Accepted 16 December 2019 Available online 20 December 2019 0882-4010/ © 2019 Published by Elsevier Ltd.
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
2. Materials and methods
Table 1 Sequences and conditions of the mentioned primers in this study.
2.1. Quantitative proteomic analysis through LC-MS/MS M.smegmatis MSMEG_6281 gene knockout strain, named M. smΔM_6281, was constructed and identified as mentioned in a previous paper [9]. Here, wild type M.smegmatis mc2155 and M. sm-ΔM_6281 were grown to logarithmic phase and then collected. The bacteria were sonicated on ice using a high intensity ultrasonic processor in a lysis buffer (8 M urea, 2 mM EDTA, 10 mM DTT, and 1% Protease Inhibitor Cocktail). The remaining debris was removed by centrifugation at 20,000 g at 4 °C for 10 min. The protein was precipitated with cold 15% TCA for 4 h at −20 °C. After centrifugation at 4°Cfor 3 min, the supernatant was discarded. The remaining precipitate was washed with cold acetone three times. The protein was re-dissolved in buffer (8 M urea, 100 mM TEAB, pH 8.0) and the protein concentration in the supernatant was determined with a 2-D Quant kit (GE Healthcare). 100 μg protein for each sample was digested with trypsin and desalted by Strata XC18 SPE column (Phenomenex, California, USA) and vacuumdried. Peptide was reconstituted in 1 M TEAB and processed according to the manufacturer's protocol for 6-plex TMT kit (Thermo Scientific, Massachusetts, USA), and then fractionated by high pH reverse-phase HPLC using Agilent 300Extend C18 column (5 μm particles, 4.6 mm ID, 250 mm length). The peptides were combined into 18 fractions and dried by vacuum centrifuging, dissolved in 0.1% FA, and directly loaded onto a reversed-phase pre-column (Acclaim PepMap 100, Thermo Scientific, Bremen, Germany). Peptide separation was performed using a reversed-phase analytical column (Acclaim PepMap RSLC, ThermoScientific, Bremen, Germany). The gradient was comprised of an increase from 7% to 25% solvent B (0.1% FA in 98% ACN) over 24 min, 25%–40% in 8 min, and climbing to 80% in 4 min, then holding at 80% for the last 4 min, all at a constant flow rate of 350 nl/ min on an EASY-nLC 1000 UPLC system. The peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Q ExactiveTM (Thermo Scientific, Bremen, Germany) coupled online to the UPLC. Intact peptides were detected in the orbitrap at a resolution of 70,000. Peptides were selected for MS/ MS using a NCE setting of 28; ion fragments were detected in the Orbitrap at a resolution of 17,500. A data-dependent procedure that alternated between one MS scan followed by 20 MS/MS scans was applied for the top 20 precursor ions above a threshold ion count of 1E4 in the MS survey scan with 30.0s dynamic exclusion. The electrospray voltage applied was 2.0 kV. Automatic gain control was used to prevent overfilling of the Orbitrap; 5E4 ions were accumulated for generation of the MS/MS spectra. For MS scans, the m/z scan range was 350–1800. Fixed first mass was set as 100 m/z.
Genes
primer sequence(5'- 3')
Annealing temperature(°C)
Product size (bp)
fadD32
ctcgacaactgccacccgtc ccggggtcatgaaggtgaagtag gtacgacgtgtccagcctcaag cccgagatgatcatgtggtgcc gatgatgcacctgttcaccacgg ggtagagcacggtcggaacac gtcgatccggagaaggccaagac gatgaagcggatgatcgactcgg atgccagaacgcacgccgga tgacgcaccaacggtcacc agttacctgcactcgttgaacac cgtctcggtcatgccccaag gtcaccccggagaagtcgttc ctggtctgccgcgaacttctc gaggagatcaccgacaccgc cggactccgcattctggaagc gactgacaatccggccgacac gaccgacccgatgaagatgatgc ctgggagcagttcgacgcac ttgcgcggacaggttctcg catctgcggtggtgtcgagac cgttgacgtggtcgatgtccg atgtgtccaagggcatccacatc cgtcgggtccttcatgttccag gcacgccatcgtgtcgatccac gattgagcccgccctgcccg ctgccaggccagcggaacgt agttgacgtggaatccgcgg ggaaagctgtggcgtgatgg gtaggccatgaggtccacca
58
394
58
417
57.5
137
58
312
58
274
56
393
57
219
52
646
58
439
58
373
57.5
335
58
365
60
191
60
256
60
393
fadD4 MSMEG_0131 MSMEG_2201 MSMEG_2446 MSMEG_5291 acpM fabD fabG mmaA1 kasB inhA MSMEG_6281 Rv3717 gap
UniProt-GOA database (http://www.ebi.ac.uk/GOA/). Proteins were classified by Gene Ontology annotation based on three categories: biological process, cellular component, and molecular function. For each category, a two-tailed Fisher's exact test was employed to test the enrichment of the differentially expressed protein against all identified proteins. Kyoto Encyclopedia of Genes and Genomes (KEGG) database was used to identify enriched pathways which were classified into hierarchical categories. The enrichments with a corrected p-value < 0.05 were considered significant. All differentially expressed proteins were searched against the STRING database version 10.5 for protein-protein interactions (PPI). Only interactions between the proteins belonging to the searched data set were selected, thereby excluding external candidates. STRING uses a metric called “confidence score” to define interaction confidence; we noted all interactions that had a confidence score ≥0.9.
2.2. Data search and validation 2.4. Quantitative detection to determine the differences of gene expression The resulting MS/MS data was processed using MaxQuant with an integrated Andromeda search engine (version.1.5.2.8). Tandem mass spectra were searched against the uniprot M.smegmatis (ATCC 700084) database. Trypsin (Promega, Wisconsin, USA) was specified as a cleavage enzyme allowing up to 2 missing cleavages. Mass error was set to 10 ppm for precursor ions and 0.02 Da for fragment ions. Carbamidomethyl on Cys was specified as fixed modification, and oxidation on Met and acetylation on protein N-term was specified as variable modification. For the protein quantification method, TMT 6plex was selected in Mascot. FDR was adjusted to < 1% at protein, peptide, and PSM level. Proteins that varied by 1.2-fold in the average abundances were retained.
We picked up some genes related to fatty acid metabolism, and further detected their expression changes through RT-PCR. The corresponding primer sequences were listed in Table 1. In brief, M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 cells were cultured to logarithmic stages at 30 °C and then collected bacteria to extract RNA using Trizol regent (Sangon Tech., Shanghai, China), removing DNA using DNaseІ (3 μg/ml). 1 μg RNA was first reversed into cDNA using RT kit (TaKaRa, Japan) and then PCR was performed by corresponding cDNA as template; the ratio of the objected gene to internal control gene (gap) was used to assess the differences in gene expression levels. ΔM_6281::Rv3717, a complemented strain containing the rescue plasmid pCG76_ Phsp60_Rv3717, was constructed as mentioned in a previous paper [9]. To determine the expression level of Rv3717, the Stratagene Mx3005P QPCR System (Agilent, California, USA) was used for quantitative real time polymerase chain reaction (Q-PCR). 100 ng RNA was first reversed into cDNA using RT kit (TaKaRa, Japan), and
2.3. Functional classification, enrichment and protein-protein interactions analysis Gene Ontology (GO) annotation proteome was derived from the 2
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 1. Functional classification of the differentially expressed proteins. (A) biological process; (B) cellular component; (C) molecular function; (D) Functional protein groups were established according to the classification, and the identified proteins were showed as increased (fold change > 1.2,p < 0.01), decreased (fold change < 1/1.2, p < 0.01) or unchanged proteins (M sm-ΔM_6281 vs M.smegmatis).
Fig. 2. Functional enrichment analysis of differentially expressed proteins.
3
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 3. KEGG pathway-base enrichment analysis. (A) KEGG pathway-based enrichment analysis of up-regulated proteins; (B) KEGG pathway-based enrichment analysis of down-regulated proteins.
then cDNA was a series of diluted from 101 to 104 fold to make standard curves. Each PCR reaction was performed using responding primers for gap, MSMEG_6281, and Rv3717 (Table 1) through TransStart Top Green Q-PCR Super Mix kit (TransGen Biotech). The relative gene expression for M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 strains was determined on the base of the corresponding standard curve. The data was analyzed and assessed for the differences in gene expressions of M. sm-ΔM_6281 and ΔM_6281::Rv3717 strains compared to wild type M.smegmatis. The data were presented as the mean ± standard error (SEM). All data about gene expression and biofilm analysis was plotted and analyzed using GraphPad Prism5 (GraphPad software). p < 0.05 is considered statistically significant according to t-test.
90 × 15 mm2 polystyrene was inoculated with 1 ml saturated culture and incubated at 30 °C for 5 d. Moreover, morphology of biofilm was determined by scan electron microscope (SEM) [13]. First, the coupons made from silicone were prepared for sterilization. The coupons treated were plated in the bottom of a distilled 12-well plate which was inoculated with 100 μl saturated culture in 2 ml M63 medium in each well and incubated at 30°Cfor 5 d. After the silicone coupons were washed using PBS to remove the medium, they were fixed by 2.5% glutaraldehyde solution for overnight at 4 °C. The samples were exposed to a series ethanol dehydration to make gold-thin film for SEM [14]. The images from three independent coupons were analyzed.
2.5. Quantitative analysis biofilm formation
3.1. MSMEG_6281-mediated potential biological process
3. Results
M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 cells were cultured to about OD600 = 1. The cultures were centrifuged at 4500 rpm for 10 min, and the precipitated bacteria were collected and diluted by 100 times using M63 medium to create cell suspension [12]. Each well of sterile polyvinylchloride flat-bottomed 96-well plates was filled with 150 μl of cell suspension. To promote biofilm formation, the plates were incubated at 30°Cfor 6 d. During the growth of biofilm, one group was separated every 24 h, removing generally the medium and washed three times with PBS buffer, then stained by 150 μl 0.01% crystal violet for 15 min, and then 95% ethanol was added to dissolve them after washing using PBS. The absorbance was measured at 589 nm.
To address the potential roles during the MSMEG_6281-mediated biological process, the total proteins from M.smegmatis mc2155 and M.sm-ΔM_6281were digested into peptides and labelled by TMT6-plex, separated by HPLC, and then we applied mass spectrometry analysis. 4383 proteins were identified, among which 4,197 proteins could be quantified. The data showed that 407 proteins were up-regulated and 444 proteins were down-regulated when quantitative ratios were above 1.2 or below 1/1.2, respectively. 64 proteins were up-regulated by 2fold and 70 proteins were down-regulated by 0.5 (Supplemental Table 1). These differentially expressed proteins are classified by functional category according to biological process, cellular component, and molecular function. The majority of those in the biological process category represent metabolic process, single-organism, and cellular process; ones related to molecular function display catalytic and binding activity; and those in the cellular component category are more
2.6. Morphology analysis of biofilm To observe biofilm formation, 20 ml M63 medium in a 4
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 4. Protein-protein interaction networks analysis. (A) Ribosome networks from PPIs analysis; (B) ABC transporters network from PPIs analysis; (C) fatty acid degradation analysis.
3.3. The expression changes of genes related to fatty acid metabolism due to lack of MSMEG_6281
distributed in macromolecular complex and cell membrane (Fig. 1A–C). To further understand the proportion of the changed expression in total proteins quantified, the proteins data was further divided into unchanged, up-regulated, and down-regulated proteins (Fig. 1-D). 32.6% of proteins related to metabolic process, 31.5% of catalytic proteins, and 29.6% of proteins related binding activity were expressed differentially. The majority of up-regulated and down-regulated proteins are distributed in the metabolism process, catalytic, and binding activities.
Mycolic acids (MAs), a distinct class of long-chain fatty acids, are distributed to the outer sides of the mycobacterial cell wall. We selected genes related to fatty acid degradation from PPI analysis in order to confirm the expression changes of genes due to a lack of MSMEG_6281. The genes are potentially involved in fatty acid degradation, including fatty acid degradation protein D32 (fadD32), FadD4; AMP-binding enzyme (MSMEG_0131); dehydradase MSMEG_2201, MSMEG_2446; and acyl-CoA synthase MSMEG_5291. RT-PCR results revealed fadD32 was up-regulated, while MSMEG_0131, MSMEG_2201, and MSMEG_2446 were significantly down-regulated (Fig. 5-A). The changes were consistent with LC-MS/MS data. In addition, the gene expression changes were recovered in a complemented strain. We investigated several genes that are essential for MAs biosynthesis which are not identified by LC-MS/MS such as AcpM, FabD, FabG, KasB, and InhA. The results showed that fabD, kasB, and inhA were significantly up-regulated, and fabG was down-regulated in M. sm-ΔM_6281. The changes were also recovered in the ΔM_6281::Rv3717 strain (Fig. 5-B). Thus, the results demonstrated that some of the genes related to fatty acid metabolism were significantly altered due to a lack of MSMEG_6281. We quantified the gene expression of the PG amidase using Q-PCR analysis. The results showed that the relative gene expression in ΔM_6281::Rv3717 was up-regulated significantly 1.46-folds compared to M.smegmatis; M. sm-ΔM_6281was down-regulated 0.4-folds, which is consistent with LC-MS/MS data (the ratio of M. sm-ΔM_6281 to M.smegmatis is 0.12 as showed in Supplemental Table 1) (Fig. 5-C).
3.2. Enrichment data analysis of the differently expressed proteins To search significant enrichment of the differently expressed proteins, GO-based enrichment analysis was performed. 1100 changed proteins had matched in GO, and the significant changes (p < 0.05) in GO categories between M. sm-ΔM_6281 and M.smegmatis were classified and listed in Fig. 2. The proteins related to oxidoreductase, transporter, and O-acyltransferase activities were down-regulated, and structural constituents of ribosome were up-regulated in the M. sm-ΔM_6281 strain. KEGG pathway-based enrichment showed that the most interesting of the down-regulated pathways was ATP-binding cassette (ABC) transporters, which was consisted of ATP-binding protein SugC, MCEfamily protein mce1C, 2D, 4C, 4F, and LprK (Fig. 3). Saccharine and lipid transporters, which might be related to antibiotic resistance of M.tb, were down-regulated. According to protein-protein interactions (PPIs) analysis, we found that the significant proteins constituted three important pathways: ribosome, ABC transporter, and fatty acid degradation (Fig. 4).
5
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 5. The relative expression analysis of genes in M.smegmatis, M sm-ΔM_6281, and ΔM_6281::Rv3717 strains. (A-B) RT-PCR analysis exhibited the relative gene expressions of candidate genes related fatty acid metabolism. PCR products were identified by 1% agrose gel electrophoresis, and the size of the bands was consistence with the length of corresponding PCR product, “M” represents 250 bp DNA ladder, and gap was regarded as internal control. Relative expression analysis of the genes and gap was performed by Quantity One, n = 3. p < 0.05 was considered statistical significant: *p < 0.05, **p < 0.01.(C) Relative gene expression of M sm-ΔM_6281and ΔM_6281::Rv3717 compared to M.smegmatis was identified through Q-PCR.
of biofilm was performed at different time intervals. The results found that biofilm did not appear in the first two days in all experimental strains. Biofilm along the well wall was exhibited clearly at day 3, and gradually increased until day 6 (Fig. 6-A). Quantitative results showed
3.4. Quantitative and morphology analysis of biofilm To explore the difference of biofilm formation among M.smegmatis, M. sm-ΔM_6281, and ΔM_6281::Rv3717 strains, a quantitative analysis
6
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
Fig. 6. Analysis of biofilm formation of M.smegmatis, M sm-ΔM_6281, and ΔM_6281::Rv3717 strains. (A) Detecting biofilm formation via crystalline violet staining; (B) Quantitative analysis of biofilm formation, n = 3. p < 0.05 was considered statistical significant: *p < 0.05, **p < 0.01. (C) Dishes containing M63 liquid medium were inoculated at day 5 during biofilm growth; (D) Scan electron microscopy analysis at day 5 during biofilm growth (×10000), bars = 1 μm.
less number of adhered cells arranged in the separating form for M. smΔM_6281, while there were more number of adhered cells for wild-type M.smegmatis, and some extracellular matrix secretions as well as cells aggregates (Fig. 6-D). The ΔM_6281::Rv3717 strain showed higher cell aggregates and extracellular matrix secretions compared to M.smegmatis, which might result from the over-expression of Rv3717 in the ΔM_6281::Rv3717 complemented strain and needs further investigation.
that the intensity of M. sm-ΔM_6281 was about 70.7% of M.smegmatis and 69.2% of ΔM_6281::Rv3717 at day 5 (Fig. 6-B). Thus, our results indicated that the capability of biofilm formation was retarded in the M. sm-ΔM_6281 strain. We also observed that biofilm formation on plates for M. smΔM_6281 is likely to be less compared to the other strains at day 5 (Fig. 6-C). SEM was considered to be a more suitable tool to observe the morphology of biofilm, thus we further investigated the biofilm on silicone coupons using SEM. Our results demonstrated that there were 7
Microbial Pathogenesis 140 (2020) 103939
J. Miao, et al.
4. Discussion
References
M.tb Rv3717, a PG amidase, is involved in PG degradation and plays a role in maintaining cell wall integrity and permeability [7–9]. In the present study, we performed comparative proteomic analysis between M.sm-ΔM_6281 and wild type M.smegmatis strain through the LC-MS/ MS method. The results exhibited that 134 proteins were up or downregulated over 2-folds. According to PPIs analysis, we found that the significant proteins constituted three important pathways: ribosome, ABC transporter, and fatty acid degradation. Intriguingly, we noted that the most obvious changes of proteins were related to fatty acid metabolism. In fact, there are about 250 distinct enzymes involved in fatty acid metabolism in M.tb compared with 50 genes in E.coli [15]. Under the enzymes’ action, mycobacteria produce diverse lipids including single fatty acids and long-chain mycolic acids (MAs) [12,16]. In vivo-grown mycobacteria depend on lipids as a carbon source for mycobacterial survival through fatty acid β-oxidation systems which contain 36 acylCoA synthase, 21 acyl-CoA dehydrogenase, and 3-hydroxy dehydrogenase [15,17]. MAs are the major lipids of a protective layer of cell wall, serving as structural units of the cell envelope [18–20]. During M.tb infection, these internalized C16/C18 fatty acids could enter the FAS- ІІ system to be used for MAs biosynthesis [19]. In this study, we confirmed the expression changes of some genes involved in fatty acid degradation and MAs biosynthesis due to lack of MSMEG_6281, such as fadD32, FadD4, AMP-binding enzyme (MSMEG_0131), dehydradase MSMEG_2201, MSMEG_2446, fabD, kasB and inhA. But, we did not find an obvious difference in the composition and structure of MAs under planktonic condition through TLC analysis. MAs are not only covalently bound to the arabinogalactan layer but also freely presented in outer-sides released by cell wall glycolipids, such as trehalose monomycolate (TMM) and trehalosedimycolate (TDM) [21,22]. Ojha A.K et al. demonstrated that the short chain free MAs may be critical to biofilm formation [23]. FAS-І and FAS-ІІ systems of M.smegmatis were shown to be similar to those of M.tb, and so M.smegmatis was often used as a model organism to study mycobacterial biofilm formation [19,24,25]. Our results revealed a delayed biofilm formation due to a lack of MSMEG_6281, while biofilm phenotype was recovered in a complemented strain. Combining the above results, we suggest that PG amidase MSMEG_6281 may impact fatty acid metabolism and biofilm formation. However, how PG amidase affects biofilm formation remains to be further explored.
[1] Organization, WH. Global Tuberculosis Report, (2019) 2019. [2] C.E. Barry, D.C. Crick, M.R. McNeil, Targeting the formation of the cell wall core of M. tuberculosis, Infect. Disord. Drug Targets 7 (2007) 182–202. [3] G. Torrens, M. Perez-Gallego, B. Moya, M. Munar-Bestard, L. Zamorano, G. Cabot, et al., Targeting the permeability barrier and peptidoglycan recycling pathways to disarm Pseudomonas aeruginosa against the innate immune system, PLoS One 12 (2017) e0181932. [4] M.J. Nasiri, M. Haeili, M. Ghazi, H. Goudarzi, A. Pormohammad, A.A. Imani Fooladi, et al., New insights in to the intrinsic and acquired drug resistance mechanisms in mycobacteria, Front. Microbiol. 8 (2017) 681. [5] D.L. Garcia, J.P. Dillard, AmiC functions as an N-acetylmuramyl-l-alanine amidase necessary for cell separation and can promote autolysis in Neisseria gonorrhoeae, J. Bacteriol. 188 (2006) 7211–7221. [6] C.C. Boutte, C.E. Baer, K. Papavinasasundaram, W. Liu, M.R. Chase, X. Meniche, et al., A cytoplasmic peptidoglycan amidase homologue controls mycobacterial cell wall synthesis, eLife 5 (2016). [7] S. Senzani, D. Li, A. Bhaskar, C. Ealand, J. Chang, B. Rimal, et al., An Amidase_3 domain-containing N-acetylmuramyl-L-alanine amidase is required for mycobacterial cell division, Sci. Rep. 7 (2017) 1140. [8] A. Kumar, S. Kumar, D. Kumar, A. Mishra, R.P. Dewangan, P. Shrivastava, et al., The structure of Rv3717 reveals a novel amidase from Mycobacterium tuberculosis, Acta Crystallogr. Sect. D Biol. Crystallogr. 69 (2013) 2543–2554. [9] J. He, W. Fu, S. Zhao, C. Zhang, T. Sun, T. Jiang, Lack of MSMEG_6281, a peptidoglycan amidase, affects cell wall integrity and virulence of Mycobacterium smegmatis, Microb. Pathog. 128 (2019) 405–413. [10] X. Li, J. He, W. Fu, P. Cao, S. Zhang, T. Jiang, Effect of Mycobacterium tuberculosis Rv3717 on cell division and cell adhesion, Microb. Pathog. 117 (2018) 184–190. [11] C.M. Sassetti, E.J. Rubin, Genetic requirements for mycobacterial survival during infection, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 12989–12994. [12] J. Recht, R. Kolter, Glycopeptidolipid acetylation affects sliding motility and biofilm formation in Mycobacterium smegmatis, J. Bacteriol. 183 (2001) 5718–5724. [13] C.W. Wu, S.K. Schmoller, J.P. Bannantine, T.M. Eckstein, J.M. Inamine, M. Livesey, et al., A novel cell wall lipopeptide is important for biofilm formation and pathogenicity of Mycobacterium avium subspecies paratuberculosis, Microb. Pathog. 46 (2009) 222–230. [14] L.C. Gomes, F.J. Mergulhao, SEM analysis of surface impact on biofilm antibiotic treatment, Scanning 2017 (2017) 2960194. [15] S.T. Cole, R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, et al., Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence, Nature 393 (1998) 537–544. [16] K.Y. Dunphy, R.H. Senaratne, M. Masuzawa, L.V. Kendall, L.W. Riley, Attenuation of Mycobacterium tuberculosis functionally disrupted in a fatty acyl-coenzyme A synthetase gene fadD5, J. Infect. Dis. 201 (2010) 1232–1239. [17] M. Jain, C.J. Petzold, M.W. Schelle, M.D. Leavell, J.D. Mougous, C.R. Bertozzi, et al., Lipidomics reveals control of Mycobacterium tuberculosis virulence lipids via metabolic coupling, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 5133–5138. [18] Y. Yuan, D. Mead, B.G. Schroeder, Y. Zhu, C.E. Barry 3rd, The biosynthesis of mycolic acids in Mycobacterium tuberculosis. Enzymatic methyl(ene) transfer to acyl carrier protein bound meromycolic acid in vitro, J. Biol. Chem. 273 (1998) 21282–21290. [19] K. Takayama, C. Wang, G.S. Besra, Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis, Clin. Microbiol. Rev. 18 (2005) 81–101. [20] A. Queiroz, L.W. Riley, Bacterial immunostat: Mycobacterium tuberculosis lipids and their role in the host immune response, Rev. Soc. Bras. Med. Trop. 50 (2017) 9–18. [21] C.C. Wright, F.F. Hsu, E. Arnett, J.L. Dunaj, P.M. Davidson, S.A. Pacheco, et al., The Mycobacterium tuberculosis MmpL11 cell wall lipid transporter is important for biofilm formation, intracellular growth, and nonreplicating persistence, Infect. Immun. 85 (2017). [22] E. Rafidinarivo, M.A. Laneelle, H. Montrozier, P. Valero-Guillen, J. Astola, M. Luquin, et al., Trafficking pathways of mycolic acids: structures, origin, mechanism of formation, and storage form of mycobacteric acids, J. Lipid Res. 50 (2009) 477–490. [23] A.K. Ojha, X. Trivelli, Y. Guerardel, L. Kremer, G.F. Hatfull, Enzymatic hydrolysis of trehalose dimycolate releases free mycolic acids during mycobacterial growth in biofilms, J. Biol. Chem. 285 (2010) 17380–17389. [24] P. Chakraborty, A. Kumar, The extracellular matrix of mycobacterial biofilms: could we shorten the treatment of mycobacterial infections? Microb. Cell 6 (2019) 105–122. [25] J. Recht, A. Martinez, S. Torello, R. Kolter, Genetic analysis of sliding motility in Mycobacterium smegmatis, J. Bacteriol. 182 (2000) 4348–4351.
Acknowledgements This study was financially supported by grants from National Natural Science Foundation of China (31300672, 31900937), Liaoning Province Natural Science Foundation of China (20180550231) and Young Scholar Support Project sponsored by the college of basic medical science of Dalian Medical University.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2019.103939.
8