- Email: [email protected]
Effect of phosphate-solubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste
Accepted Manuscript Title: Effect of phosphate-solubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste Authors: German A. Estrada-Bonilla, Cintia M. Lopes, Ademir Durrer, Paulo R.L. Alves, Nicolle Passaglia, Elke J.B.N. Cardoso PII: DOI: Reference:
S0723-2020(17)30065-6 http://dx.doi.org/doi:10.1016/j.syapm.2017.05.003 SYAPM 25838
To appear in: Received date: Revised date: Accepted date:
27-1-2017 6-5-2017 12-5-2017
Please cite this article as: German A.Estrada-Bonilla, Cintia M.Lopes, Ademir Durrer, Paulo R.L.Alves, Nicolle Passaglia, Elke J.B.N.Cardoso, Effect of phosphatesolubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste, Systematic and Applied Microbiologyhttp://dx.doi.org/10.1016/j.syapm.2017.05.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Effect of phosphate-solubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste
German A. Estrada-Bonilla1, Cintia M. Lopes1, Ademir Durrer2, Paulo R. L. Alves3, Nicolle Passaglia1, Elke J.B.N. Cardoso 1
1
Department of Soil Sciences, University of São Paulo, Av. Pádua Dias. 11, 13418900,
Piracicaba, SP, Brazil. 2
University of California-Davis, One Shields Avenue, 95616, Davis, CA, USA.
3
Federal University of the Southern Border, Av. Fernando Machado 108 E, 89802112,
Chapecó, SC, Brazil.
*Corresponding author: German Andres Estrada-Bonilla Department of Soil Science, University of São Paulo, Av. Pádua Dias 11, 13416-000 Piracicaba, SP, Brazil. Telephone number: + 55 19 34172142 E-mail: [email protected]
Highlights Wastes were submitted to the composting process inoculated with phosphatesolubilizing bacteria. Inoculation with phosphate-solubilizing bacteria improved phosphorus availability. The main attributes that modulated bacterial community were the pH and C/N ratio. The orders Lactobacillales and Bacillales dominated the composting process. The predominance of the genus Bacillus was responsible for the increase of
labile P. Abstract Sugarcane processing generates a large quantity of residues, such as filter cake and ashes, which are sometimes composted prior to their amendment in soil. However, important issues still have to be addressed on this subject, such as the description of bacterial succession that occurs throughout the composting process and the possibilities of using phosphate-solubilizing bacteria (PSB) during the process to improve phosphorus (P) availability in the compost end product. Consequently, this study evaluated the bacterial diversity and P dynamics during the composting process when inoculated with Pseudomonas aeruginosa PSBR12 and Bacillus sp. BACBR01. To characterize the bacterial community structure during composting, and to compare PSB-inoculated compost with non-inoculated compost, partial sequencing of the bacterial 16S rRNA gene and sequential P fractionation were used. The data indicated that members of the order Lactobacillales prevailed in the early stages of composting for up to 30 days, mostly due to initial changes in pH and the C/N ratio. This dominant bacterial group was then slowly replaced by Bacillales during a composting process of up to 60 days. In addition, inoculation of PSB reduced the levels of Ca-bound P by 21% and increased the labile organic P fraction. In PSB-inoculated compost, Ca-P compound solubilization occurred concomitantly with an increase of the genus Bacillus. The bacterial succession and the final community is described in compost from sugarcane residues and the possible use of these inoculants to improve P availability in the final compost is validated.
Keywords: Phosphorus availability; Inoculant; Bacterial communities; Sequential phosphorus fractionation.
Introduction The sugarcane industry generates large quantities of solid waste, such as filter cake and ash. Currently, an average of 30 kg of filter cake is produced for every tonne of ground sugarcane. During the 2014/15 harvest in Brazil, a total of 634.77 million tonnes of sugarcane were processed [10], which produced approximately 19.04 million tonnes of filter cake. If this organic waste is not correctly disposed of, it can become a source of environmental pollution and may even cause public health problems [24]. Thus, composting is an important method for management of the waste produced by the sugarcane industry [25, 27]. When applied on soil, the resulting compost improves the soil’s physical properties, increasing its porosity and water retention capacity. It also alters the chemical and microbiological characteristics of the soil, enriching it with humic substances and macro- and micronutrients [21]. During composting, the microbial community is the most important component involved in recycling the residue but it must overcome a gradual reduction in nutrients and large changes in temperature and water content, as well as oxygen and ammonia levels [34]. Previous studies have described the microbial communities during composting using culture-independent analyses, such as fatty-acid methyl esters (FAMEs), denaturing gradient gel electrophoresis (DGGE), amplified ribosomal rDNA restriction analysis (ARDRA), and high-throughput sequencing technologies [8, 14, 19, 38]. It is therefore of fundamental importance to understand other microbiological aspects, especially the succession of populations during the sequential composting process, in order to improve the physical and chemical characteristics of the final product.
Highly weathered tropical soils are typically poor in available phosphorus (P) and have a high P fixation capacity [3]. Composting of sugarcane processing waste normally results in high P levels, primarily in organic forms. Thus, compost application provides a steady supply of mineralizable P, and improves its availability in such highly weathered soils [5]. Concurrently, it is also known that phosphate-solubilizing bacteria (PSB) are important for P solubilization of phosphate minerals and mineralization of organic P compounds [30]. However, there are few studies describing the use of PSB to increase the availability of P during composting. However, Billah and Bano [4] reported increases of up to 40% in the quantity of available P when compost piles were inoculated with a strain of Pseudomonas sp. Compost with a higher quantity of available P has great potential for application in tropical soils. Hence, the main objective of the current study was to detail the effect of PSB addition on P availability in compost and to describe the structure of the bacterial communities during this process.
Materials and Methods Compost piles and treatments The dimensions of the compost piles were 3.2 x 1.6 x 25 m (base x height x length), with a separation of 5 m between them. All compost piles were prepared using two parts of filter cake (1,400 kg m-1) to one part of boiler and fly ash (700 kg m-1) together with laying chicken manure (380 kg m-1). For treatments including rock phosphate (RP), a further 2% (42 kg m-1) of powdered (particle size smaller than 0.074 mm) RP was
pulverized over the piles. The chemical composition of the RP used was: total P2O5 (271.0 g kg-1); citric acid P2O5 (46.0 g kg-1); CaO (357.5 g kg-1); Fe2O3 (171.3 g kg-1). During composting, the temperature was monitored daily at five different points in the pile and a minimum humidity of 30% was maintained throughout the composting period. Moisture was conserved weekly by turning the pile over (to improve water evaporation) or by adding water whenever necessary. The experimental design included full randomization, with four treatments and three repetitions, giving a total of 12 compost piles. The treatments tested were as follows: 1filter cake + ash (Standard); 2- filter cake + ash + RP (RP); 3- filter cake + ash + inoculant (Standard + Inoculant). ; 4- filter cake + ash + RP + inoculant (RP + Inoculant). The composting period was 60 days and the piles were turned over at least every seven days. Samples were taken every 15 days for chemical and biological analyses from five different levels within the mid 15 m of each pile, and these were mixed to obtain a composite sample for each replicate. Phosphate-solubilizing strains and preparation of the inoculant Prior to the experiment described above, bacterial strains were isolated from composting piles of industrial sugarcane residues, located at the same site where the study was later conducted. Sixty-five bacterial strains were isolated either at the start of the composting process (mesophilic phase) or 15 days later, when temperatures were approximately 60 oC (thermophilic phase). Afterwards, strains were selected according to their ability to solubilize P in vitro in an SMRS1 liquid medium [36]. The two best Psolubilizing bacterial strains were selected (Supplementary Fig. S1) and identified as
Pseudomonas aeruginosa PSBR12 (from the mesophilic phase) and Bacillus sp. BacBR1 (from the thermophilic phase) (Supplementary Fig. S2). The accession numbers of their sequences are reported in the GenBank database. Initially, these strains were grown separately in a 13 L Tecnopon fermenter loaded with 10 L of LB medium maintained for 15 h at 300 rpm and 30 °C, with an airflow of 10 L min-1. The number of viable cells was determined using the LB medium microplate method [16]. At the end of fermentation, concentrations of 10 9 cells mL-1 of each strain were counted. Before application, equal volumes of each of the bacterial suspensions were mixed and the inoculant was then diluted in 50 L of water, which was applied at a dosage of 8 L Mg-1 compost and a concentration of 10 8 cells mL-1 for each strain. The inoculant was added at the start of the experiment and again 30 days after construction of the piles (DAPC). Bacterial communities Extraction of total DNA and quantification of bacterial communities during composting Total DNA was extracted from 0.4 g compost samples using PowersoilTM DNA kits (MoBio Laboratories, USA), according to the manufacturer’s instructions. The number of 16S rRNA gene copies was estimated per gram of compost by quantitative PCR using a StepOne™ Real-Time PCR System with SYBR® Green I. The primers Eub338 (5' - ACTCCTACGGGAGGCAGCAG - 3') and Eub518 (5' ATTACCGCGGCTGCTGG - 3') [29] were used for quantifying, and they generated fragments of approximately 200 bp. Amplification was performed by applying the following conditions: 95 ºC for 3 min, 35 cycles at 94 ºC for 30 s, 55 ºC for 30 s, and 72 ºC for 30 s. The final reaction volume
was 25 µL, which contained 12.5 µL of SYBR® Green PCR Master Mix (Applied Biosystems®), 0.20 pmol μL-1 of each primer, 0.10 mg mL-1 BSA, 50 ng of template DNA and Milli-Q water to complete the reaction volume. Standard curves were obtained by performing amplifications with the number of known copies of the template DNA added to the reaction. In this way, the amplification data for the DNA extracted from the compost were interpolated with the standard curve to determine the number of copies of the gene of interest. Analysis of the bacterial community structure with terminal restriction fragment length polymorphism The bacterial community structure was analyzed using terminal restriction fragment length polymorphism (T-RFLP) of the 16S rRNA gene. The target gene was amplified using the 8fm and 926r primers, with the 8fm primer being labeled with 6-FAM [35]. Enzyme restriction was accomplished using approximately 100 ng of product with 5 U of the HhaI enzyme (Fermentas, São Paulo, Brazil), in accordance with the manufacturer’s instructions. Afterwards, a precipitation was prepared with ethanol/EDTA/sodium acetate, following the protocol of the BigDye ® Terminator v3.1 Cycle Sequencing Kit. Samples were prepared for analysis following the instructions in the BigDye® manual using the GS600LIZ marker (Life Technologies) and they were analyzed in a 3500 Genetic Analyzer (Applied Biosystems, Life Technologies). The results were evaluated using the GeneMapper® 4.1 software with a cut-off line at 50 fluorescence units in order to remove background noise. The table with peak intensities was exported and the bacterial community profiles were grouped based on principal coordinates analysis (PCoA) using PAST 3.03 software [18].
Analysis of the bacterial community structure using high-throughput sequencing of the V4 region of the 16S rRNA gene High-throughput sequencing of the V4 hypervariable region from the 16S rRNA gene was performed using the primers 515F and 806R [7]. This analysis was carried out according to the sampling time, with four samples for each period. To perform the sequencing, the three replicates were pooled, since the T-RFLP technique did not reveal changes in the bacterial community structure between replicates (Supplementary Fig. S3). The amplification conditions employed were the following: 94 oC for 4 min; 35 cycles at 94 ºC for 30 s; 63 ºC for 1 min and 72 ºC for 1 min; followed by a final extension at 72 ºC for 10 min. The reagents used were: 3.75 mM MgCl2, 0.2 mM dNTP (Invitrogen Corporation, USA), 0.05 U μL-1 of premium Taq polymerase (Invitrogen Corporation, USA), 1X Taq polymerase buffer (Tris-HCl 1 mmol L-1, pH 9.0 and KCl 5 mmol L-1) (Invitrogen Corporation, USA), 0.2 μM of each primer, 1 μL DNA (50 ng), and Milli-Q water to complete the reaction volume. Sequencing was conducted in a MiSeqTM System (Illumina) with a MiSeq Reagent v2 (500 cycles) kit. The QIIME platform was used to analyze the sequencing [6]. Briefly, the reads (R1 and R2) were joined using the command join_paired_ends.py. Sequences were clustered using the UCLUST method at a similarity of 97%. Taxonomic affiliations were determined against the Greengenes database. The algorithm FastTree was used to allocate the sequences to phylogenetic trees. A phylogenetic abundance plot was constructed, and beta diversity was estimated using the Bray-Curtis distance index.
Phosphorus analyses and chemical analyses of the compost Compost was air dried and sieved through 2 mm pore size mesh prior to sequential P fractionation, following the methodology proposed by Hedley et al. [20] with modifications by Condron et al. [11]. P was extracted sequentially from 0.5 g dry compost samples in the following order: water (PW), 0.5 M NaHCO3 at pH 8.5 (PBIC), 0.1 M NaOH (PHID-0.1), 1.0 M HCl (PHCl) and 0.5 M NaOH (PHID-0.5). The remaining compost was oven dried and digested with H2SO4 + H2O2 to determine the residual P (PResidual). P concentrations in the acid extracts were determined using the Murphy and Riley [28] method. Inorganic P (Pi) fractions in the alkaline extracts (NaHCO3 and NaOH) were determined using the Dick and Tabatabai [13] method. Total P in the alkaline extracts was determined by digesting with ammonium persulfate + H2SO4 in an autoclave [40]. Organic P (Po) was estimated by calculating the difference between total P and Pi in the various fractions. Compost P fractions were grouped according to their lability predicted by the extractants [33]. Labile P: Pw, PiBIC and PoBIC; moderately labile P: PHID-0.1 (Pi and Po) and PHCl, and non-labile P included PHID-0.5 (Pi and Po) and PResidual. The following chemical attributes of the compost samples were determined: pH, C/N ratio, K, Ca, Mg and citric acid phosphorus (Pac) [1]. Correlation of microbiological and environmental data The physical-chemical data were first transformed in Box-Cox using PAST 3.03 software [18]. The biological data (high-throughput sequencing data) were transformed using the Bray-Curtis distance index, as previously described for the sequence analysis. Both matrices were submitted to a redundancy analysis (RDA) in order to evaluate the
bacterial community structure and the influence of physical and chemical parameters using Canoco for Windows 4.51 (Center for Biometry, Wageningen, Netherlands). The average of the physical and chemical attributes for each sampling time was used in the RDA analysis. Significance (P < 0.05) was tested using a Monte Carlo simulation with 999 permutations. In order to confirm the correlation between the variance of the Bacillus community and that of the P fractions, the PERMANOVA test in the R platform Vegan package was used.
Results and discussion Temperature variation during the composting process and quantification of 16S rRNA gene copies Fig. 1 shows that the temperature in the compost increased rapidly to 50 ºC on the first day and continued to increase up to the 30th day, and then remained above 60 ºC until the end of the evaluation period. The temperature variation correlated with the intensity of the oxidative degradation process of the organic matter. Thus, an increase in temperature indicated high biological activity [31]. No significant differences were found for the temperature between treatments. The high number of 16S rRNA gene copies (approximately 1010 g-1 of compost) during the 60 days of composting showed that bacterial abundance was fundamental for this process (Fig. 2). In the experiments, there were no significant quantitative differences between treatments for each sampling time, indicating that the addition of RP and the bacterial inoculant did not affect the bacterial abundance in the compost. However, the numbers of 16S rRNA gene copies in the compost also decreased significantly from 15
DAPC in all treatments. Therefore, it can be assumed that the abundance of 16S rRNA genes determined was higher than the actual cell numbers because the bacteria may have had a distinct 16S rRNA operon copy number according to the species [23]. However, Chandna et al. [9], who used a different counting technique in the culture medium, did not report the same tendency, since they found a reduction in the number of bacteria from 109 UFC g-1 at the start of composting to 107 UFC g-1 in the thermophilic and mature phases. Relationship between bacterial community structure and the physical and chemical parameters Using both methodologies, T-RFLP and high-throughput sequencing, it was verified that the changes that occurred in the bacterial community were predominantly temporal (Supplementary Fig. S3 and Fig. 3). Starting at 15 DAPC, it was observed that the bacterial community structure differed in its composition compared to later dates. There was bacterial community succession soon after the start of the composting process, but there were similarities between the compositions at 45 and 60 DAPC, suggesting that from 45 DAPC onwards the bacterial community structure was relatively stable. The chemical attributes pH and C/N ratio differed significantly from one date to another, and explained the changes in the bacterial community as composting progressed, since they had an explanatory power of 32% and 12%, respectively (Monte Carlo test at 5%). The dominant phylum during composting was Firmicutes and the bacterial community succession over time primarily comprised the orders Lactobacillales, Bacillales and Clostridiales (Fig. 4). No OTUs from the genus Pseudomonas were found
during the process. The strain Pseudomonas aeruginosa PSBR12, which was inoculated into the compost at the very beginning of composting, probably did not become established in the process or did not achieve detectable numbers because of the high composting temperature. At the start of composting, the large quantity of rapidly degradable organic compounds in the raw materials used in the piles and the C/N ratio of approximately 30 must have stimulated bacterial growth, primarily of the order Lactobacillales, thus causing the heating of the piles during the initial phase. Under low oxygen pressure conditions, bacteria from the order Lactobacillales produce organic acids, primarily lactic acid, as a product of sugar fermentation, which could explain the low pH at the start of composting [22]. Lactobacillales can also produce hydrogen peroxide, bacteriocins and antibiotics, which perhaps may help to explain the reduced presence of other groups of bacteria at the start of composting [2]. The RDA confirmed that the presence of Lactobacillales correlated significantly with the low pH at the start of composting (Fig. 3). From 15 DAPC onwards, a reduction of Lactobacillales and an increase of Clostridiales occurred, probably due to the increasing pH. Low pH is known to be a limiting factor for growth of the genus Clostridium, which belongs to the order Clostridiales [26]. On the other hand, the surge and development of obligate anaerobes, such as Clostridium, suggested that there were quite a lot of anaerobic micro-niches within the aggregates of the compost. The increase in Bacillales, as well as Clostridiales, after 15 DAPC could have also been primarily associated with the increase in pH. Genera belonging to these orders would have degraded the organic acids previously produced by lactic acid bacteria,
causing a rise in pH and inhibiting the growth of Lactobacillales. The results corroborated those of Partanen et al. [32], who detected great abundance of lactic acid bacteria, such as Acetobacter and Lactobacillus during low pH phases when composting domestic waste. Bacillus is a genus that possesses the ability to produce catabolic enzymes, such as proteases, which can increase pH during the proteolytic process. Bacteria belonging to the orders Clostridiales and Bacillales also possess the capacity to metabolize more recalcitrant substrates, such as cellulose and lignin, which may give them an advantage when sources of more easily degradable nutrients are exhausted [39]. Ishii et al. [22] found similar results using the DGGE technique. They described how, at the start of composting, fermenting bacteria producing organic acids dominated the composting community and how, as the temperature increased, soluble carbon decreased and pH increased, while the succession process was dominated by Bacillus spp. After 30 DAPC, bacteria belonging to the order Bacillales dominated the composting process, probably because of their capacity to withstand high temperatures and to profit from higher pH (Fig. 2). Within the order Bacillales, Bacillus spp. are spore-forming bacteria that exhibit active metabolism up to temperatures of approximately 50-60 °C, and they have the capacity to degrade more recalcitrant substrates [34]. Moreover, bacteria from the order Xanthomonadales were present at the start of composting, and this order includes many groups of plant pathogenic bacteria [12]. In the experiments, their numbers decreased with time, showing that composting was effective in the elimination of potentially pathogenic bacteria, again probably due to the high temperatures within the piles (Fig. 1) [15]. Animal and human pathogens would probably
be equally affected, thus turning the use of organic compost into a secure method for the reuse of different kinds of residues and waste from agriculture. Effect of the inoculants on P availability During P fractionation, from 45 DAPC, significant differences were found in the PHCl and POBIC fractions between the PSB-inoculated and non-inoculated piles (Fig. 5). The PHCl fraction represents the moderately labile inorganic P associated with apatite, other sparingly soluble Ca-P compounds or negatively charged oxide surfaces [17], and it is considered unavailable. The POBIC fraction represents compounds with low recalcitrance, such as ribonucleic acid and glycerophosphate, which are completely and immediately available [37]. During composting, when the piles were inoculated with PSB, a decrease of the unavailable P (PHCl) and an increase in labile and available Po (POBIC) was found. These reactions correlated with the increase of OTUs pertaining to the genus Bacillus. It is possible that the previous inoculation of the Bacillus sp. BACBR01 strain in the piles contributed to establishment and rapid multiplication of this genus, resulting in increasing phosphate solubilization. Previous studies have suggested that composting with RP is an efficient way of increasing the P available to plants [41]. The inoculated strains possessed the capacity to solubilize RP (Supplementary Fig. S1), which was corroborated by the reduction in sparingly soluble Ca-P compounds (PHCl fraction). Dissolution of the non-available P was greater in inoculated compost piles than in the non-inoculated ones. At the end of the composting period, the pH was close to 8, which provided favorable conditions for the formation of calcium phosphates with low
solubility. However, in the presence of PSB inoculation, the synthesis of these compounds decreased. This result strongly suggested that PSB inoculation was an option for improving the quality of the final compost, by providing greater quantities of available P (labile Po). In this study, the bacterial PSB strain reduced the final quantity of Ca-P compounds in the compost by 21%. Billah and Bano [4] also showed that inoculation with Pseudomonas sp., together with the addition of RP, could increase the available P extractable with Mehlich-3 solution by 40%. Conclusions During composting of sugarcane industry residues, the bacterial communities changed with time as the composting process progressed. The most important and dominating bacterial orders modulated during composting were Lactobacillales, Bacillales and Clostridiales, and the changes were primarily influenced by pH and the C/N ratio. It was demonstrated that the addition of PSB was a potential technological option for obtaining compost with a significantly greater amount of available P. However, even larger amounts of P could become available due to reduced binding of P with Ca in the compost, thereby augmenting labile Po.
Acknowledgements The authors are grateful to Financiadora de Estudos e Projetos (FINEP process No. 01.13.0209.00) for financial support. They would also like to thank the engineer Roberto Malimpence from the Baraúna enterprise for technical support and Professors Dr. Moacir
Forim, Dr. Fernando Andreote and Dr. Godofredo Vitti for suggestions and help with the research project.
References [1] Alcarde, J.C. (2009) Manual de análise de fertilizantes. FEALQ, Piracicaba, Brazil, 259 pp. [2] Aoshima, M., Pedro, M.S., Haruta, S., Ding, L., Fukada, T., Kigawa, A., Kodama, T., Ishii, M., Igarashi, Y. (2001) Analyses of microbial community within a composter operated using household garbage with special reference to the addition of soybean oil. J. Biosci. Bioeng. 91, 456–461. [3] Barros, N.F.F., Comerford, N.B., Barros, N.F. (2005) Phosphorus sorption, desorption and resorption by soils of the Brazilian Cerrado supporting eucalypt. Biomass Bioenerg. 28, 229–236. [4] Billah, M., Bano, A. (2015) Role of plant growth promoting rhizobacteria in modulating the efficiency of poultry litter composting with rock phosphate and its effect on growth and yield of wheat. Waste Manage. Res. 33, 63–72. [5] Busato, J.G., Leao, T.P., Baldotto, M.A., Canellas, L.P. (2012) Organic matter quality and dynamics in tropical soils amended with sugar industry residue. Rev. Bras. Ciênc. Solo. 36, 1179–1188. [6] Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fierer, N., Peña, A.G., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Sevinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight, R. (2010) QIIME allows analysis of highthroughput community sequencing data. Nat. Methods. 7, 335–336.
[7] Caporaso, J.G., Lauber, C.L., Walters, W.A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S.M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J.A., Smith, G., Knight, R. (2012) Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 6, 1621–1624. [8] Chandna, P., Mallik, S., Kuhad, R.C. (2013) Assessment of bacterial diversity in agricultural by-product compost by sequencing of cultivated isolates and amplified rDNA restriction analysis. Appl. Microbiol. Biotechnol. 97, 6991–7003. [9] Chandna, P., Nain, L., Singh, S., Kuhad, R.C. (2013) Assessment of bacterial diversity during composting of agricultural by products. BMC Microbiol. 13, 99, http://www.biomedcentral.com/1471-2180/13/99. [10]
CONAB.
(2015).
Companhia
Nacional
de
Abastecimento.
Internet:
http://www.conab.gov.br/conteudos.php?a=1253&. (Consulted 20.08.2016). [11] Condron, L.M., Goh, K.M., Newman, R.H. (1985) Nature and distribution of soil phosphorus as revealed by a sequential extraction method followed by
31
P nuclear
magnetic resonance analysis. Eur. J. Soil Sci. 36, 199–207. [12] Cutiño-Jiménez, A.M., Martins-Pinheiro, M., Lima, W.C., Martin-Tornet, A., Morales, O.G., Menck, C.F.M. (2010) Evolutionary placement of Xanthomonadales based on conserved protein signature sequences. Mol. Phylogenet. Evol. 54, 524–534. [13] Dick, W.A., Tabatabai, M.A. (1977) Determination of orthophosphate in aqueous solutions containing labile organic and inorganic phosphorus compounds. J. Environ. Qual. 6, 82–85. [14] Elouaqoudi, F.Z., Fels, L.E., Amir, S., Merlina, G., Meddich, A., Lemee, L., Ambles, A., Hafidi, M. (2015) Lipid signature of the microbial community structure
during composting of date palm waste alone or mixed with couch grass clippings. Int Biodeterior. Biodegrad. 97, 75–84. [15] Elorrieta, M.A., Suarez-Estrella, F., Lopez, M.J., Vargas-Garcia, M.C., Moreno, J. (2003) Survival of phytopathogenic bacteria during waste composting. Agric. Ecosyst. Environ. 96, 141–146. [16] Estrada, G.A., Baldani, V.L.D., De Oliveira, D.M., Urquiaga, S., Baldani, J.I. (2013) Selection of phosphate-solubilizing diazotrophic Herbaspirillum and Burkholderia strains and their effect on rice crop yield and nutrient uptake. Plant Soil 369, 115–129. [17] Gatiboni, L.C., Kaminski, J., Rheinheimer, D.S., Flores, J.P.C. (2007) Biodisponibilidade de formas de fósforo acumuladas em solo sob sistema plantio direto. Rev. Bras. Ciênc. Solo 31, 691–699. [18] Hammer, O., Harper, D.A.T., Ryan, P.D. (2001) Past: paleontological statistical software package for education and data analysis. Paleontol. Electron. 4, 1–9. [19] He, Y., Xie, K., Xu, P., Huang, X., Gu, W., Zhang, F., Tang, S. (2013) Evolution of microbial community diversity and enzymatic activity during composting. Res. Microbiol. 164, 189–198. [20] Hedley, M.J., Stewart, J.W.B., Chauhan, B.S. (1982) Changes in inorganic and organic soil phosphorus fractions induced by cultivation practices and by laboratory incubations. Soil Sci. Soc. Am. J. 46, 970–976. [21] Hernández, T., Garcia, E., Garcia, C. (2015) A strategy for marginal semiarid degraded soil restoration: A sole addition of compost at a high rate. A five-year field experiment. Soil Biol. Biochem. 89, 61–71.
[22] Ishii, K., Fukui, M., Takii, S. (2000) Microbial succession during a composting process as evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 89, 768–777. [23] Klappenbach, J.A., Sayman, P.R., Cole, J.R., Schmidt, T.M. (2001) rrndb: the Ribosomal RNA Operon Copy Number Database. Nucleic Acids Res. 29, 181–184. [24] Kumar, S. (2011) Composting of municipal solid waste. Crit. Rev. Biotechnol. 31 (2), 112–136. [25] Kumar, R., Verma, D., Singh, B.L., Kumar, U., Shweta. (2010) Composting of sugar-cane waste by-products through treatment with microorganisms and subsequent vermicomposting. Bioresour. Technol. 101, 6707–6711. [26] Li, T., Tian, R., Cai, K., Wang, Q., Chen, F., Fang, H., Luo, S., Li, Z., Wang, D., Hou, X., Wang, H. (2013) The effect of pH on growth of Clostridium botulinum type A and expression of bontA and botR during different growth stages. Foodborne Pathog. Dis. 10, 692–697. [27] Meunchang, S., Panichsakpatana, S., Weaver, R.W. (2005) Co-composting of filter cake and bagasse; by-products from a sugar mill. Bioresour. Technol. 96, 437–442. [28] Murphy, J., Riley, J.P. (1962) A modified single solution method for the determination of phosphate in natural waters. Anal. Chim. Acta 27, 31–36. [29] Muyzer, G., De Waal, E.C., Uitterlinden, A.G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695– 700.
[30] Owen, D., Williams, A.P., Griffith, G.W., Withers, P.J.A. (2015) Use of commercial bio-inoculants to increase agricultural production through improved phosphorus acquisition. Appl. Soil Ecol. 86, 41–54. [31] Pagans, E., Barrena, R., Font, X., Sanchez, A. (2006) Ammonia emissions from the composting of different organic wastes. Dependency on process temperature. Chemosphere 62, 1534–1542. [32] Partanen, P., Hultman, J., Paulin, L., Auvinen, P., Romantschuk, M. (2010) Bacterial diversity at different stages of the composting process. BMC Microbiol. 10, 94, http://www.biomedcentral.com/1471-2180/10/94. [33] Rodrigues, M., Pavinato, P.S., Withers, P.J.A., Teles, A.P.B., Herrera, W.F.B. (2015) Legacy phosphorus and no tillage agriculture in tropical Oxisols of the Brazilian savanna. Sci. Total Environ. 542, 1050–1061. [34] Ryckeboer, J., Mergaert, J., Vaes, K., Klammer, S., De Clercq, D., Coosemans, J., Insam, H., Swings, J. (2003) A survey of bacteria and fungi occurring during composting and self-heating processes. Ann. Microbiol. 53 (4), 349–410. [35] Schütte, U.M.E., Abdo, Z., Bent, S.J., Williams, C.J., Schneider, G.M., Solheim, B., Forney, L.J. (2009) Bacterial succession in a glacier foreland of the high Arctic. ISME J. 3, 1258–1268. [36] Sundara-Rao, W.V.B., Sinha, M.K. (1963) Phosphate dissolving microorganisms in the soil and rhizosphere. Indian J. Agric. Sci. 33, 272–278. [37] Tiessen, H., Moir, J.O. (1993) Characterization of available P by sequential extraction. In: Carter, M.R. (Ed.), Soil Sampling and Methods of Analysis Canadian Society of Soil Science. Lewis Publications, Boca Raton, pp. 75–86.
[38] Tortosa, G., Castellano-Hinojosa, A., Correa-Galeote, D., Bedmar, E.J. (2017) Evolution of bacterial diversity during two-phase olive mill waste (“alperujo”) composting by 16S rRNA gene pyrosequencing. Bioresour. Technol. 224, 101–111. [39] Watanabe, K., Nagao, N., Toda, T., Kurosawa, N. (2009) The dominant bacteria shifted from the order “Lactobacillales” to Bacillales and Actinomycetales during a startup period of large-scale, completely-mixed composting reactor using plastic bottle flakes as bulking agent. World J. Microbiol. Biotechnol. 25, 803–811. [40] USEPA - United States Environmental Protection Agency. (1971) Methods of chemical analysis for water and wastes. Environmental Protection Agency, Cincinnati, USA, 312 pp. [41] Vassilev, N., Vassileva, M. (2003) Biotechnological solubilization of rock phosphate on media containing agro-industrial wastes. Appl. Microbiol. Biotechnol. 61, 435–440.
Figure Captions Fig. 1. Changes in temperature over 60 days due to composting of sugarcane industry residue. Bars indicate the standard error for three replicates.
Fig. 2. Bacterial abundance over 60 days during composting of sugarcane industry residue. Bars indicate the standard error for three replicates.
Fig. 3. Redundancy analysis (RDA) showing the relationship between the bacterial community structure and environmental parameters during composting. RDA conducted with the operational taxonomic unit (OTU) profiles obtained using the Illumina platform. * Parameters significant at a probability of 5% according to Monte Carlo testing.
Fig. 4. Dynamics of the bacterial community structure (at the order level) during composting of sugarcane industry residue.
Fig. 5. Dynamics of the inorganic, only moderately labile PHCl fraction and the organic labile POBIC fraction. Bars represent the relative percentage OTUs of the genus Bacillus during composting of sugarcane industry residue.
S0723-2020(17)30065-6 http://dx.doi.org/doi:10.1016/j.syapm.2017.05.003 SYAPM 25838
To appear in: Received date: Revised date: Accepted date:
27-1-2017 6-5-2017 12-5-2017
Please cite this article as: German A.Estrada-Bonilla, Cintia M.Lopes, Ademir Durrer, Paulo R.L.Alves, Nicolle Passaglia, Elke J.B.N.Cardoso, Effect of phosphatesolubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste, Systematic and Applied Microbiologyhttp://dx.doi.org/10.1016/j.syapm.2017.05.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Effect of phosphate-solubilizing bacteria on phosphorus dynamics and the bacterial community during composting of sugarcane industry waste
German A. Estrada-Bonilla1, Cintia M. Lopes1, Ademir Durrer2, Paulo R. L. Alves3, Nicolle Passaglia1, Elke J.B.N. Cardoso 1
1
Department of Soil Sciences, University of São Paulo, Av. Pádua Dias. 11, 13418900,
Piracicaba, SP, Brazil. 2
University of California-Davis, One Shields Avenue, 95616, Davis, CA, USA.
3
Federal University of the Southern Border, Av. Fernando Machado 108 E, 89802112,
Chapecó, SC, Brazil.
*Corresponding author: German Andres Estrada-Bonilla Department of Soil Science, University of São Paulo, Av. Pádua Dias 11, 13416-000 Piracicaba, SP, Brazil. Telephone number: + 55 19 34172142 E-mail: [email protected]
Highlights Wastes were submitted to the composting process inoculated with phosphatesolubilizing bacteria. Inoculation with phosphate-solubilizing bacteria improved phosphorus availability. The main attributes that modulated bacterial community were the pH and C/N ratio. The orders Lactobacillales and Bacillales dominated the composting process. The predominance of the genus Bacillus was responsible for the increase of
labile P. Abstract Sugarcane processing generates a large quantity of residues, such as filter cake and ashes, which are sometimes composted prior to their amendment in soil. However, important issues still have to be addressed on this subject, such as the description of bacterial succession that occurs throughout the composting process and the possibilities of using phosphate-solubilizing bacteria (PSB) during the process to improve phosphorus (P) availability in the compost end product. Consequently, this study evaluated the bacterial diversity and P dynamics during the composting process when inoculated with Pseudomonas aeruginosa PSBR12 and Bacillus sp. BACBR01. To characterize the bacterial community structure during composting, and to compare PSB-inoculated compost with non-inoculated compost, partial sequencing of the bacterial 16S rRNA gene and sequential P fractionation were used. The data indicated that members of the order Lactobacillales prevailed in the early stages of composting for up to 30 days, mostly due to initial changes in pH and the C/N ratio. This dominant bacterial group was then slowly replaced by Bacillales during a composting process of up to 60 days. In addition, inoculation of PSB reduced the levels of Ca-bound P by 21% and increased the labile organic P fraction. In PSB-inoculated compost, Ca-P compound solubilization occurred concomitantly with an increase of the genus Bacillus. The bacterial succession and the final community is described in compost from sugarcane residues and the possible use of these inoculants to improve P availability in the final compost is validated.
Keywords: Phosphorus availability; Inoculant; Bacterial communities; Sequential phosphorus fractionation.
Introduction The sugarcane industry generates large quantities of solid waste, such as filter cake and ash. Currently, an average of 30 kg of filter cake is produced for every tonne of ground sugarcane. During the 2014/15 harvest in Brazil, a total of 634.77 million tonnes of sugarcane were processed [10], which produced approximately 19.04 million tonnes of filter cake. If this organic waste is not correctly disposed of, it can become a source of environmental pollution and may even cause public health problems [24]. Thus, composting is an important method for management of the waste produced by the sugarcane industry [25, 27]. When applied on soil, the resulting compost improves the soil’s physical properties, increasing its porosity and water retention capacity. It also alters the chemical and microbiological characteristics of the soil, enriching it with humic substances and macro- and micronutrients [21]. During composting, the microbial community is the most important component involved in recycling the residue but it must overcome a gradual reduction in nutrients and large changes in temperature and water content, as well as oxygen and ammonia levels [34]. Previous studies have described the microbial communities during composting using culture-independent analyses, such as fatty-acid methyl esters (FAMEs), denaturing gradient gel electrophoresis (DGGE), amplified ribosomal rDNA restriction analysis (ARDRA), and high-throughput sequencing technologies [8, 14, 19, 38]. It is therefore of fundamental importance to understand other microbiological aspects, especially the succession of populations during the sequential composting process, in order to improve the physical and chemical characteristics of the final product.
Highly weathered tropical soils are typically poor in available phosphorus (P) and have a high P fixation capacity [3]. Composting of sugarcane processing waste normally results in high P levels, primarily in organic forms. Thus, compost application provides a steady supply of mineralizable P, and improves its availability in such highly weathered soils [5]. Concurrently, it is also known that phosphate-solubilizing bacteria (PSB) are important for P solubilization of phosphate minerals and mineralization of organic P compounds [30]. However, there are few studies describing the use of PSB to increase the availability of P during composting. However, Billah and Bano [4] reported increases of up to 40% in the quantity of available P when compost piles were inoculated with a strain of Pseudomonas sp. Compost with a higher quantity of available P has great potential for application in tropical soils. Hence, the main objective of the current study was to detail the effect of PSB addition on P availability in compost and to describe the structure of the bacterial communities during this process.
Materials and Methods Compost piles and treatments The dimensions of the compost piles were 3.2 x 1.6 x 25 m (base x height x length), with a separation of 5 m between them. All compost piles were prepared using two parts of filter cake (1,400 kg m-1) to one part of boiler and fly ash (700 kg m-1) together with laying chicken manure (380 kg m-1). For treatments including rock phosphate (RP), a further 2% (42 kg m-1) of powdered (particle size smaller than 0.074 mm) RP was
pulverized over the piles. The chemical composition of the RP used was: total P2O5 (271.0 g kg-1); citric acid P2O5 (46.0 g kg-1); CaO (357.5 g kg-1); Fe2O3 (171.3 g kg-1). During composting, the temperature was monitored daily at five different points in the pile and a minimum humidity of 30% was maintained throughout the composting period. Moisture was conserved weekly by turning the pile over (to improve water evaporation) or by adding water whenever necessary. The experimental design included full randomization, with four treatments and three repetitions, giving a total of 12 compost piles. The treatments tested were as follows: 1filter cake + ash (Standard); 2- filter cake + ash + RP (RP); 3- filter cake + ash + inoculant (Standard + Inoculant). ; 4- filter cake + ash + RP + inoculant (RP + Inoculant). The composting period was 60 days and the piles were turned over at least every seven days. Samples were taken every 15 days for chemical and biological analyses from five different levels within the mid 15 m of each pile, and these were mixed to obtain a composite sample for each replicate. Phosphate-solubilizing strains and preparation of the inoculant Prior to the experiment described above, bacterial strains were isolated from composting piles of industrial sugarcane residues, located at the same site where the study was later conducted. Sixty-five bacterial strains were isolated either at the start of the composting process (mesophilic phase) or 15 days later, when temperatures were approximately 60 oC (thermophilic phase). Afterwards, strains were selected according to their ability to solubilize P in vitro in an SMRS1 liquid medium [36]. The two best Psolubilizing bacterial strains were selected (Supplementary Fig. S1) and identified as
Pseudomonas aeruginosa PSBR12 (from the mesophilic phase) and Bacillus sp. BacBR1 (from the thermophilic phase) (Supplementary Fig. S2). The accession numbers of their sequences are reported in the GenBank database. Initially, these strains were grown separately in a 13 L Tecnopon fermenter loaded with 10 L of LB medium maintained for 15 h at 300 rpm and 30 °C, with an airflow of 10 L min-1. The number of viable cells was determined using the LB medium microplate method [16]. At the end of fermentation, concentrations of 10 9 cells mL-1 of each strain were counted. Before application, equal volumes of each of the bacterial suspensions were mixed and the inoculant was then diluted in 50 L of water, which was applied at a dosage of 8 L Mg-1 compost and a concentration of 10 8 cells mL-1 for each strain. The inoculant was added at the start of the experiment and again 30 days after construction of the piles (DAPC). Bacterial communities Extraction of total DNA and quantification of bacterial communities during composting Total DNA was extracted from 0.4 g compost samples using PowersoilTM DNA kits (MoBio Laboratories, USA), according to the manufacturer’s instructions. The number of 16S rRNA gene copies was estimated per gram of compost by quantitative PCR using a StepOne™ Real-Time PCR System with SYBR® Green I. The primers Eub338 (5' - ACTCCTACGGGAGGCAGCAG - 3') and Eub518 (5' ATTACCGCGGCTGCTGG - 3') [29] were used for quantifying, and they generated fragments of approximately 200 bp. Amplification was performed by applying the following conditions: 95 ºC for 3 min, 35 cycles at 94 ºC for 30 s, 55 ºC for 30 s, and 72 ºC for 30 s. The final reaction volume
was 25 µL, which contained 12.5 µL of SYBR® Green PCR Master Mix (Applied Biosystems®), 0.20 pmol μL-1 of each primer, 0.10 mg mL-1 BSA, 50 ng of template DNA and Milli-Q water to complete the reaction volume. Standard curves were obtained by performing amplifications with the number of known copies of the template DNA added to the reaction. In this way, the amplification data for the DNA extracted from the compost were interpolated with the standard curve to determine the number of copies of the gene of interest. Analysis of the bacterial community structure with terminal restriction fragment length polymorphism The bacterial community structure was analyzed using terminal restriction fragment length polymorphism (T-RFLP) of the 16S rRNA gene. The target gene was amplified using the 8fm and 926r primers, with the 8fm primer being labeled with 6-FAM [35]. Enzyme restriction was accomplished using approximately 100 ng of product with 5 U of the HhaI enzyme (Fermentas, São Paulo, Brazil), in accordance with the manufacturer’s instructions. Afterwards, a precipitation was prepared with ethanol/EDTA/sodium acetate, following the protocol of the BigDye ® Terminator v3.1 Cycle Sequencing Kit. Samples were prepared for analysis following the instructions in the BigDye® manual using the GS600LIZ marker (Life Technologies) and they were analyzed in a 3500 Genetic Analyzer (Applied Biosystems, Life Technologies). The results were evaluated using the GeneMapper® 4.1 software with a cut-off line at 50 fluorescence units in order to remove background noise. The table with peak intensities was exported and the bacterial community profiles were grouped based on principal coordinates analysis (PCoA) using PAST 3.03 software [18].
Analysis of the bacterial community structure using high-throughput sequencing of the V4 region of the 16S rRNA gene High-throughput sequencing of the V4 hypervariable region from the 16S rRNA gene was performed using the primers 515F and 806R [7]. This analysis was carried out according to the sampling time, with four samples for each period. To perform the sequencing, the three replicates were pooled, since the T-RFLP technique did not reveal changes in the bacterial community structure between replicates (Supplementary Fig. S3). The amplification conditions employed were the following: 94 oC for 4 min; 35 cycles at 94 ºC for 30 s; 63 ºC for 1 min and 72 ºC for 1 min; followed by a final extension at 72 ºC for 10 min. The reagents used were: 3.75 mM MgCl2, 0.2 mM dNTP (Invitrogen Corporation, USA), 0.05 U μL-1 of premium Taq polymerase (Invitrogen Corporation, USA), 1X Taq polymerase buffer (Tris-HCl 1 mmol L-1, pH 9.0 and KCl 5 mmol L-1) (Invitrogen Corporation, USA), 0.2 μM of each primer, 1 μL DNA (50 ng), and Milli-Q water to complete the reaction volume. Sequencing was conducted in a MiSeqTM System (Illumina) with a MiSeq Reagent v2 (500 cycles) kit. The QIIME platform was used to analyze the sequencing [6]. Briefly, the reads (R1 and R2) were joined using the command join_paired_ends.py. Sequences were clustered using the UCLUST method at a similarity of 97%. Taxonomic affiliations were determined against the Greengenes database. The algorithm FastTree was used to allocate the sequences to phylogenetic trees. A phylogenetic abundance plot was constructed, and beta diversity was estimated using the Bray-Curtis distance index.
Phosphorus analyses and chemical analyses of the compost Compost was air dried and sieved through 2 mm pore size mesh prior to sequential P fractionation, following the methodology proposed by Hedley et al. [20] with modifications by Condron et al. [11]. P was extracted sequentially from 0.5 g dry compost samples in the following order: water (PW), 0.5 M NaHCO3 at pH 8.5 (PBIC), 0.1 M NaOH (PHID-0.1), 1.0 M HCl (PHCl) and 0.5 M NaOH (PHID-0.5). The remaining compost was oven dried and digested with H2SO4 + H2O2 to determine the residual P (PResidual). P concentrations in the acid extracts were determined using the Murphy and Riley [28] method. Inorganic P (Pi) fractions in the alkaline extracts (NaHCO3 and NaOH) were determined using the Dick and Tabatabai [13] method. Total P in the alkaline extracts was determined by digesting with ammonium persulfate + H2SO4 in an autoclave [40]. Organic P (Po) was estimated by calculating the difference between total P and Pi in the various fractions. Compost P fractions were grouped according to their lability predicted by the extractants [33]. Labile P: Pw, PiBIC and PoBIC; moderately labile P: PHID-0.1 (Pi and Po) and PHCl, and non-labile P included PHID-0.5 (Pi and Po) and PResidual. The following chemical attributes of the compost samples were determined: pH, C/N ratio, K, Ca, Mg and citric acid phosphorus (Pac) [1]. Correlation of microbiological and environmental data The physical-chemical data were first transformed in Box-Cox using PAST 3.03 software [18]. The biological data (high-throughput sequencing data) were transformed using the Bray-Curtis distance index, as previously described for the sequence analysis. Both matrices were submitted to a redundancy analysis (RDA) in order to evaluate the
bacterial community structure and the influence of physical and chemical parameters using Canoco for Windows 4.51 (Center for Biometry, Wageningen, Netherlands). The average of the physical and chemical attributes for each sampling time was used in the RDA analysis. Significance (P < 0.05) was tested using a Monte Carlo simulation with 999 permutations. In order to confirm the correlation between the variance of the Bacillus community and that of the P fractions, the PERMANOVA test in the R platform Vegan package was used.
Results and discussion Temperature variation during the composting process and quantification of 16S rRNA gene copies Fig. 1 shows that the temperature in the compost increased rapidly to 50 ºC on the first day and continued to increase up to the 30th day, and then remained above 60 ºC until the end of the evaluation period. The temperature variation correlated with the intensity of the oxidative degradation process of the organic matter. Thus, an increase in temperature indicated high biological activity [31]. No significant differences were found for the temperature between treatments. The high number of 16S rRNA gene copies (approximately 1010 g-1 of compost) during the 60 days of composting showed that bacterial abundance was fundamental for this process (Fig. 2). In the experiments, there were no significant quantitative differences between treatments for each sampling time, indicating that the addition of RP and the bacterial inoculant did not affect the bacterial abundance in the compost. However, the numbers of 16S rRNA gene copies in the compost also decreased significantly from 15
DAPC in all treatments. Therefore, it can be assumed that the abundance of 16S rRNA genes determined was higher than the actual cell numbers because the bacteria may have had a distinct 16S rRNA operon copy number according to the species [23]. However, Chandna et al. [9], who used a different counting technique in the culture medium, did not report the same tendency, since they found a reduction in the number of bacteria from 109 UFC g-1 at the start of composting to 107 UFC g-1 in the thermophilic and mature phases. Relationship between bacterial community structure and the physical and chemical parameters Using both methodologies, T-RFLP and high-throughput sequencing, it was verified that the changes that occurred in the bacterial community were predominantly temporal (Supplementary Fig. S3 and Fig. 3). Starting at 15 DAPC, it was observed that the bacterial community structure differed in its composition compared to later dates. There was bacterial community succession soon after the start of the composting process, but there were similarities between the compositions at 45 and 60 DAPC, suggesting that from 45 DAPC onwards the bacterial community structure was relatively stable. The chemical attributes pH and C/N ratio differed significantly from one date to another, and explained the changes in the bacterial community as composting progressed, since they had an explanatory power of 32% and 12%, respectively (Monte Carlo test at 5%). The dominant phylum during composting was Firmicutes and the bacterial community succession over time primarily comprised the orders Lactobacillales, Bacillales and Clostridiales (Fig. 4). No OTUs from the genus Pseudomonas were found
during the process. The strain Pseudomonas aeruginosa PSBR12, which was inoculated into the compost at the very beginning of composting, probably did not become established in the process or did not achieve detectable numbers because of the high composting temperature. At the start of composting, the large quantity of rapidly degradable organic compounds in the raw materials used in the piles and the C/N ratio of approximately 30 must have stimulated bacterial growth, primarily of the order Lactobacillales, thus causing the heating of the piles during the initial phase. Under low oxygen pressure conditions, bacteria from the order Lactobacillales produce organic acids, primarily lactic acid, as a product of sugar fermentation, which could explain the low pH at the start of composting [22]. Lactobacillales can also produce hydrogen peroxide, bacteriocins and antibiotics, which perhaps may help to explain the reduced presence of other groups of bacteria at the start of composting [2]. The RDA confirmed that the presence of Lactobacillales correlated significantly with the low pH at the start of composting (Fig. 3). From 15 DAPC onwards, a reduction of Lactobacillales and an increase of Clostridiales occurred, probably due to the increasing pH. Low pH is known to be a limiting factor for growth of the genus Clostridium, which belongs to the order Clostridiales [26]. On the other hand, the surge and development of obligate anaerobes, such as Clostridium, suggested that there were quite a lot of anaerobic micro-niches within the aggregates of the compost. The increase in Bacillales, as well as Clostridiales, after 15 DAPC could have also been primarily associated with the increase in pH. Genera belonging to these orders would have degraded the organic acids previously produced by lactic acid bacteria,
causing a rise in pH and inhibiting the growth of Lactobacillales. The results corroborated those of Partanen et al. [32], who detected great abundance of lactic acid bacteria, such as Acetobacter and Lactobacillus during low pH phases when composting domestic waste. Bacillus is a genus that possesses the ability to produce catabolic enzymes, such as proteases, which can increase pH during the proteolytic process. Bacteria belonging to the orders Clostridiales and Bacillales also possess the capacity to metabolize more recalcitrant substrates, such as cellulose and lignin, which may give them an advantage when sources of more easily degradable nutrients are exhausted [39]. Ishii et al. [22] found similar results using the DGGE technique. They described how, at the start of composting, fermenting bacteria producing organic acids dominated the composting community and how, as the temperature increased, soluble carbon decreased and pH increased, while the succession process was dominated by Bacillus spp. After 30 DAPC, bacteria belonging to the order Bacillales dominated the composting process, probably because of their capacity to withstand high temperatures and to profit from higher pH (Fig. 2). Within the order Bacillales, Bacillus spp. are spore-forming bacteria that exhibit active metabolism up to temperatures of approximately 50-60 °C, and they have the capacity to degrade more recalcitrant substrates [34]. Moreover, bacteria from the order Xanthomonadales were present at the start of composting, and this order includes many groups of plant pathogenic bacteria [12]. In the experiments, their numbers decreased with time, showing that composting was effective in the elimination of potentially pathogenic bacteria, again probably due to the high temperatures within the piles (Fig. 1) [15]. Animal and human pathogens would probably
be equally affected, thus turning the use of organic compost into a secure method for the reuse of different kinds of residues and waste from agriculture. Effect of the inoculants on P availability During P fractionation, from 45 DAPC, significant differences were found in the PHCl and POBIC fractions between the PSB-inoculated and non-inoculated piles (Fig. 5). The PHCl fraction represents the moderately labile inorganic P associated with apatite, other sparingly soluble Ca-P compounds or negatively charged oxide surfaces [17], and it is considered unavailable. The POBIC fraction represents compounds with low recalcitrance, such as ribonucleic acid and glycerophosphate, which are completely and immediately available [37]. During composting, when the piles were inoculated with PSB, a decrease of the unavailable P (PHCl) and an increase in labile and available Po (POBIC) was found. These reactions correlated with the increase of OTUs pertaining to the genus Bacillus. It is possible that the previous inoculation of the Bacillus sp. BACBR01 strain in the piles contributed to establishment and rapid multiplication of this genus, resulting in increasing phosphate solubilization. Previous studies have suggested that composting with RP is an efficient way of increasing the P available to plants [41]. The inoculated strains possessed the capacity to solubilize RP (Supplementary Fig. S1), which was corroborated by the reduction in sparingly soluble Ca-P compounds (PHCl fraction). Dissolution of the non-available P was greater in inoculated compost piles than in the non-inoculated ones. At the end of the composting period, the pH was close to 8, which provided favorable conditions for the formation of calcium phosphates with low
solubility. However, in the presence of PSB inoculation, the synthesis of these compounds decreased. This result strongly suggested that PSB inoculation was an option for improving the quality of the final compost, by providing greater quantities of available P (labile Po). In this study, the bacterial PSB strain reduced the final quantity of Ca-P compounds in the compost by 21%. Billah and Bano [4] also showed that inoculation with Pseudomonas sp., together with the addition of RP, could increase the available P extractable with Mehlich-3 solution by 40%. Conclusions During composting of sugarcane industry residues, the bacterial communities changed with time as the composting process progressed. The most important and dominating bacterial orders modulated during composting were Lactobacillales, Bacillales and Clostridiales, and the changes were primarily influenced by pH and the C/N ratio. It was demonstrated that the addition of PSB was a potential technological option for obtaining compost with a significantly greater amount of available P. However, even larger amounts of P could become available due to reduced binding of P with Ca in the compost, thereby augmenting labile Po.
Acknowledgements The authors are grateful to Financiadora de Estudos e Projetos (FINEP process No. 01.13.0209.00) for financial support. They would also like to thank the engineer Roberto Malimpence from the Baraúna enterprise for technical support and Professors Dr. Moacir
Forim, Dr. Fernando Andreote and Dr. Godofredo Vitti for suggestions and help with the research project.
References [1] Alcarde, J.C. (2009) Manual de análise de fertilizantes. FEALQ, Piracicaba, Brazil, 259 pp. [2] Aoshima, M., Pedro, M.S., Haruta, S., Ding, L., Fukada, T., Kigawa, A., Kodama, T., Ishii, M., Igarashi, Y. (2001) Analyses of microbial community within a composter operated using household garbage with special reference to the addition of soybean oil. J. Biosci. Bioeng. 91, 456–461. [3] Barros, N.F.F., Comerford, N.B., Barros, N.F. (2005) Phosphorus sorption, desorption and resorption by soils of the Brazilian Cerrado supporting eucalypt. Biomass Bioenerg. 28, 229–236. [4] Billah, M., Bano, A. (2015) Role of plant growth promoting rhizobacteria in modulating the efficiency of poultry litter composting with rock phosphate and its effect on growth and yield of wheat. Waste Manage. Res. 33, 63–72. [5] Busato, J.G., Leao, T.P., Baldotto, M.A., Canellas, L.P. (2012) Organic matter quality and dynamics in tropical soils amended with sugar industry residue. Rev. Bras. Ciênc. Solo. 36, 1179–1188. [6] Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fierer, N., Peña, A.G., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Sevinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight, R. (2010) QIIME allows analysis of highthroughput community sequencing data. Nat. Methods. 7, 335–336.
[7] Caporaso, J.G., Lauber, C.L., Walters, W.A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S.M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J.A., Smith, G., Knight, R. (2012) Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 6, 1621–1624. [8] Chandna, P., Mallik, S., Kuhad, R.C. (2013) Assessment of bacterial diversity in agricultural by-product compost by sequencing of cultivated isolates and amplified rDNA restriction analysis. Appl. Microbiol. Biotechnol. 97, 6991–7003. [9] Chandna, P., Nain, L., Singh, S., Kuhad, R.C. (2013) Assessment of bacterial diversity during composting of agricultural by products. BMC Microbiol. 13, 99, http://www.biomedcentral.com/1471-2180/13/99. [10]
CONAB.
(2015).
Companhia
Nacional
de
Abastecimento.
Internet:
http://www.conab.gov.br/conteudos.php?a=1253&. (Consulted 20.08.2016). [11] Condron, L.M., Goh, K.M., Newman, R.H. (1985) Nature and distribution of soil phosphorus as revealed by a sequential extraction method followed by
31
P nuclear
magnetic resonance analysis. Eur. J. Soil Sci. 36, 199–207. [12] Cutiño-Jiménez, A.M., Martins-Pinheiro, M., Lima, W.C., Martin-Tornet, A., Morales, O.G., Menck, C.F.M. (2010) Evolutionary placement of Xanthomonadales based on conserved protein signature sequences. Mol. Phylogenet. Evol. 54, 524–534. [13] Dick, W.A., Tabatabai, M.A. (1977) Determination of orthophosphate in aqueous solutions containing labile organic and inorganic phosphorus compounds. J. Environ. Qual. 6, 82–85. [14] Elouaqoudi, F.Z., Fels, L.E., Amir, S., Merlina, G., Meddich, A., Lemee, L., Ambles, A., Hafidi, M. (2015) Lipid signature of the microbial community structure
during composting of date palm waste alone or mixed with couch grass clippings. Int Biodeterior. Biodegrad. 97, 75–84. [15] Elorrieta, M.A., Suarez-Estrella, F., Lopez, M.J., Vargas-Garcia, M.C., Moreno, J. (2003) Survival of phytopathogenic bacteria during waste composting. Agric. Ecosyst. Environ. 96, 141–146. [16] Estrada, G.A., Baldani, V.L.D., De Oliveira, D.M., Urquiaga, S., Baldani, J.I. (2013) Selection of phosphate-solubilizing diazotrophic Herbaspirillum and Burkholderia strains and their effect on rice crop yield and nutrient uptake. Plant Soil 369, 115–129. [17] Gatiboni, L.C., Kaminski, J., Rheinheimer, D.S., Flores, J.P.C. (2007) Biodisponibilidade de formas de fósforo acumuladas em solo sob sistema plantio direto. Rev. Bras. Ciênc. Solo 31, 691–699. [18] Hammer, O., Harper, D.A.T., Ryan, P.D. (2001) Past: paleontological statistical software package for education and data analysis. Paleontol. Electron. 4, 1–9. [19] He, Y., Xie, K., Xu, P., Huang, X., Gu, W., Zhang, F., Tang, S. (2013) Evolution of microbial community diversity and enzymatic activity during composting. Res. Microbiol. 164, 189–198. [20] Hedley, M.J., Stewart, J.W.B., Chauhan, B.S. (1982) Changes in inorganic and organic soil phosphorus fractions induced by cultivation practices and by laboratory incubations. Soil Sci. Soc. Am. J. 46, 970–976. [21] Hernández, T., Garcia, E., Garcia, C. (2015) A strategy for marginal semiarid degraded soil restoration: A sole addition of compost at a high rate. A five-year field experiment. Soil Biol. Biochem. 89, 61–71.
[22] Ishii, K., Fukui, M., Takii, S. (2000) Microbial succession during a composting process as evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 89, 768–777. [23] Klappenbach, J.A., Sayman, P.R., Cole, J.R., Schmidt, T.M. (2001) rrndb: the Ribosomal RNA Operon Copy Number Database. Nucleic Acids Res. 29, 181–184. [24] Kumar, S. (2011) Composting of municipal solid waste. Crit. Rev. Biotechnol. 31 (2), 112–136. [25] Kumar, R., Verma, D., Singh, B.L., Kumar, U., Shweta. (2010) Composting of sugar-cane waste by-products through treatment with microorganisms and subsequent vermicomposting. Bioresour. Technol. 101, 6707–6711. [26] Li, T., Tian, R., Cai, K., Wang, Q., Chen, F., Fang, H., Luo, S., Li, Z., Wang, D., Hou, X., Wang, H. (2013) The effect of pH on growth of Clostridium botulinum type A and expression of bontA and botR during different growth stages. Foodborne Pathog. Dis. 10, 692–697. [27] Meunchang, S., Panichsakpatana, S., Weaver, R.W. (2005) Co-composting of filter cake and bagasse; by-products from a sugar mill. Bioresour. Technol. 96, 437–442. [28] Murphy, J., Riley, J.P. (1962) A modified single solution method for the determination of phosphate in natural waters. Anal. Chim. Acta 27, 31–36. [29] Muyzer, G., De Waal, E.C., Uitterlinden, A.G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695– 700.
[30] Owen, D., Williams, A.P., Griffith, G.W., Withers, P.J.A. (2015) Use of commercial bio-inoculants to increase agricultural production through improved phosphorus acquisition. Appl. Soil Ecol. 86, 41–54. [31] Pagans, E., Barrena, R., Font, X., Sanchez, A. (2006) Ammonia emissions from the composting of different organic wastes. Dependency on process temperature. Chemosphere 62, 1534–1542. [32] Partanen, P., Hultman, J., Paulin, L., Auvinen, P., Romantschuk, M. (2010) Bacterial diversity at different stages of the composting process. BMC Microbiol. 10, 94, http://www.biomedcentral.com/1471-2180/10/94. [33] Rodrigues, M., Pavinato, P.S., Withers, P.J.A., Teles, A.P.B., Herrera, W.F.B. (2015) Legacy phosphorus and no tillage agriculture in tropical Oxisols of the Brazilian savanna. Sci. Total Environ. 542, 1050–1061. [34] Ryckeboer, J., Mergaert, J., Vaes, K., Klammer, S., De Clercq, D., Coosemans, J., Insam, H., Swings, J. (2003) A survey of bacteria and fungi occurring during composting and self-heating processes. Ann. Microbiol. 53 (4), 349–410. [35] Schütte, U.M.E., Abdo, Z., Bent, S.J., Williams, C.J., Schneider, G.M., Solheim, B., Forney, L.J. (2009) Bacterial succession in a glacier foreland of the high Arctic. ISME J. 3, 1258–1268. [36] Sundara-Rao, W.V.B., Sinha, M.K. (1963) Phosphate dissolving microorganisms in the soil and rhizosphere. Indian J. Agric. Sci. 33, 272–278. [37] Tiessen, H., Moir, J.O. (1993) Characterization of available P by sequential extraction. In: Carter, M.R. (Ed.), Soil Sampling and Methods of Analysis Canadian Society of Soil Science. Lewis Publications, Boca Raton, pp. 75–86.
[38] Tortosa, G., Castellano-Hinojosa, A., Correa-Galeote, D., Bedmar, E.J. (2017) Evolution of bacterial diversity during two-phase olive mill waste (“alperujo”) composting by 16S rRNA gene pyrosequencing. Bioresour. Technol. 224, 101–111. [39] Watanabe, K., Nagao, N., Toda, T., Kurosawa, N. (2009) The dominant bacteria shifted from the order “Lactobacillales” to Bacillales and Actinomycetales during a startup period of large-scale, completely-mixed composting reactor using plastic bottle flakes as bulking agent. World J. Microbiol. Biotechnol. 25, 803–811. [40] USEPA - United States Environmental Protection Agency. (1971) Methods of chemical analysis for water and wastes. Environmental Protection Agency, Cincinnati, USA, 312 pp. [41] Vassilev, N., Vassileva, M. (2003) Biotechnological solubilization of rock phosphate on media containing agro-industrial wastes. Appl. Microbiol. Biotechnol. 61, 435–440.
Figure Captions Fig. 1. Changes in temperature over 60 days due to composting of sugarcane industry residue. Bars indicate the standard error for three replicates.
Fig. 2. Bacterial abundance over 60 days during composting of sugarcane industry residue. Bars indicate the standard error for three replicates.
Fig. 3. Redundancy analysis (RDA) showing the relationship between the bacterial community structure and environmental parameters during composting. RDA conducted with the operational taxonomic unit (OTU) profiles obtained using the Illumina platform. * Parameters significant at a probability of 5% according to Monte Carlo testing.
Fig. 4. Dynamics of the bacterial community structure (at the order level) during composting of sugarcane industry residue.
Fig. 5. Dynamics of the inorganic, only moderately labile PHCl fraction and the organic labile POBIC fraction. Bars represent the relative percentage OTUs of the genus Bacillus during composting of sugarcane industry residue.