Effect of peripartum dietary energy supplementation of dairy cows on metabolites, liver function and reproductive variables

Animal Reproduction Science 112 (2009) 301–315

Effect of peripartum dietary energy supplementation of dairy cows on metabolites, liver function and reproductive variables E. Casta˜neda-Guti´errez a , S.H. Pelton a , R.O. Gilbert b , W.R. Butler a,∗ a b

Department of Animal Science, Cornell University, Ithaca, NY 14853, United States Department of Clinical Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853-6401, United States

Received 10 January 2008; received in revised form 6 April 2008; accepted 28 April 2008 Available online 3 May 2008

Abstract Multiparous Holstein cows (n = 58) were used to study the effects of peripartum dietary supplementation on metabolic status, liver function and reproduction variables. Diets for cows were as follows: (a) no supplementation (CTL), (b) prilled fatty acids as 1.9% of DM (PrFA), (c) calcium salts of long chain n-6 fatty acids as 2.24% of DM (CaLFA) or (d) daily topdressing with 769 g of 65% propylene glycol (PGLY). Supplements were fed during the last 21 days before expected calving except for PGLY that continued until 21 days after parturition. Ovarian activity was monitored by transrectal ultrasonography and days to first ovulation were recorded. Liver biopsies were obtained on day 8 and 21 postpartum and analyzed for triglyceride content and mRNA expression of pyruvate carboxylase, cytosolic phosphoenolpyruvate carboxykinase, carnitine palmytoyltransferase 1A, and peroxisome proliferator-activated receptor-␣. At 71 days following parturition, stage of ovarian cycles was synchronized and at day15 of the cycle oxytocin was injected i.v., blood samples were obtained at frequent intervals, and analyzed for 13,14 dihydro, 15-keto PGF2␣ (PGFM). Milk production and milk components were not different among treatment groups. Cows in PGLY gained body condition score (BCS) prepartum and net energy balance prepartum tended to be greater, but was not different postpartum from other groups. PGLY supplementation increased plasma insulin concentration prepartum, but not during the postpartum period. No significant differences were observed in plasma concentrations of glucose, NEFA, and insulin-like growth factor or hepatic triglyceride content, but all supplements tended to decrease ␤ hydroxybutyrate postpartum compared to CTL cows. Abundance of mRNA of gluconeogenic and lipid oxidation genes was not different among treatment groups. Days to first ovulation and uterine ∗ Corresponding author at: Department of Animal Science, Cornell University, 149 Morrison Hall, Ithaca NY 148534801, United States. Tel.: +1 607 255 3174; fax: +1 607 255 9829. E-mail address: [email protected] (W.R. Butler).

0378-4320/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.anireprosci.2008.04.028

302

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

PGF2␣ production in response to an oxytocin treatment were not significantly different among treatment groups. Peripartum supplementation did not result in the substantial improvement of metabolic profile in early lactation nor significantly affect days to first ovulation and PGFM response to an oxytocin treatment. © 2008 Elsevier B.V. All rights reserved. Keywords: Dairy cattle–propylene glycol; Prepartum fatty acids; Reproduction; Liver; Ovulation

1. Introduction The transition period in dairy cows is defined as the last 3 wk prepartum until 3 wk postpartum and is characterized by marked changes in metabolism to support late gestation and the onset of milk synthesis. Along with a gradual decline in dry matter intake (DMI) that starts 2–3 wk prepartum, an abrupt increase in nutrient demand with initiation of lactation results in negative energy balance (NEBAL) and extensive mobilization of body fat reserves as nonesterified fatty acids (NEFA). Depressed concentrations of glucose, and frequently insulin, are typical during NEBAL in association with increased hepatic gluconeogenesis (see reviews by Bell, 1995; Grummer, 1993; Drackley, 1999). To coordinate these adaptations liver metabolism is upregulated; mRNA abundance of gluconeogenic enzymes such as cytosolic phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate carboxylase (PC) increase during early lactation (Greenfield et al., 2000; Agca et al., 2002). Also genes involved in fatty acid oxidation such as carnitine palmytoyltransferase-1 (CPT1) and peroxisome proliferator-activated receptor-␣ (PPAR␣) are altered and their mRNA abundance is positively correlated with circulating NEFA and ␤hydroxybutyrate (BHB) concentrations (Loor et al., 2005). If excessive lipolysis occurs during early lactation, oxidative capacity of the liver can be exceeded resulting in liver triglyceride accumulation and ketosis which reduces hepatic gluconeogenic capacity (see reviews by Bell, 1995; Grummer, 1993; Drackley, 1999). Supplementation with propylene glycol (PGLY) during early lactation has been used as a means to increase plasma insulin and glucose concentrations and to reduce lipolysis. NEBAL has detrimental effects on reproduction. Cows that lose body condition score (BCS) extensively during the first 30 days of lactation experience long intervals to first ovulation and concentration of circulating BHB and NEFA were greater in cows in which ovulation did not occur from the first postpartum dominant follicle that developed after parturition (reviewed by Butler, 2003). The central role of the liver in coordinating metabolism and reproduction is illustrated by the negative correlation between liver triglycerides and days to first estrus and to pregnancy (Jorritsma et al., 2000). Because major changes begin prepartum in the transition period, implementation of nutritional strategies at this time may have beneficial effects on hepatic metabolism and, subsequently, on reproductive function. Fat supplementation earlier during the prepartum period has resulted in less triglyceride accumulation, and increased peroxisomal oxidation (Grum et al., 1996b; Drackley, 1999). Preliminary studies found beneficial effects of fat supplementation during the prepartum period on pregnancy rate and days not pregnant (Frajblat and Butler, 2003). The delayed carry-over effect may be related to the effect of changes in circulating metabolites during the transition period on small developing ovarian follicles. Intrafollicular concentrations of NEFA and BHB are closely correlated with serum concentrations (Leroy et al., 2004) and greater NEFA impact negatively on the proliferation of granulosa cells and embryonic development in vitro (Jorritsma et al., 2004).

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

303

Dietary supplementation of unsaturated fatty acids such as linoleic, linolenic eicosapentaenoic and docosahexaenoic acid may improve reproduction by replacing precursor arachidonic acid in the phospholipid fraction and decreasing uterine production of PGF2␣ secretion. Reduction in PGF2␣ production amplifies the inhibition imposed by the early embryo and may help to prevent luteolysis and, thereby, improve embryo survival (reviewed by Abayasekara and Wathes, 1999; Mattos et al., 2000). Rate of turnover of the uterine phospholipid fraction is not known, but Oldick et al. (1997), reported that inhibition of PGF2␣ release from the uterus in response to oxytocin occurred for more than 100 days after abomasal infusions of yellow grease (high linoleic acid concentration). Therefore, supplementation with unsaturated fat during the transition period may have an inhibitory effect on uterine PGF2␣ secretion later in lactation. Because nutrient intake and energy balance during the transition period may influence reproductive performance, we hypothesized that dietary energy supplementation would decrease circulating NEFA, BHB and hepatic triglycerides, and, therefore, reduce days to first ovulation. Thus, the objective of this study was to compare three forms of dietary energy supplementation using unsaturated fatty acids, saturated fatty acids, or a glucogenic precursor (propylene glycol) during the prepartum period for their effects on liver metabolism and days to first ovulation in lactating cows. 2. Materials and methods 2.1. Animals and experimental design All procedures were approved by the Cornell University Institutional Animal Care and Use Committee. Multiparous Holstein cows (n = 60) from the Cornell University Dairy Teaching and Research facility were blocked by parity and by 305-day mature equivalent milk production in the previous lactation, and assigned in a randomized complete blocked design to one of the following dietary treatments: (a) no supplementation (CTL), (b) prilled fatty acids as 1.9% of DM (PrFA; Energy Booster 100, MS Specialty Nutrition, Dundee, IL), (c) calcium salts of long chain n-6 fatty acids as 2.24% of DM (CaLFA; Megalac-R, Church & Dwight Co., Princeton, NJ) or (d) daily topdressing on the CTL ration with 769 g of 65% propylene glycol (Pro-Pylene 65, International Probiotech Inc., Quebec, Canada). PrFA and CaLFA provided the same amount of fat. Fatty acid composition of fat supplements is given in Table 1. Fat supplements were incorporated into a total mixed ration (TMR) formulated to meet or exceed nutrient requirements for pregnant cows using the Cornell Net Carbohydrate and Protein System (Fox et al., 2004), and were fed from 21 days before expected day of calving until parturition. After calving, all cows received a diet formulated for high producing cows without additional supplements, except the group receiving PGLY which continued to receive daily PGLY topdressing until 21 days postpartum in an effort to maintain increased plasma glucose and insulin throughout the first follicular wave (Butler et al., 2006). Samples of the TMR were taken weekly, DM content was determined by drying at 54 ◦ C until constant weight, and then aliquot samples were composited at 4 wk intervals. Feed composites were analyzed by wet chemistry methods for CP, ADF, NDF, and EE (Dairy One Cooperative Inc., Ithaca, NY). Ingredients and composition of the diets are reported in Table 2. Cows were housed in free stalls fitted with Calan gates before parturition and in individual tie stalls after calving to allow recording of daily dry matter intake from 21 days before expected day of calving to 30 days in milk (DIM). Water and mineral blocks were available throughout the study. Body weight (BW) and body condition score (5 point system; Wildman et al., 1982) was

304

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Table 1 Fatty acid composition of fat supplements Fatty acid, g/100 g of FA

PrFA

CaLFA

12:0 14:0 14:1 15:0 16:0 16:1 17:0 17:1 18:0 18:1 18:1 trans 18:2 18:3 20:0 20:1 20:2 Others

2.00 2.92 0.06 0.29 28.20 0.43 1.23 0.10 51.20 8.39 0.00 1.53 0.13 1.12 0.13 0.06 0.00

0.00 0.00 0.00 0.00 17.40 0.00 0.00 0.00 2.10 32.10 1.53 30.50 2.40 0.00 0.00 0.00 13.97

Cows received prilled fatty acids as 1.9% DM (PrFA) or calcium salts of long chain n-6 fatty acids (CaLFA) as 2.2% DM from −21 to 0 DIM

recorded weekly by two individuals from the initiation of the experiment until day 70 postpartum. After calving, cows were milked three times per day and milk weights recorded. One day per week, a sample was obtained from each milking; a composite was formed from the three milkings and stored at 4 ◦ C with a preservative (bronopol tablet; D&F Control System, San Ramon, CA) until analysis for fat, true protein and somatic cell count (Dairy One Cooperative Inc.) with the analytical and calibration methods described by Bernal-Santos et al. (2003). Blood samples were obtained three times per week in the prepartum period, daily from calving to 30 DIM and then weekly until 70 DIM. Blood was collected from the median coccygeal vessels into vacuum tubes containing sodium heparin (100 U/ml of blood). Plasma was harvested by centrifugation (2800 × g for 15 min at 4 ◦ C) and stored at −20 ◦ C until metabolite and hormone analyses. On day 8 and again on day 21 ± 1 (mean ± S.D.) postpartum, liver samples were obtained via percutaneous trochar biopsy (Veenhuizen et al., 1991) from 12 cows randomly selected in each group. Liver tissue was snap frozen in liquid nitrogen and stored at −80 ◦ C until it was analyzed for triglyceride content or mRNA isolation. From day 10 to 30 postpartum, ovarian follicular development was monitored three times per week by linear array ultrasonography with a 7.5 MHz transrectal transducer (Aloka 210; Corometrics Medical Systems, Wallingford, CT, USA). Ovulation was recorded by observation of a corpus luteum (CL). 2.2. Estrous cycle synchronization At 71 ± 3 DIM cows received 100 ␮g of GnRH (Cystorelin; Abbott Laboratories, North Chicago, IL) and an intravaginal progesterone releasing device was inserted (Eazi-Breed, AgTech, Manhattan, KS). Seven days later the device was removed, 30 mg of PGF2␣ (Lutalyse; Pharmacia & Upjohn, Kalamazoo, MI) was injected followed by 100 ␮g of GnRH 2 days later. Ovulation

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

305

Table 2 Ingredient and chemical composition of the experimental diets Variable

CTLa

PrFA

CaLFA

Postpartum diet

Ingredient (% of DM) Corn silage Alfalfa haylage Alfalfa hay Grass hay Wheat straw High moisture corn Corn meal Citrus pulp Confectionary sugar product Soybean hulls Wheat middling Gluten feed Anionic supplement Soybean meal Blood and feather meal Urea Tallow Mineral mixb Yeast Prilled fatty acids Ca salts of fatty acids

36.34 11.40 0.00 11.58 3.56 0.00 7.11 5.34 0.00 4.06 4.06 4.06 5.45 3.74 0.00 0.00 0.00 0.79 0.46 0.00 0.00

36.35 11.40 0.00 11.58 8.73 0.00 3.56 5.35 0.00 2.35 2.35 2.35 5.45 5.35 0.00 0.00 0.00 0.70 0.46 1.89 0.00

36.36 11.41 0.00 11.59 8.70 0.00 3.57 5.35 0.00 2.35 2.35 2.35 5.45 5.35 0.00 0.00 0.00 0.79 0.46 0.00 2.21

29.43 14.77 4.43 3.23 1.18 20.61 0.00 0.00 0.93 0.93 4.33 6.92 0.00 3.92 4.06 0.20 1.45 3.30 0.29 0.00 0.00

Chemical analysis (% of DM) Adjusted CP ADF NDF Crude fat NEL (Mcal/kg)

15.4 25.0 38.4 3.3 1.56

14.9 25.7 40.4 4.5 1.60

15.7 24.3 37.9 4.2 1.60

18.1 20.2 32.5 4.6 1.65

Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. Values represent averages of samples composited every 4 wk. a Cows in the PGLY group received control diet with 769 g of propylene glycol as a topdress, having energetic value of 2 Mcal/day. b The mix (DM basis) contained: 0.57% Ca, 15.75% sulfur, 1362.24 ppm cobalt, 40,816.32 ppm copper, 2724.49 ppm iodine, 10,204.08 ppm iron, 122,448.98 ppm manganese, 122,448.98 ppm zinc.

and formation of a CL in response to GnRH was monitored by ultrasonography. On day 15 of the estrous cycle, cows received an intravenous injection of oxytocin (100 IU), blood samples were collected before and every 15 min following the oxytocin injection for 3 h, and then every 30 min for one additional hour from a jugular cannula implanted the previous day. 2.3. Metabolite and hormone analyses Plasma NEFA, glucose and BHB were quantified by enzymatic analysis [NEFA-C kit, Wako Chemicals, Richmond, VA; Glucose (kit 510A), and BHB (kit 310-UV), Sigma Diagnostics, St. Louis, MO] in samples from 3 wk before parturition (NEFA and BHB) or 10 days before parturition (glucose), and then every other day until 3 wk postpartum.

306

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Plasma concentration of insulin-like growth factor I (IGF-I) was quantified by radioimmunoassay (RIA) according to the method described by Butler et al. (2006) on the plasma samples obtained beginning three times per week before parturition and during the first 9 wk of lactation. Progesterone concentrations in plasma were determined by RIA (Elrod and Butler, 1993) in samples obtained 3 times per week during the first 11 wk of lactation. Ovulation was determined based on both ultrasonographic observations and temporal pattern and concentration of plasma progesterone according to the criteria described by Butler et al. (1981). Briefly, ovulation was assumed if serum progesterone increased above 0.5 ng/ml for at least five consecutive samples, and exceeded 2 ng/ml for at least two successive samples. The day of ovulation was assumed to occur 3 days before an increase to 1 ng/ml. Insulin was quantified by RIA (McGuire et al., 1995) in plasma samples obtained three times per week before parturition and during the first 3 wk of lactation. Bovine insulin was used for iodination and standards (lot 615-70N-80; Lilly Research Laboratories, Greenfield, IN). In the samples taken before and after the oxytocin injection, plasma concentrations of 13,14 dihydro, 15-keto PGF2␣ (PGFM) were quantified by RIA, according to the method described by Meyer et al. (1995) using tritiated PGFM (Amersham Biosciences, Piscataway, NJ). For triglyceride analysis, liver tissue was homogenized with a mixture of (2:1) chloroform:methanol, and lipid was extracted according to Folch et al. (1957). Triglycerides were measured by a colorimetric method (Fletcher, 1968) with modifications described by Foster and Dunn (1973). 2.4. Hepatic mRNA analysis After triglyceride analysis on liver samples obtained at 8 DIM, sufficient tissue remained available for mRNA extraction from 11 of the cows in the control group and 9 cows from each supplement group. Changes in mRNA abundance of PC, cytosolic PEPCK, CPT1, and PPAR␣ were measured using quantitative real-time reverse transcriptase PCR assays (qRT-PCR). Extraction of mRNA from ∼80 mg of tissue was performed using the RNeasy Lipid Kit (Qiagen) and DNA was removed by on-column DNase treatment (RNase-Free DNase Set; Qiagen). Total RNA was reverse transcribed using SuperScript III First Strand Synthesis kit (Invitrogen) with random primers. Primers were designed on or spanning exon boundaries using PrimerExpress v2.0 (Applied Biosystems). Quantitative RT-PCR reactions were performed using iTaq SYBR Green Supermix with ROX (Bio-Rad Laboratories) and 400 nM of gene specific forward and reverse primers (Invitrogen); CPT1 (forward GCAGCGTTCTTCGTGACGTTA; reverse ACCTGTCGAAACACCTGCCAT); PC (forward GCCCACTTCAAGGACTTCACTG; reverse GCCAAGGCTTTGATGTGCA); PEPCK (forward AGGACAAATCCCAACGCCAT; reverse GCTGATCAATGCCTTCCCAGT), PPAR␣ (forward CGGTGTCCACGCATGTGA; reverse TCAGCCGAATCGTTCTCCTAAA; Loor et al., 2005). cDNA (25 ng) was amplified with a program consisting of 95 ◦ C for 15 s and 60 ◦ C for 40 cycles (ABI PRISM 7000 Sequence Detection System, Applied Biosystems). Dissociation curves were generated at the end of amplification to verify presence of a single product. Sample message abundance was determined relative to a dilution curve of pooled liver cDNA. The housekeeping genes used were Beta-2 microglobulin (B2M) and 18S ribosomal RNA. 2.5. Statistical analysis One cow in PrFA and one cow in CaLFA were removed from the study due to health problems after calving (chronic mastitis; very low intake and milk production) and their data were

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

307

not included for any analyses. Individual daily milk production and DMI values were reduced to weekly means before analysis and the yields of fat, protein and lactose were calculated using the weekly mean for milk production. For all analyses, significance was declared at P < 0.05 and trends at P ≤ 0.10. Production variables, metabolites and hormones were evaluated by ANOVA using the PROC MIXED procedure of SAS (2001) for repeated measures. The model included treatment, week or day of treatment, treatment by week or day interaction and cow within treatment was a random variable. Data for metabolites was analyzed separately for prepartum and postpartum periods. Plane of nutrition during the dry period is known to have an effect on dry matter intake and lipid metabolism (Douglas et al., 2006), therefore BCS before initiation of treatment was used as a covariate to reduce variation and account for possible effects not related to treatment. P-value for the covariate was greater than 0.25 for insulin and IGF analysis, and thus was dropped from the model for the analysis of these variables. Liver triglycerides were evaluated with PROC GLM of SAS (2001) and the model included effect of treatment and BCS before initiation of treatment was used as a covariate. Least squares means were calculated and differences between treatments were detected with the Tukey’s adjustment. Abundance of mRNA was analyzed with PROC GLM of SAS (2001) using the normalized mean of the housekeeping genes as a covariate. To evaluate the uterine PGF2␣ response to the oxytocin treatment, area under the curve for PGFM was calculated with the trapezoidal method using PROC EXPAND of SAS (2001), and analysis of variance was performed to detect differences between treatments. Days to first ovulation were compared by survival analysis using PROC LIFETEST procedure of SAS (2001). 3. Results 3.1. Production variables Milk production, milk components and body weight were not significantly different among treatments (Table 3). BCS prepartum was increased by supplementation with PGLY, but DMI was not significantly different (Table 3). Net energy balance during the prepartum period tended to be greater in cows fed PGLY compared with the other groups (P = 0.07). 3.2. Plasma metabolites and hormones Plasma glucose concentrations were not different among treatments during prepartum or postpartum periods, however, insulin was greater in the prepartum period for cows supplemented with PGLY (Table 4). Mean circulating IGF-I concentrations were not significantly different among groups (Table 4). Treatment had no significant effect on plasma NEFA (Fig. 1). BHB tended to be greater at days 15 and 18 postpartum in CTL cows compared to any supplemented group (P = 0.07; Fig. 1). Diet did not have a significant effect on liver triglyceride accumulation at day 8 or at day 21 (Table 4). 3.3. Days to first ovulation and PGFM response to oxytocin treatment Days to first ovulation compared by survival analysis were not different among treatment groups (P = 0.60; Fig. 2). Plasma PGFM increased sharply in response to the oxytocin injection (Fig. 3), and gradually returned to baseline by 240 min, however, area under the response curve did not differ among treatments (P = 0.63).

308

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Table 3 Least squares means of production parameters Treatmenta CTL

SEM

PrFA

CaLFA

PGLY

P-value treatment

P-value treatment × time

Milk (kg/day)b Fat (%) Protein (%)

42.6 3.5 2.7

44.4 3.6 2.8

44.1 3.4 2.9

45.9 3.6 2.8

1.5 0.12 0.05

0.43 0.80 0.39

0.66 0.79 0.24

DMIc Prepartum (kg/day) Postpartum (kg/day)

13.1 17.6

13.2 19.4

13.1 18.7

14.5 19.2

0.77 0.71

0.45 0.30

0.80 0.84

0.47 0.54

0.58 0.19

0.04 0.07

0.01 0.18

0.97 0.12

1.2 1.5

0.07 0.36

0.18 0.62

Body weightd Prepartum (kg) Postpartum (kg)

723 607

Body condition scored Prepartum Postpartum Energy balancec Prepartum (Mcal/day) Postpartum (Mcal/day)

707 621

711 622

738 645

3.4 2.8

3.4 2.9

3.4 3.0

3.6 3.0

5.9 −6.7

7.1 −5.3

5.7 −4.0

9.6 −5.4

17 17

a Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. b Values represent least squares means from the first 12 wk of lactation. c Values represent least squares means from 3 wk before calving (prepartum) and first 4 wk of lactation (postpartum) and include energetic value of PGLY (2 Mcal/day). d Values represent least squares means during 3 wk before calving (prepartum) or first 12 wk of lactation (postpartum).

Table 4 Least squares means of plasma glucose, hormones and liver triglycerides Treatmenta CTL Glucose (mg/dl) Prepartum Postpartumb Insulin (ng/ml) Prepartum Postpartumb IGF-I (ng/ml) Prepartum Postpartumc

61.4 52.2 0.31b 0.20 107 56

Liver TG (% of wet weight) Day 8 5.0 Day 21 4.8

PrFA 60.8 54.3 0.28b 0.21 108 55 6.5 4.7

CaLFA

PGLY

60.9 53.3

63.9 56.6

0.32b 0.23 107 69 6.9 4.9

0.41a 0.27 123 64 8.0 5.2

SEM

P-value treatment

P-value treatment × time

1.91 1.75

0.28 0.25

0.87 0.82

0.03 0.04

0.04 0.43

0.23 0.65

7.7 5.8

0.28 0.43

0.61 0.56

1.6 1.4

0.61 0.99

a Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. b Values represent least squares means during the first 3 wk of lactation. c Values represent least squares means during the first 9 wk of lactation.

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

309

Fig. 1. Plasma concentrations of NEFA (Panel A) and BHB (Panel B). Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. Values are least squares means for each treatment. During the prepartum period SEM for NEFA averaged 37 ␮mol/l; there was no significant effect of treatment (P = 0.11) or treatment by week interaction (P = 0.92). During the postpartum period SEM averaged 56 ␮mol/l; there was no significant effect of treatment (P = 0.89) or treatment by week interaction (P = 0.68). For BHB SEM averaged 0.45 mg/dl during the prepartum period; there was no significant effect of treatment (P = 0.82) or treatment by week interaction (P = 0.52). During the postpartum period SEM averaged 0.94 mg/dl; there was no significant effect of treatment (P = 0.13), treatment by week interaction (P = 0.07).

3.4. Hepatic mRNA abundance Relative mRNA abundance of hepatic genes is presented in Figs. 4 and 5. Dietary treatment had no significant effect on mRNA abundance for any of the genes analyzed. 4. Discussion First ovulation postpartum is affected by NEBAL and shifts in DMI that begin before parturition (Beam and Butler, 1999; Butler et al., 2006). During NEBAL, NEFA are increased and glucose

310

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Fig. 2. Survival analysis for timing of first ovulation among treatment groups. Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. Treatment effect was not significant (P = 0.58; censored cows were 0% for control and 7% for PrFa, CaLFA and PGLY).

and insulin are decreased. It has been suggested that these metabolites act as signals to the hypothalamic–pituitary axis for resumption of LH pulses necessary for first ovulation (Canfield and Butler, 1991). Increased insulin during early lactation restored the coupling between GH and IGF axis, and increased the production of estradiol by the dominant follicle (Butler et al., 2003, 2004). Supplementation with PGLY during early lactation increases plasma insulin and glucose concentrations and reduces lipolysis. PGLY drenching (500 ml/day) on days 7–42 of lactation resulted in decreased days to first ovulation (Miyoshi et al., 2001). Butler et al. (2006) drenched cows with PGLY from −10 to 25 DIM, and reported increases in plasma insulin, but ovulation

Fig. 3. Plasma PGFM response to an intravenous oxytocin treatment (100 IU). Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. Treatment effect for area under the curve was not significant (P = 0.63).

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

311

Fig. 4. Relative abundance of hepatic mRNA for PEPCK and PC at day 8 of lactation. Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. For PEPCK SEM was 9.7 units; there was no significant effect of treatment (P = 0.79). For PC SEM was 15.6 units; there was no significant effect of treatment (P = 0.38).

rate and outcomes of the first follicular wave were not different from control. In the present study, insulin was increased by PGLY during the prepartum period, but not during the postpartum period, and also no differences were detected in days to first ovulation. In the previous study (Butler et al., 2006), plasma NEFA and BHB were decreased by PGLY treatment, but not in the present study, likely because PGLY treatment was discontinued on the day of calving and PGLY had no effect on energy balance. Peripartum energy supplementation did not have an effect on liver triglyceride accumulation nor on the mRNA abundance of CPT1 and PPAR␣, which are genes involved in hepatic fatty acid oxidation. This is in contrast with the results of Grum et al. (1996a,b), who reported decreased TG accumulation at day 1 postpartum in cows that received dietary fat supplementation compared with those receiving concentrate. In the same studies, peroxisomal oxidation and acid-soluble carnitine were increased, and esterification of palmitate was decreased, suggesting that dietary fat altered liver metabolism favoring oxidation capacity. Doepel et al. (2002) subsequently found that increasing prepartum energy intake (fat and carbohydrate) resulted in greater DMI postpartum, less NEFA and liver triglycerides than in control cows. However, other studies found increased or no difference in concentration of liver triglycerides with long-term prepartum fat supplementation (Vazquez-A˜non et al., 1997; Douglas et al., 2004).

312

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Fig. 5. Relative abundance of hepatic mRNA PPAR␣ and CPT1 at day 8 of lactation. Cows received (a) no supplementation (CTL); (b) prilled fatty acids as 1.9% DM (PrFA) from −21 to 0 DIM; (c) calcium salts of long chain n-6 fatty acids as 2.2% DM (CaLFA) from −21 to 0 DIM; (d) supplementation with 769 g/day of 65% propylene glycol (PGLY) from −21 to 21 DIM. For PPAR␣ SEM was 8.2 units; there was no significant effect of treatment (P = 0.42). For CPT1 SEM was 20.9 units; there was no significant effect of treatment (P = 0.81).

Abundance of mRNA for two key gluconeogenic enzymes was measured: PC, which catalyzes the conversion of pyruvate to oxaloacetate, and cytosolic PEPCK, which catalyzes the conversion of oxaloacetate to phosphoenolpyruvate. Both enzymes have been shown to respond to the onset of lactation, but changes in PEPCK did not occur until 28 DIM while PC was changed by 1 DIM (Greenfield et al., 2000). In the present study no significant difference was observed among treatments. Velez and Donkin (2005) reported that PC mRNA, but not PEPCK is directly related to gluconeogenesis from lactate in dairy cows in NEBAL. Thus, supplementation with a glucose precursor (PGLY) may have resulted in decreased rates of hepatic gluconeogenesis during the onset of lactation. Staples et al. (1998) reviewed a number of studies that evaluated the effects of supplemental dietary fat on reproductive variables. Most of those experiments used supplemental fat during early lactation and/or the breeding period and only about half of them reported beneficial effects. The present experiment studied a different approach by limiting fat supplementation only to the last 3 wk prepartum. A previous preliminary study reported a trend for reduction in days open and an increase in pregnancy rate when prilled saturated fatty acids were supplemented prepartum (Frajblat and Butler, 2003), however, the present study focused on ovarian follicle dynamics and days to first ovulation that were not altered by fat supplementation.

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

313

Potential long-term carry-over effects of peripartum dietary fat or energy supplementation on uterine capacity for PGF2␣ secretion during the usual breeding period was assessed following oxytocin injection as used in previous studies (Mattos et al., 2000). CaLFA provided omega-6 fatty acids, and long chain omega-3 or omega-6 unsaturated fatty acids can reduce synthesis of PGF2␣ after an oxytocin treatment in vivo and in vitro by replacing arachidonic acid and/or inhibiting the action of the enzyme cyclooxygenase (Mattos et al., 2004; Petit et al., 2004; Cheng et al., 2005). Residual inhibitory effects on PGF2␣ synthesis have been reported lasting up to 100 day after abomasal infusion with yellow grease with large amounts of linoleic acid (Oldick et al., 1997). In the present study, no differences in response to the oxytocin treatment were observed between treatments. Unsaturated fatty acids as CaLFA were only supplemented during the last 21 days prepartum, thus it is possible that the supplementation period was not adequate to allow incorporation of fatty acids in the phospholipid fraction, or that complete turnover of the phospholipid pool had occurred by the time the oxytocin treatment was performed (∼95 DIM). 5. Conclusion Peripartum supplementation with saturated fat, unsaturated fat or propylene glycol did not improve metabolic variables, abundance of mRNA for lipid oxidation and gluconeogenesis enzymes in liver or energy balance during early lactation, and subsequently there was no improvement of days to first ovulation. Furthermore, no carry-over effects were observed of prepartum fat supplementation on uterine PGF2␣ response to oxytocin treatment during lactation. Acknowledgments This research was supported by Research grant No. US-3422-03 R from BARD, the United States—Israel Binational Agricultural Research and Development Fund. The authors would like to acknowledge the generous contributions of dietary supplements used in this study from Church & Dwight, Princeton, NJ (Megalac-R), Milk Specialties, Dundee, IL (Energy Booster 100), and International Probiotech Inc., Quebec, Canada (Pro-Pylene 65). The authors gratefully acknowledge the efforts and contributions of the following staff and students at Cornell University: Bruce Berggren-Thomas, Gladys Birdsall, Merijn de Bont, Adam Grochowsky, Kevin Harvatine, Robert Huang, Ray Axtell and Walter Jones. References Abayasekara, D.R., Wathes, D.C., 1999. Effects of altering dietary fatty acid composition on prostaglandin synthesis and fertility. Prostaglandins Leukot. Essent. Fatty Acids 61, 275–287. Agca, C., Greenfield, R.B., Hartwell, J.R., Donkin, S.S., 2002. Cloning and characterization of bovine cytosolic and mitochondrial PEPCK during transition to lactation. Physiol. Genomics 11, 53–63. Beam, S.W., Butler, W.R., 1999. Effects of energy balance on follicular development and first ovulation in postpartum dairy cows. J. Reprod. Fertil. Suppl. 54, 411–424. Bell, A.W., 1995. Regulation of organic nutrient metabolism during transition from late pregnancy and early lactation. J. Anim. Sci. 73, 2804–2819. Bernal-Santos, G., Perfield, J.W., Barbano, D.M., Bauman, D.E., Overton, T.R., 2003. Production responses of dairy cows to dietary supplementation with conjugated linoleic acid (CLA) during the transition period and early lactation. J. Dairy Sci. 86, 3218–3228. Butler, W.R., 2003. Energy balance relationships with follicular development, ovulation and fertility in postpartum dairy cows. Livest. Prod. Sci. 83, 211–218.

314

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

Butler, W.R., Everett, R.W., Coppock, C.E., 1981. The relationships between energy balance, milk production and ovulation in postpartum Holstein cows. J. Anim. Sci. 53, 742–748. Butler, S.T., Marr, A.L., Pelton, S.H., Radcliff, R.P., Lucy, M.C., Butler, W.R., 2003. Insulin restores GH responsiveness during lactation-induced negative energy balance in dairy cattle: effects on expression of IGF-I and GH receptor 1A. J. Endocrinol. 176, 205–217. Butler, S.T., Pelton, S.H., Butler, W.R., 2004. Insulin increases 17 beta-estradiol production by the dominant follicle of the first postpartum follicle wave in dairy cows. Reproduction 127, 537–545. Butler, S.T., Pelton, S.H., Butler, W.R., 2006. Energy balance, metabolic status, and the first postpartum ovarian follicle wave in cows administered propylene glycol. J. Dairy Sci. 89, 2938–2951. Canfield, R.W., Butler, W.R., 1991. Energy balance, first ovulation and the effects of naloxone on LH-secretion in early postpartum dairy cows. J. Anim. Sci. 69, 740–746. Cheng, Z.G., Abayasekara, D.R.E., Wathes, D.C., 2005. The effect of supplementation with n-6 polyunsaturated fatty acids on 1-2-and 3-series prostaglandin F production by ovine uterine epithelial cells. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1736, 128–135. Doepel, L., Lapierre, H., Kenelly, J.J., 2002. Peripartum performance and metabolism of dairy cows in response to prepartum energy and protein intake. J. Dairy Sci. 85, 2315–2334. Douglas, G.N., Overton, T.R., Bateman, H.G., Drackley, J.K., 2004. Peripartal metabolism and production of Holstein cows fed diets supplemented with fat during the dry period. J. Dairy Sci. 87, 4210–4220. Douglas, G.N., Overton, T.R., Bateman, H.M., Dann, H.G., Drackley, J.K., 2006. Prepartal plane of nutrition, regardless of dietary energy source, affects periparturient metabolism and dry matter intake in Holstein cows. J. Dairy Sci. 89, 2141–2157. Drackley, J.K., 1999. Biology of dairy cows during the transition period: the final frontier? J. Dairy Sci. 82, 2259–2273. Elrod, C.C., Butler, W.R., 1993. Reduction of fertility and alteration of uterine pH in heifers fed excess ruminally degradable protein. J. Anim. Sci. 71, 694–701. Fletcher, M.J., 1968. A colorimetric method for estimating serum triglycerides. Clin. Chim. Acta 22, 393–397. Folch, J., Lees, M., Stanley, G.H.S., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Foster, L.B., Dunn, R.T., 1973. Stable reagents for determination of serum triglycerides by a colorimetric Hantzsch condensation method. Clin. Chem. 19, 338–340. Fox, D.G., Tedeschi, L.O., Tylutki, T.P., Russell, J.B., Van Amburgh, M.E., Chase, L.E., Pell, A.N., Overton, T.R., 2004. The Cornell Net Carbohydrate and Protein System model for evaluating herd nutrition and nutrient excretion. Anim. Feed Sci. Technol. 112, 29–78. Frajblat, M., Butler, W.R., 2003. Effect of dietary fat prepartum on first ovulation and reproductive performance in lactating dairy cows. J. Anim. Sci. 81 (Suppl. 1), 119. Greenfield, R.B., Cecava, M.J., Donkin, S.S., 2000. Changes in mRNA expression for gluconeogenic enzymes in liver of dairy cattle during the transition to lactation. J. Dairy Sci. 83, 1228–1236. Grum, D.E., Drackley, J.K., Hansen, L.R., Cremin, J.D., 1996a. Production, digestion, and hepatic lipid metabolism of dairy cows fed increased energy from fat or concentrate. J. Dairy Sci. 79, 1836–1849. Grum, D.E., Drackley, J.K., Younker, R.S., Lacount, D.W., Veenhuizen, J., 1996b. Nutrition during the dry period and hepatic lipid metabolism of periparturient dairy cows. J. Dairy Sci. 79, 1850–1864. Grummer, R.R., 1993. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76, 3882–3896. Jorritsma, R., Jorritsma, H., Schukken, Y.H., Wentink, G.H., 2000. Relationships between fatty liver and fertility and some periparturient diseases in commercial Dutch dairy herds. Theriogenology 54, 1065–1074. Jorritsma, R., Cesar, M.L., Hermans, J.T., Kruitwagen, C., Vos, P., Kruip, T.A.M., 2004. Effects of non-esterified fatty acids on bovine granulosa cells and developmental potential of oocytes in vitro. Anim. Reprod. Sci. 81, 225–235. Leroy, J., Vanholder, T., Delanghe, J.R., Opsomer, G., Van Soom, A., Bols, P.E.J., Dewulf, J., De Kruif, A., 2004. Metabolic changes in follicular fluid of the dominant follicle in high-yielding dairy cows early post partum. Theriogenology 62, 1131–1143. Loor, J.J., Dann, H.M., Everts, R.E., Oliveira, R., Green, C.A., Guretzky, N.A.J., Rodriguez-Zas, S.L., Lewin, H.A., Drackley, J.K., 2005. Temporal gene expression profiling of liver from periparturient dairy cows reveals complex adaptive mechanism in hepatic function. Physiol. Genomics 23, 217–226. Mattos, R., Staples, C.R., Thatcher, W.W., 2000. Effects of dietary fatty acids on reproduction in ruminants. Rev. Reprod. 5, 38–45.

E. Casta˜neda-Guti´errez et al. / Animal Reproduction Science 112 (2009) 301–315

315

Mattos, R., Staples, C.R., Arteche, A., Wiltbank, M.C., Diaz, F.J., Jenkins, T.C., Thatcher, W.W., 2004. The effects of feeding fish oil on uterine secretion of PGF2 alpha, milk composition, and metabolic status of periparturient Holstein cows. J. Dairy Sci. 87, 921–932. McGuire, M.A., Griinari, J.M., Dwyer, D.A., Bauman, D.E., 1995. Role of insulin in the regulation of mammary synthesis of fat and protein. J. Dairy Sci. 78, 816–824. Meyer, M.D., Hansen, P.J., Thatcher, W.W., Drost, M., Badinga, L., Roberts, R.M., Li, J., Ott, T.L., Bazer, F.W., 1995. Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2␣ of cows in response to a recombinant interferon-t. J. Dairy Sci. 78, 1921–1931. Miyoshi, S., Pate, J.L., Palmquist, D.L., 2001. Effects of propylene glycol drenching on energy balance, plasma glucose, plasma insulin, ovarian function and conception in dairy cows. Anim. Reprod. Sci. 68, 29–43. Oldick, B.S., Staples, C.R., Thatcher, W.W., Gyawu, P., 1997. Abomasal infusion of glucose and fat—effect on digestion, production, and ovarian and uterine functions of cows. J. Dairy Sci. 80, 1315–1328. Petit, H.V., Germiquet, C., Lebel, D., 2004. Effect of feeding whole, unprocessed sunflower seeds and flaxseed on milk production, milk composition, and prostaglandin secretion in dairy cows. J. Dairy Sci. 87, 3889–3898. SAS, 2001. User’s Guide: Statistics, Version 8. SAS Inst., Inc., Cary, NC. Staples, C.R., Burke, J.M., Thatcher, W.W., 1998. Influence of supplemental fats on reproductive tissues and performance of lactating cows. J. Dairy Sci. 81, 856–871. Vazquez-A˜non, M., Bertics, S.J., Grummer, R.R., 1997. The effect of dietary energy source during mid to late lactation on liver triglyceride and lactation performance of dairy cows. J. Dairy Sci. 80, 2504–2512. Veenhuizen, J.J., Drackley, J.K., Richard, M.J., Sanderson, T.P., Miller, L.D., Young, J.W., 1991. Metabolic changes in blood and liver during development and early treatment of experimental fatty liver and ketosis in cows. J. Dairy Sci. 74, 4238–4253. Velez, J.C., Donkin, S.S., 2005. Feed restriction induces pyruvate carboxylase but not phosphoenolpyruvate carboxykinase in dairy cows. J. Dairy Sci. 88, 2938–2948. Wildman, E.E., Jones, G.M., Wagner, P.E., Boman, R.L., Trout, H.F., Lesch, T.N., 1982. A dairy cow body condition scoring system and its relationship to selected production variables in high producing Holstein dairy cattle. J. Dairy Sci. 65, 495–501.