Effect of pre-culture on virus elimination from in vitro apple by thermotherapy coupled with shoot tip culture

Journal of Integrative Agriculture 2018, 17(9): 2015–2023 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Effect of pre-culture on virus elimination from in vitro apple by thermotherapy coupled with shoot tip culture HU Guo-jun, DONG Ya-feng, ZHANG Zun-ping, FAN Xu-dong, REN Fang, LI Zheng-nan Research Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng 125100, P.R.China

Abstract We evaluated the role of pre-culture on survival rate of in vitro apple plants treated by thermotherapy. Two apple cultivars, Malus×domestica cv. Pink Lady and Huafu, were used in the experiment and both have widely grown in China and infected with Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV). Results in growth and virus titer of apple plants did not exhibit clear trends during five different periods of pre-culture. Whilst, pre-culture increased the survival rate of the two cultivars during thermotherapy. The survival rate of plants pre-cultured for 13 d (P-13d) was 14 and 51% higher than that of P-1d plants for Pink Lady and Huafu, respectively. Moreover, pre-culture positively influenced regeneration of Huafu plants. The average survival rate of plants regenerated from P-1d and P-4d was 20% lower than that regenerated from P-7d, P-10d, and P-13d. The efficiency of virus eradication was determined by reverse-transcription PCR with two primer pairs for each virus, and the detection results showed that pre-culture scarcely affected apple virus elimination. Despite the fact that the two viruses were hardly detected at 5 d of thermotherapy, no virus-free plants were found in the two cultivars of regenerated apple plantlets after 30-d treatment. Keywords: apple, in vitro culture, pre-culture, thermotherapy, virus elimination

fruit in 2014 (Hu et al. 2016). Genetic resources are required

1. Introduction The apple (Malus×domestica) belongs to the family Rosaceae which is one of the most widely cultivated temperate fruit trees. China is one of the main apple-producing countries, producing almost half of the world’s apples with a planting area of 2.3 million ha and a production of 41 million tons of

to breed new apple cultivars in both traditional and genetic engineering breeding programs. An alternative breeding method is vegetative propagation; however, viruses are particularly problematic in vegetatively propagated crops because they are transmitted from generation to generation. Apple chlorotic leaf spot virus (ACLSV, genus Trichovirus, family Betaflexiviridae), Apple stem pitting virus (ASPV, genus Foveavirus, family Betaflexiviridae) and Apple stem grooving virus (ASGV, genus Capillovirus, family Betaflexiviridae) are common viruses and infected plants

Received 8 September, 2017 Accepted 14 November, 2017 HU Guo-jun, E-mail: [email protected]; Correspondence DONG Ya-feng, Tel/Fax: +86-429-3598278, E-mail: yfdong@ 163.com © 2018 CAAS. Publishing services by Elsevier B.V. All rights reserved. doi: 10.1016/S2095-3119(18)61913-6

are generally asymptomatic (Adams et al. 2004). They significantly reduce fruit yield and quality, and commonly occur as mixed infections, causing top-working disease of apple on susceptible rootstocks (Yanase 1983; Desvignes and Boyé 1988). All these viruses are naturally disseminated via infected propagation materials (Yanase et al. 1989; Pasquini

2016

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

et al. 1998; Hirata et al. 2003). Apple is vegetatively propagated by grafting, thus resulting in virus transmission from generation to generation. Thermotherapy is an efficient technique to eliminate viruses from infected apple plants (Paprstein et al. 2008; Hu et al. 2015a, b). A higher temperature over an extended time period can reduce the movement of virus particles into the apical meristem by inhibiting viral RNA synthesis (Valero et al. 2003; Wang et al. 2008). Even if the viruses are not eliminated, higher temperatures can sufficiently slow down their replication and infection rates to allow new shoots to grow (Wang et al. 2008). However, studies have reported that prolonged heat treatments would severely negatively affected the growth and survival of apple plants (Paprstein et al. 2008; Hu et al. 2015b). In previous researches, Hu et al. (2015a) found that the duration of pre-culture may have effects on the survival of high temperature-treated plants. In this study, we investigated the effects of pre-culture duration on the survival rate and viral elimination in in vitro samples of two apple cultivars that were also exposed to a thermotherapy treatment. We hypothesized that pre-culture and thermotherapy acting together would increase the viral elimination and plant survival. We compared virus concentrations in in vitro apple plants that were pre-cultured at one of five different time periods to determine the percentage of viral elimination. Plant survival was determined by calculating the percentage of initial shoots after thermotherapy.

2. Materials and methods 2.1. Plant materials Two apple cultivars that are widely grown in China, in vitro Malus×domestica cv. Pink Lady and Huafu, were used as the plant materials in the experiment. Shoots of the two cultivars were collected in spring from the Research Institute of Pomology, Chinese Academy of Agricultural Sciences. The presence of ACLSV and ASGV was tested by reverse transcription PCR (RT-PCR).

2.2. In vitro cultures In vitro plants were cultured on modified Murashige and Skoog (MS) medium containing 1.0 mg L–1 6-benzylaminopurine, 0.2 mg L–1 indole-3-butytric acid, 30 g L–1 sucrose, and 5.6 g L–1 agar. The pH was adjusted to 5.8 with 1 mol L–1 NaOH or HCl before autoclaving at 121°C for 15 min. All cultures were kept in a standard growth room at (24±1)°C under a 16 h light/8 h dark photoperiod with 2 000 lx light intensity. Viable cultures were transferred to fresh MS medium at 30–40 d intervals, and the presence of ACLSV and ASGV

in the cultures was reassessed by RT-PCR.

2.3. Isolation of RNA and RT-PCR Total RNA was extracted from apple samples as described by Hu et al. (2017). First-strand cDNA synthesis was conducted in a 20-μL reaction containing approximately 1 μg RNA, 5× M-MLV RT buffer, 0.5 mmol L–1 dNTP mix (Roche Diagnostics, Mannheim, Germany), 5 μmol L–1 random hexamer primers (TaKaRa, Dalian, China), and 5 U μL–1 M-MLV reverse transcriptase (Promega, Madison, WI, USA). The mixtures were incubated at 37°C for 10 min and then at 42°C for 1 h. The PCR was carried out in a 25-μL reaction volume containing 10× PCR buffer with Mg2+, 10 mmol L–1 dNTP mix, 0.5 μL each primer (final concentration 1 μmol L–1), 0.2 μL rTaq DNA polymerase (U μL–1) (TaKaRa), 2 μL template cDNA, and sterile water. Each apple virus was detected using two primer pairs (Table 1). The cycling profile comprised a 3-min incubation at 94°C, followed by 35 cycles of 94°C for 30 s (denaturation), 50–55°C for 30 s (annealing), and 72°C for 30–50 s (extension), with a final extension step at 72°C for 10 min. Amplicons were separated by electrophoresis on 1.2% (w/v) agarose gels, stained with ethidium bromide, and then visualized under ultraviolet light.

2.4. Quantitative real-time PCR (qRT-PCR) Total RNA samples were treated with the RT reagent kit with gDNA Eraser (TaKaRa) to remove genomic DNA and synthesize the first strand cDNA according to the manufacturer’s instructions. In a PCR tube, 2.0 µL 5× gDNA Eraser buffer, 1.0 L gDNA Eraser, and 3.0 µg total RNA were mixed and then RNase-free dH2O was added up to 10 µL, and the solution was then incubated at 42°C for 2 min. Additional reagents of 4.0 µL 5× PrimeScript buffer, 1.0 µL PrimeScript RT Enzyme Mix I, and 1.0 µL RT Primer Mix was then added to the previous tube, then RNase-free dH2O was added up to 20 µL, and the solution was then incubated at 37°C for 15 min followed by 85°C for 5 s and stored at −20°C for later use. The titres of ACLSV and ASGV during pre-culture and thermotherapy was quantified using SYBR® Premix Ex Taq™ II (TaKaRa) according to the manufacturer’s instructions on the CFX Connect Real-Time System (Bio-Rad, Hercules, CA). The 20 μL reaction mixtures were incubated at 95°C for 2 min for the initial denaturation stage, followed by 40 cycles at 95°C for 10 s, 58°C for 15 s and 72°C for 20 s. The ΔCt method was used to calculate the relative concentration of ACLSV and ASGV during treatment. Each sample was examined in triplicate. The primers used in this study were synthesized by Sangon Biotech (Shanghai, China). A primer

2017

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

pair that allowed for the specific amplification of mRNA corresponding to the mitochondrial nad 5 (Ma et al. 2008) gene was used as an internal control (Table 1).

2.5. Pre-culture and thermotherapy Shoots approximately 6.0 mm long were excised from in vitro cultures and were placed into culture bottles containing fresh MS medium. The plantlets were pre-cultured in a growth room for 1, 4, 7, 10, and 13 d, respectively and plant materials were collected after each pre-culture period. After pre-culture, the culture bottles were moved into a heated chamber. The temperature was raised at 3°C d–1, then the cultivated temperatures were as follows: 27, 30, 33, and 37°C, and the thermotherapy periods were recorded when the temperature reached 37°C. The duration of all thermotherapy treatments was 30 d. Plant materials were collected at different culture temperatures of 27, 30, 33, and 37°C, and collected at 37°C for 0, 1, 5, 10, 15, 20, 25, and

30 d of thermotherapy, respectively. The growth and heights of the in vitro apple plants were observed periodically to evaluate the effects of the different treatments. In total, 45 shoots were used for each treatment. Meristem tips approximately 1.0 mm long were dissected from apical shoots after treatments and cultured on the same basic MS medium as that described above. Cultures from the same source kept in a standard growth room were used as controls. After three cycles of sub-culture, RT-PCR was conducted to detect viruses, and the efficiency of virus elimination was calculated as follows: Number of virus-free plants/Number of initial shoots.

3. Results 3.1. Effect of pre-culture on growth of in vitro apple plantlets All in vitro Pink Lady and Huafu plants survived and grewed

Table 1 Oligonucleotide primers used in reverse transcription PCR (RT-PCR) assays to detect apple viruses Virus1) ACLSV

ASGV

ASPV

Nad

Primer A53 A52 ACF1 ACR1 H5873 C6396 AGF1 AGR1 ASP-C ASP-A ASPF1 ASPR5 F R

1)

Sequence (5´→3´) GGCAACCCTGGAACAGA CAGACCCTTATTGAAGTCGAA TGGAGTCCATCTTCGCGAAC CTCTTTCATGGGTTCAAGAG CCCGCTGTTGGATTTGATACACCTC CTGCAAGACCGCGACCAAGTTT ATGAGTTTGGAAGACGTGC GACTAACCCTCCAGTTCC CTCTTGAACCAGCTGATGGC ATAGCCGCCCCGGTTAGGTT AGCGGTTGCCTATTTTTGCTCC GTGAGGTCAAAGATGCTGAAACC GATGCTTCTTGGGGCTTCTTGT CTCCAGTCACCAACATTGGCATA

Position (nt) 6 875–6 891 7 212–7 232 6 913–6 922 7 522–7 503 5 872–5 896 6 373–6 396 5 640–5 658 6 338–6 353 8 993–9 012 9 237–9 256 3 480–3 501 3 748–3 770 968–987 1 836–1 838 1 973–1 995

Size (bp) Reference 358 Cieslinska et al. (1995) 590

Hu et al. (2015a)

524

Clover et al. (2003)

713

Hu et al. (2015a)

264

Kudela et al. (2009)

291

Malinowski et al. (1998)

181

Menzel et al. (2002)

ACLSV, Apple chlorotic leaf spot virus; ASGV, Apple stem grooving virus; ASPV, Apple stem pitting virus.

Table 2 Survival rate after pre-culture, thermotherapy and shoot tip culture Duration of pre-culture1) Pink Lady P-1d P-4d P-7d P-10d P-13d Huafu P-1d P-4d P-7d P-10d P-13d 1)

No. of treated plants

Percentage of surviving plants after pre-culture (%)

No. of dissected shoots

45 45 45 45 45

100 100 100 100 100

5 18 8 10 16

2 (40.0) 9 (50.0) 2 (25.0) 3 (30.0) 7 (43.8)

45 45 45 45 45

100 100 100 100 100

14 24 32 25 37

2 (14.3) 5 (20.8) 23 (71.9) 12 (48.0) 24 (64.9)

P-1d, P-4d, P-7d, P-10d, and P-13d, pre-cultured for 1, 4, 7, 10, and 13 d, respectively.

No. of surviving shoots (rate, %)

2018

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

healthy during pre-culture (Table 2). The heights of plants for the two cultivars showed hardly any difference among the five pre-culture periods, but the leaves of plants pre-cultured for 13 d (P-13d) was slightly bigger than that of P-1d (Fig. 1). Moreover, as the period of pre-culture time extended, the increase in size of basal callus was more obvious in the cultivar Pink Lady. After 13 d of pre-culture, there were no new shoots observed in both cultivars (Fig. 1).

control samples. We observed that targets of ACLSV and ASGV showed little difference among the five periods of pre-culture (Fig. 2). The relative quantities of ACLSV and ASGV in the two cultivars were verified by qRT-PCR, and the results of the titers of the two viruses lacked any increasing or decreasing trends with duration of pre-culture, which indicated that the regularity of virus-titer change in different periods was unclear (Fig. 3).

3.2. Effect of pre-culture on apple virus titer

3.3. Effect of thermotherapy on growth of pre-culture apple plantlets

The presence of ACLSV and ASGV in Pink Lady and Huafu plants was detected using a standard RT-PCR after 1, 4, 7, 10 and 13 d of pre-culture. Non-specific bands were rarely observed, and no amplicons were generated for the negative

The survival rate of in vitro Pink Lady and Huafu plants decreased as the duration of thermotherapy increased, but the pre-culture treatment generally had positive effects on

A

P-1d

P-4d

P-7d

P-10d

P-13d

B

P-1d

P-4d

P-7d

P-10d

P-13d

Fig. 1 Growth of in vitro apple plants after pre-culture for 1, 4, 7, 10 and 13 d (P-1d, P-4d, P-7d, P-10d, and P-13d), respectively. A, in vitro Pink Lady plants. B, in vitro Huafu plants.

Pink Lady bp 500 300 100 bp 500 300 100 bp 500 300 100

M

1

2

3

4

5

Huafu 6

7

8

M

1

2

3

4

5

6

7

8 ACLSV

ASGV

Internal control

Fig. 2 Agarose gel electrophoresis of reverse transcription PCR (RT-PCR) products of Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) in the five different periods of in vitro pre-culture and an internal control. M, DNA marker II (Tiangen, Beijing, China); lane 1, no template control; lane 2, negative control; lane 3, no positive control; lanes 4–8, pre-culture for 1, 3, 7, 10 and 13 d, respectively. The primer sets for ACLSV and ASGV detection were A53/A52 and H5873/C6396, respectively.

2019

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

B

Relative expression

Relative expression

1.5 1.0 0.5 0

P-1d

P-4d

P-7d

P-10d

3.0 2.5 2.0 1.5 1.0 0.5 0

2.0

ACLSV

2.0

ASGV

ACLSV

1.5 1.0 0.5 0

P-13d

Relative expression

Relative expression

A

P-1d

P-4d

P-7d

P-10d

P-13d ASGV

1.5 1.0 0.5 0

P-1d

P-4d

P-7d

P-10d

P-13d

P-1d

P-4d

P-7d

P-10d

P-13d

Fig. 3 Quantitative reverse transcription PCR (RT-PCR) was performed to quantify the relative expression levels of Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) in in vitro Pink Lady (A) and Huafu (B) plants after pre-cultured for 1, 4, 7, 10 and 13 d (P-1d, P-4d, P-7d, P-10d, and P-13d), respectively. Error bars represent the standard deviations among triplicate experimental reactions. Table 3 Survival rate of apple plants during thermotherapy Varietiy Pink Lady

Huafu

Duration of pre-culture1) P-1d P-4d P-7d P-10d P-13d P-1d P-4d P-7d P-10d P-13d

5d 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa 100±0.0 Aa

10 d 75.6±10.2 Bb 84.5±3.9 Bb 86.7±6.7 ABb 95.5±3.9 ABa 95.6±7.7 Aa 80.0±6.7 Cb 84.5±3.9 CBb 91.1±7.7 BCa 97.8±3.9 Aa 97.8±3.9 Aa

Survival rate (%) 15 d 20 d 66.6±11.5 Ab 44.5±3.9 Ac 71.1±7.7 Ac 59.4±5.3 Ac 63.0±10.0 Ac 44.5±3.9 Ad 75.6±7.7 Ab 56.4±14.4 Ac 71.9±8.8 Ab 55.6±10.2 Ac 73.3±6.7 Bb 54.2±7.9 Bc 73.3±0.0 Bc 65.3±2.4 Bd 75.6±7.7 Bb 65.3±2.4 Bbc 75.5±3.9 Bb 66.7±0.0 Bc 91.1±10.2 Aa 86.7±13.4 Aa

25 d 28.9±3.8 Bd 46.6±11.5 Ad 40.0±6.7 ABde 42.2±10.2 ABcd 46.6±11.5 Ac 40.0±6.7 Cd 56.4±5.3 BCe 60.8±6.9 Bc 60.8±6.9 Bc 84.5±16.8 Aa

30 d 11.1±10.2 Be 37.8±7.7 Ad 28.9±7.7 Ae 35.6±10.2 Ad 42.2±10.2 Ac 37.8±7.7 Cd 48.9±3.8 BCf 60.8±6.9 Bc 60.8±6.8 Bc 84.5±16.8 Aa

1)

P-1d, P-4d, P-7d, P-10d, and P-13d, pre-cultured for 1, 4, 7, 10, and 13 d, respectively. Data were analyzed according to a general linear model-general factorial using SPSS for Windows (Release 7.5.1). To estimate homogenous subsets for various treatments, post hoc Tukey’s HSD (Honestly Significant Difference) test at α=0.05 level of significance was applied. Within each column, different letters indicate significant differences (P<0.05). Vertical differences among treatments were denoted by capital letters, and the horizontal differences among duration were denoted by lowercase letters.

the growth of the two cultivars (Table 3). For Pink Lady,

survival rate of P-13d plants was higher than that of P-4d,

the survival rate of P-1d plants was lower than that of P-4d,

P-7d and P-10d plants during the longest thermotherapy

P-7d, P-10d, and P-13d plants when thermotherapy lasted

treatment (30 d), and there was no significant difference

10, 25 and 30 d. Only five plants survived after 30 d of

among different durations of the thermotherapy. The

thermotherapy (Table 3). The effect of high temperature

percentage of surviving plants was up to 82.2% at the end

on plants among the five pre-culture periods was not

of thermotherapy (30 d) (Table 3). When the treatment

obvious during 20 and 25 d of thermotherapy. At the end

lasted 30 d, the leaves of P-1d and P-4d plants turned

of thermotherapy, the leaves of P-1d, P-4d and P-7d

yellow and brown and became desiccated. No growth was

plants turned yellow, brown or black and dessicated; the

observed in these two treatments when compared with the

tips of most plants became brown or black. Moreover,

control plants and the growth of P-7d and P-10d plants was

growth of plants in these three treatments was nearly

higher than that of the former two treatments. The P-13d

similar to that of the control plants, and the growth

plants showed almost the same amount of growth with that

speed of P-10d and P-13d plants was higher than that

of control (Fig. 4-B). Shoot proliferation was also strongly

of the former three treatments (Fig. 4-A). For Huafu, the

inhibited by higher temperatures. Almost no axillary shoots

2020

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

regenerated for the two cultivars in the 37°C treatments.

treated Huafu plants was detected using a standard RTPCR when the temperature raised to 27, 30, 33 and 37°C, respectively, and during 37°C for 0, 1, 5, 10, 15, 20, 25, and 30 d, respectively. There was no band for the two viruses after 5 d at 37°C. We speculated that the viral titer would decrease as early as the start of the treatment (Fig. 5).

3.4. Effect of pre-culture on survival rate of shoot regeneration In vitro Pink Lady and Huafu plants were regenerated from treated shoot tips (1.0 mm) and the survival rate was calculated (Table 2). The effect of pre-culture duration on regeneration of Pink Lady was not obvious, and no clear trend was observed for this cultivar. Whereas, pre-culture clearly affected regeneration of Huafu plants. The average survival rate of plants regenerated from P-1d and P-4d was 20% lower than that regenerated from P-7d, P-10d and P-13d.

3.6. Efficiency of virus eradication by thermotherapy combined with shoot tip culture Regenerated plants sub-cultured for three cycles were analyzed by RT-PCR to confirm the elimination of viruses, using two primer pairs for each virus. Plants were judged as virus-free when there were no target products amplified by RT-PCR with four primer pairs. Virus elimination efficiencies differed in the two apple cultivars (Table 4). The average elimination rates of ACLSV and ASGV in regenerated Pink Lady plants was 21.7 and 8.7%, respectively. Only two regenerated plants were ASGV-free. Almost no ACLSV was

3.5. Effect of thermotherapy on ACLSV and ASGV titers The presence of ACLSV and ASGV in the high temperatureA

P-1d

P-4d

P-7d

P-10d

P-13d

CK

B

P-1d

P-4d

P-7d

P-10d

P-13d

CK

Fig. 4 Growth of in vitro apple plants after thermotherapy for 30 d. A, in vitro Pink Lady plants. B, in vitro Huafu plants. CK, in vitro apple plants were cultured in a standard growth room; P-1d, P-4d, P-7d, P-10d, and P-13d, pre-cultured for 1, 4, 7, 10, and 13 d, respectively.

bp 500 300 100

M

1

2

3

4

5

6

7

8

9

10

11

12

13 ACLSV

bp 500 300 100

ASGV

bp 500 300 100

Internal control

Fig. 5 Agarose gel electrophoresis of reverse transcription PCR (RT-PCR) products of ACLSV (Apple chlorotic leaf spot virus) and ASGV (Apple stem grooving virus) in five different periods of thermotherapy and a internal control in Huafu plants. M, DNA Marker II (Tiangen, Beijing, China); lane 1, no template control; lane 2, negative control; lane 3, no positive control; lanes 4–6, temperature at 27, 30, and 33°C, respectively; lanes 7–13, pre-cultured for 1, 5, 10, 15, 20, 25 and 30 d (P-1d, P-3d, P-7d, P-10d, and P-13d) at 37°C, respectively. The primer sets for ACLSV and ASGV detection were A53/A52 and H5873/C6396, respectively.

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

Table 4 Efficiencies of thermotherapy to generate Apple chlorotic leaf spot virus (ACLSV)- or Apple stem grooving virus (ASGV)-free apple plants Duration of pre-culture1) P-1d P-4d P-7d P-10d P-13d

Pink Lady ACLSV ASGV 0/22) 0/22) 22.2 (2/9) 22.2 (2/9) 0/22) 1/22) 33.3 (1/3) 0 (0/3) 14.3 (1/7) 0 (0/7)

Huafu ACLSV ASGV 0/22) 0/22) 0 (0/5) 0 (0/5) 0 (0/23) 21.7 (5/23) 0 (0/12) 25.0 (3/12) 4.2 (1/24) 33.3 (8/24)

1)

P-1d, P-4d, P-7d, P-10d, and P-13d, pre-cultured for 1, 4, 7, 10, and 13 d, respectively. Less than three shoots were obtained. Numbers in parentheses indicate virus-free shoots/shoots analyzed.

2)

eliminated from regenerated Huafu plants, and the average eradication rate of ASGV was 24.2%. The pre-culture scarcely showed any effect on the apple virus elimination rate. The detection results showed that no virus-free plants were found in the two regenerated apple cultivars.

4. Discussion Thermotherapy is a routine method for virus eradication, and this method has been widely used to eliminate viruses from fruit trees and other vegetative plants (Valero et al. 2003; Paprstein et al. 2008; Tan et al. 2010). Woody plants, like apple, are sensitive to prolonged exposure to extreme high temperatures (Paprstein et al. 2008; Tan et al. 2010; Hu et al. 2012). High temperatures significantly affected shoot survival, and the survival rate directly associated with the success of thermotherapy. In this research, we tried to investigate the potential influence of various durations of pre-culture to increase the survival rate of apple plantlets. The success of virus elimination is also related to the concentration of each particular virus in the plant material. It was unclear whether the titers of virus would change during pre-culture, so the relative quantitative concentration of ACLSV and ASGV in the Pink Lady and Huafu plants were analyzed. The results showed no obvious trend of the two virus’s titers in the two cultivars during pre-culture. Thus, we speculated that pre-culture did not affect the virus titers, and the differences among the five periods were due to individual differences between plantlets. It showed that the longer time pre-culture could increase the growth of plants, which were helpful for the plants during high temperature treatment. The temperature range is an important factor affecting shoot survival. Most often, the temperature of thermotherapy is measured in a growth chamber. Some authors have shown that the air temperature measured in the growth chamber was 1 or 2°C (Deogratias et al. 1989; Stein et al. 1991) lower than that inside the test tubes within the chamber. When choosing a temperature, there must be a balance between

2021

relatively low shoot mortality at higher temperatures and the high percentage of virus-free shoots (Dziedzic 2008). Previous research demonstrated that the survival rates of shoots from apple plants treated at 34 and 36°C was 84.6 and 93.3%, respectively, but almost no shoots survived in the 38°C treatment (Hu et al. 2015a). We chose 37°C to eliminate the apple viruses, and the results indicated that this temperature caused high death rates, thus, the method of pre-culture was applied to determine whether it can mitigate the often fatal effect of high temperatures. The survival rate of P-13d plants was 14 and 51% higher than that of P-1d plants for Pink Lady and Huafu, respectively. However, although the in vitro apple plants were cultured in the same conditions, inherent variability among individuals within each cultivar may be responsible for the differences we observed, for example, in the P-4d plants of Pink Lady and P-10d plants of Huafu. The duration of thermotherapy treatment can affect virus elimination efficiency (Tan et al. 2010; Hu et al. 2012). Dong et al. (2002) found that the elimination rate of an apple virus treated with a high temperature of 37°C for 36 d was clearly higher than that of 27 d. Cheng et al. (2003) had reported that when a 38°C temperature lasted for 25 d, the elimination rates of ACLSV and ASGV were 17% higher than that lasted for 20 d. In the present study, the duration of the high temperature treatment was 30 d long, and surviving plants (11.1–82.2%) were found in all pre-culture treatments at the end of treatment. However, the effects of temperature and duration of exposure may be obscured by the intrinsic heat tolerance of the host plant because the level of tolerance depends on species and variety (Hu et al. 2015b). Pink Lady plants were more sensitive to high temperature than that of Huafu. The results showed that pre-culture had little effect on apple virus elimination. Unfortunately, none of the regenerated apple plants were virus-free. In fact, the titers of ACLSV and ASGV during thermotherapy were detected, and no virus was found when thermotherapy lasted for 5 d. The underlying mechanism of thermotherapy’s effect on reducing viral infection has not been completely explained yet. Since Kunkel (1935) established that exposure of virus-infected trees in pots to temperatures ranging between 34.4 and 36.3°C was effective in treating peach tree of either peach yellows or peach rosette, heat treatment for the inactivation of different viruses in plants has become an established practice. One explanatory hypothesis is that heat stress, especially at sublethal temperatures, inhibits virus replication in newly growing plant tissues and thus allows a plant to recover from viral infections (Nyland and Goheen 1969; Mink et al. 1998). Szittya et al. (2003) and Qu et al. (2005) reported that plant-virus interactions are strongly affected by temperature, and high temperatures

2022

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

are frequently associated with low virus content in infected plants. Wang et al. (2008) revealed a drastic decrease in the amounts of Raspberry bushy dwarf virus RNA in shoot tips and leaves following 5 d of thermotherapy; moreover, the amounts of viral RNA were barely detectable following 8 d of thermotherapy. The plants likely did not have time to grow significantly in 8 d and the tissues sampled at different time points were essentially the same developmentally. They speculated that it may be explained by enhanced RNA silencing, the cellular mechanism devoted to targeting and degrading viral RNA in plants, at elevated temperatures. Our results supported the same conclusion. Dong et al. (2002) reported 65% virus eradication from virus-infected apple plants using thermotherapy for 27 d. In the present study, none of the virus-free apple plantlets regenerated after high temperature treatment. The result also differed from our previously reported results (Hu et al. 2015a), in which 43.7 and 52.4% of the regenerated plants from (34±0.5)°C and (36±0.5)°C treatments were virusfree. The reasons for this difference in virus elimination efficiency are not known, although factors such as the use of shoot tips from in vitro plants as well as the different apple variety, and, perhaps, virus strain and concentration may have played a role in determining the differences in results. Moreover, the detection method also may have caused this difference (Bayati et al. 2011). In this study, RT-PCR has been used for virus detection, and to ensure accuracy, two primer pairs for each apple virus were used to increase the specificity and sensitivity of detection, while Dong et al. (2002) used enzyme-linked immuno-sorbent assay (ELISA) and indicator plants as a detection method.

5. Conclusion This experimental model allowed us to evaluate the modifications of thermotherapy. It proved that some improvement was needed to increase the virus elimination rate of different elimination methods. Furthermore, this study also lends further insight into the underlying mechanisms of thermotherapy.

Acknowledgements This work was supported by the Agricultural Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP).

References Adams M J, Antoniw J F, Bar-Joseph M, Brunt A A, Candresse T, Foster G D, Martelli G P, Milne R G, Fauquet C M. 2004. The new plant virus family Flexiviridae and assessment

of molecular criteria for species demarcation. Archives of Virology, 149, 1045–1060. Bayati S, Shams-Bakhsh M, Moini A. 2011. Elimination of Grapevine virus A (GVA) by cryotherapy and electrotherapy. Journal of Agricultural Science and Technology, 13, 442–450. Cheng Y Q, Xu J, ZhanY, Lie H C, Shun Y W, Shun Q H. 2003. Responses of micropropagated apple cultivars and stock to thermotherapy for viruses elimination. Chinese Agricultural Science Bulletin, 19, 216–219. (in Chinese) Cieslinska M, Malinowski T, Zawadzka B J. 1995. Studies on several strains of Apple chlorotic leaf spot virus (ACLSV) isolated from different fruit tree species. Acta Horticulturae, 386, 63–71. Clover G R G, Pearson M N, Elliott D R, Tang Z, Smales T E, Alexander B J R. 2003. Characterization of a strain of Apple stem grooving virus in Actinidia chinensis from China. Plant Pathology, 52, 371–378. Deogratias J M, Dosba F, Lutz A. 1989. Eradication of Prune dwarf virus, Prunus necrotic ringspot virus and Apple chlorotic leaf spot virus in sweet cherries by a combination of chemotherapy, thermotherapy, and in vitro culture. Canadian Journal of Plant pathology, 11, 337–342. Desvignes J C, Boyé R. 1988. Different diseases caused by the Chlorotic leaf spot virus on the fruit trees. Acta Horticulturae, 235, 31–38. Dong Y F, Zhang Z P, Zhang S Y, Hong N, Yu J M. 2002. Studies on elimination of apple and pear virus by combining tissue culture of top-stem with heat therapy. Northern Fruits, 2, 9–10. (in Chinese) Dziedzic E. 2008. Elimination of Prunus necrotic ring spot virus (PNRSV) from plum ‘Earliblue’ shoots through thermotherapy in vitro. Journal of Fruit and Ornamental Plant Research, 16, 101–109. Hirata H, Lu X, Yamaji Y, Kagiwada S, Ugaki M, Namba S. 2003. A single silent substitution in the genome of Apple stem grooving virus causes symptom attenuation. Journal of General Virology, 84, 2579–2583. Hu G J, Dong Y F, Zhang Z P, Fan X D, Ren F, Li Z. 2017. Occurrence and genetic diversity analysis of Apple stem pitting virus isolated from apples in China. Archives of Virology, 162, 2397–2402. Hu G J, Dong Y F, Zhang Z P, Fan X D, Ren F, Li Z N, Zhou J. 2016. First report of Prunus necrotic ringspot virus infection of apple in China. Plant Disease, 100, 1955. Hu G J, Dong Y F, Zhang Z P, Fan X D, Ren F, Zhou J. 2015a. Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell Tissue Organ Culture, 121, 435–443. Hu G J, Hong N, Wang L P, Hu H J, Wang G P. 2012. Efficacy of virus elimination from in vitro cultured sand pear (Pyrus pyrifolia) by chemotherapy combined with thermotherapy. Crop Protection, 37, 20–25. Hu G J, Zhang Z P, Dong Y F, Fan X D, Ren F, Zhu H J. 2015b. Efficiency of virus elimination from potted apple plants by thermotherapy coupled with shoot-tip grafting. Australasian

HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023

Plant Pathology, 44, 167–173. Kudela V, Krejzar V, Kundu J K, Pankova I, Ackermann P. 2009. Apple burrknots involved in trunk canker initiation and dying of young trees. Plant Protection Science, 45, 1–11. Kunkel L O. 1935. Heat treatment for the cure of yellows and rosette of peach. Phytopathology, 25, 24. Ma B G, Niu J X, Morley-Bunker M, Pan L Z, Zhang H P, Zhang L X. 2008. Detection of three pear viruses by multiplex RTPCR assays with co-amplification of an internal control. Australasian Plant Pathology, 37, 117–122. Malinowski T, Komorowska B, Golis T, Zawadzka B. 1998. Detection of Apple stem pitting virus and Pear vein yellows virus using reverse transcription-polymerase chain reaction. Acta Horticulturae, 472, 87–95. Menzel W, Jelkmann W, Maiss E. 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods, 99, 81–92. Mink G I, Wample R, Howell W E. 1998. Heat treatment of perennial plants to eliminate phytoplasms, viruses and viroids while maintaining plant survival. Plant Virus Disease Control, 40, 332–345. Nyland G, Goheen A C. 1969. Heat therapy of virus diseases of perennial plants. Annunal Review of Phytopathology, 7, 331–354. Paprstein F, Sedlak J, Polak J, Svobodova L, Hassan M, Bryxiova M. 2008. Results of in vitro thermotherapy of apple cultivars. Plant Cell Tissue Organ, 94, 347–352. Pasquini G, Faggioli F, Pilotti M, Lumia V, Barba M, Hadidi A. 1998. Characterization of Apple chlorotic leaf spot virus isolates from Italy. Acta Horticulturae, 472, 195–202. Qu F, Ye X, Hou G, Sato S, Clemente T E, Morris T J. 2005. RDR6 has a broad-spectrum but temperature-dependent

2023

antiviral defense role in Nicotiana benthamiana. Journal of Virology, 79, 15209–15217. Stein A, Spiegel S, Faingersh G, Levy S. 1991. Responses of micropropagated peach cultivars to thermotherapy for elimination of Prunus necrotic ringspot virus. Annals of Applied Biology, 119, 265–271. Szittya G, Silhavy D, Molnar A, Havelda Z, Lovas A, Lakatos L, Banfalvi Z, Burgyan J. 2003. Low temperature inhibits RNA silencing-mediated defence by the control of siRNA generation. EMBO Jouranl, 22, 633–640. Tan R R, Wang L P, Hong N, Wang G P. 2010. Enhanced efficiency of virus eradication following thermotherapy of shoot-tip cultures of pear. Plant Cell Tissue Organ Culture, 101, 229–235. Valero M, Ibáñez A, Morte A. 2003. Effects of high vineyard temperatures on the Grapevine leafroll associated virus elimination from Vitis vinifera L. cv. Napoleon tissue cultures. Scientia Horticulturae, 97, 289–296. Wang Q C, Cuellar W J, Rajamäki M, Hirata Y, Valkonen J P T. 2008. Combined thermotherapy and cryotherapy for efficient virus eradication: Relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Molecular Plant Pathology, 8, 1–14. Yanase H. 1983. Back transmission of Apple stem grooving virus to apple seedlings and induction of symptoms of apple topworking disease in Mitsuba Kaido (Malus sieboldii) and Kobano Zumi (Malus sieboldii var. arborescens) rootstocks. Acta Horticulturae, 130, 117–122. Yanase H, Koganezawa H, Fridlund P R. 1989. Correlation of pear necrotic spot with pear vein yellows and apple stem pitting, and a flexuous filamentous virus associated with them. Acta Horticulturae, 235, 157–158.

Section editor HUANG San-wen Managing editor SHI Hong-liang WENG Ling-yun