Effect of processing aid on the chemical composition and metagenomics of fermented African oil bean seed (Pentaclethra macrophylla, Benth)

LWT - Food Science and Technology 111 (2019) 429–435

Contents lists available at ScienceDirect

LWT - Food Science and Technology journal homepage: www.elsevier.com/locate/lwt

Effect of processing aid on the chemical composition and metagenomics of fermented African oil bean seed (Pentaclethra macrophylla, Benth)

T

Fidelis Azia,c,∗, Helen A. Njokua, Esther I. Davidb, Michael O. Odoa, Veronica N. Nwobasia, Chuanhai Tuc, Mingsheng Dongc a

Department of Food Science & Technology, Ebonyi State University EBSU, Ebonyi State, P.M.B 053, Abakaliki, Nigeria Department of Home Economics, Ebonyi State University EBSU, Ebonyi State, P.M.B 053, Abakaliki, Nigeria c College of Food Science and Technology, Nanjing Agricultural University, Nanjing, 210095, Jiangsu Province, PR China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Pentaclethra macrophylla Benth Anti-nutrients Amino acid Volatile compounds Metagenomics

Oil palm inflorescence ash (FMA) has been used in post-harvest processing and preservation of food crops. In this study effect of oil palm inflorescence ash as a processing aid on the chemical composition and metagenomics of fermented African oil bean seed (Pentaclethra macrophylla, Benth) was investigated. The result showed that the African oil bean seeds sample fermented with FMA had higher total amino acid (TAA) content (88.48 g/100 g crude protein (cp)) and better protein quality compared to the sample fermented without the ash (NFM) (81.04 g/100 g cp) and the unfermented (UFM) sample (8.07 g/100 g cp). The FMA had lower residual antinutritional factors and total saturated fatty acid (4.07%) hence has better dietary value than the NFM and UFM samples. New aromatic volatile compounds were also produced in the FMA which further improved its sensory quality compared to the NFM and UFM samples. The metagenomic study revealed that FMA had fewer spoilage bacteria but higher fermentative yeasts than the NFM. Thus the findings of the current study provide evidence that African oil bean seeds fermented with oil palm inflorescence ash have better chemical and microbial composition than the one processed without the oil palm ash.

1. Introduction African oil bean plant (Pentaclethra macrophylla, Benth) has become a very important leguminous plant especially in developing countries because of its protein-rich seed. The African oil bean seed (Pentaclethra macrophylla, Benth) is a highly nutritious seed and could be fermented to produce highly aromatic and protein-rich delicacy commonly known as “ugba”. Ugba has become an important and less expensive source of protein for people whose staple foods are deficient in protein in many developing countries (Mbajunwa, 1995). Human migration has also made this delicacy common in most European and American countries (Ohiri & Bassey, 2017). The seed contains a high content of essential amino acids, fatty acids and volatile compounds hence are also extensively utilized as a flavoring agent (Olasupo, Okorie, & Oguntoyinbo, 2016). However, the major setback to the production and utilization of fermented African oil bean seed is its susceptibility to microbial contamination, resulting in loss of aromatic and nutritional qualities within few days of production ( Enujiugha, 2003). Millions of children and adult in developing depend on staple foods such as starchy roots and tubers as well as protein deficient legumes as ∗

their main source of dietary protein (Enujiugha & Ayodele-Oni, 2003; WHO, 2013). Hence increased protein malnutrition in the last few decades have necessitated more vigorous research into harnessing the nutrient potential of underutilized oilseeds to solve protein malnutrition problem in developing countries especially in Africa (Enujiugha and Akanbi, 2005). The African oil bean trees abound in most rainforest areas of West Africa and Central Africa and are currently grown in many farms across Africa because of the increasing demand for its protein-rich seed (Donatus & Aluwuo, 2008). Methods for processing ugba often vary from one processor to another hence the inconsistency in the quality of the naturally fermented product (Ogueke, Nwosu, Owuamanam, & Iwoono, 2010; Enujiugha, & Akanbi, 2005). Fermentation enhances the organoleptic properties and protein quality of the seed (Olasupo et al., 2016). However, it reduces the shelf-life of the seed and exposes the product to post-fermentation contamination and spoilage (Oguntoyinbo, 2014). Thus the major concern of researchers in recent time has been to seek alternative processing method that would increase the shelf-life without decreasing the aromatic and nutritional quality as well as consumer acceptance of the oil bean seed.

Corresponding author. Department of Food Science & Technology, Ebonyi State University EBSU, Ebonyi State, P.M.B 053, Abakaliki, Nigeria. E-mail addresses: azifi[email protected], azi.fi[email protected] (F. Azi).

https://doi.org/10.1016/j.lwt.2019.05.056 Received 1 February 2019; Received in revised form 3 May 2019; Accepted 12 May 2019 Available online 13 May 2019 0023-6438/ © 2019 Elsevier Ltd. All rights reserved.

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

2.4. Protein quality index of the African oil bean seed samples

Search for alternative processing technique that would ensure improved nutritional quality and elongate the shelf-life of the fermented product has led the processors to adopt the use of oil palm inflorescence ash as a processing aid in the production of fermented oil bean seed product ugba. Ugba processed with the ash is widely available in many Nigerian markets at present and it is widely accepted because of its better organoleptic and storage stability. Metagenomics has been used to reveal unique and interesting microbial diversity and dynamics in many fermented foods (Huang et al., 2017). Chemical studies have shown that oil palm inflorescence ash contains mainly elemental Ca, K, and Mg (Ayodele & Iwhiwhu, 2011). It increases the pH of the medium, hence it has been applied in postharvest processing and preservation of food crops (Ayodele & Iwhiwhu, 2011; Baoua, Amadou, Margam, & Murdock, 2012). However, despite the increasing acceptability and popularity of ugba processed with oil palm inflorescence ash; there is still no research information regarding the effect of this processing aid on the chemical and metagenomics of the fermented oil bean seed. Thus the purpose of the current study is to investigate the effect of oil palm inflorescence ash as a processing aid on the chemical composition and metagenomics of fermented African oil bean seed ugba.

2.4.1. Essential amino acid index (EAAI) EAAI was calculated using the ratio of test protein to the reference protein for each of the essential amino acids according to the method of Steinke, Prescher, and Hopkins (1980). 2.4.2. Determination of protein efficiency ratio (PER) The PER was estimated according to the method described by Mubarak (2005) and Gokhan et al. (2012). PER1 = − 0.684 + 0.456 × Leu – 0.047 × Pro. PER2 = −0.468 + 0.454 × Leu – 0.105 × Tyr. PER3 = −1.816 + 0.435 × Met +0.78 × Leu +0.211 × Hys – 0.944 × Tyr.

2.4.3. essential amino acid scores Determination of the amino acid scores was according to the method of (FAO/WHO/UNU, 1985). 2.5. Fatty acid analysis

2. Materials and methods

The African oil bean seed samples were first esterified to the more volatile methyl esters using methanol. The analysis of the methyl esters of fatty acids of the samples was done with Agilent 7890A Series gas chromatograph (7890A GC) coupled with Agilent 5975 mass spectroscopy detector (GC-MSD) system, USA. An HP-5 Phenyl Methyl Siloxane column temperature of 325 °C and MS capillary column (30 m length x 320 mm ID x 0.25 μm film thickness) operated in electronimpact (EI) mode with an ionization voltage of 70eV was used to separate fatty acid methyl esters. The flow rate of the helium carrier gas was 1 ml/min and pressure of 7.8696 psi. Samples injection volumes were 1 μL and analyses were done with split injection mode. The Oven temperature was held at 60∘C for 2 min, ramped to 200∘C for 0 min and finally programmed at 240∘C and held for 5 min. GC chromatograms of the African oil bean seed samples were examined and each peak identified was confirmed by direct comparison with those of the authentic compounds with the NIST08. L Mass Spectral Library.

2.1. Sample collection The African oil bean seeds were purchased from local supermarket in Abakaliki Local Government Area, Ebonyi State, Nigeria. The seeds were botanically identified at the Department of Crop and Land Scape Management, Ebonyi State University, Abakaliki, Nigeria. 2.2. Sample preparation The African oil bean seeds were boiled for 8 h at 100 °C. The seed coats were removed. The embryos were sliced into smaller pieces and further boiled for 1 h. The sliced seeds were washed thoroughly in water three times changes of water. The oil palm inflorescence ash (50 g) from palm frond was mixed in 500 ml of distilled water. The washed sliced seeds were divided into three separate parts 500 g each. One part (500 g) was wrapped with banana leaves and the second part was mixed in oil palm inflorescence ash solution and both left to ferment for 72 h at room temperature (27–30 °C) while the third part was analyzed unfermented. After the 72 h fermentation the unfermented (UFM), sample fermented without ash (NFM) and the African oil bean seed sample fermented with oil palm inflorescence ash (FMA) were taken to the laboratory for analyses.

2.6. SPME-GC/MS analysis of volatile component Headspace solid-phase microextraction (HS-SPME) gas chromatography (GC) coupled with mass spectrometry (MS) and flame ionization detector (FID) was used to analyze volatile components according to the method described by Chua, Lu, and Liu (2017). The pH of the samples (5-ml) was first adjusted to 2.5 using 1 M HCl. The African oil bean sample solutions were then subjected to HS-SPME extraction at 60 °C for 50 min using a carboxen/poly (dimethylsiloxane) fiber (Supelco, Bellefonte, PA, USA) at 250 rpm/min. At the end of the extraction, the SPME fiber was desorbed at 250 °C for 3 min in the injection port. The flow rate of the carrier gas (helium) was at 1.2 ml/min while the temperature program was set to increase from 50 °C (5 min) to 230 °C (30 min) at a rate of 5 °C/min. The volatile compounds were identified by comparing their individual mass spectra with the NIST08 Library and Wiley275 Library.

2.3. Amino acid derivatization and analysis The amino acids were first extracted and derivatized using butanolacetyl chloride (4:1 v/v) for 1 h at 110 °C and trifluoroacetylation with 200 μl trifluoroacetic anhydride at 60 °C for 30 min. Agilent 7890A Series gas chromatograph (7890A GC) coupled with Agilent 5975 mass spectroscopy detector (GC-MSD) system, USA was used for the analysis. The Oven temperature was held at 170∘C for 5 min ramped to 200∘C for 3 min increased to 290∘C for 1 min at 4∘C/min and finally programmed to 320∘C for 15 min at 20∘C/min. The injection volume of the derivatized amino acids (AA) was 1 〈mu〉L. The Agilent HP -5 column capillary GC column (30 m × 320 μm x 0.25 μm) was used. The carrier gas was H2 at a flow rate of 40 mL/min and pressure of 17.963 psi and split vent of 1 mL/min at 0.5 min. GC chromatograms of the African oil bean seed samples were examined and each peak identified was confirmed by direct comparison of their chromatographic retention times, retention indices, and mass spectra with those of the authentic compounds with the NIST08. L Mass Spectral Library.

2.7. Anti-nutritional factors analysis The trypsin inhibitor activities of the African oil bean samples were determined according to the method of Zhou, Han, Li, and He (2017), using PAPNA (N-bezol-DL-arginine p-nitroanilide) as synthetic substrate. The phytate content was determined by the ion exchange method of Latta and Eskin (1980). Tannins content were determined using the vanillin – HPLC method of Price, Socoyoc, and Butler (1978). 430

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

2.8. Total DNA isolation and sequencing

Table 1 Amino acids profile of the African oil bean seed samples.

Isolation of the total microbial DNA and sequencing was according to the method described by Chakravorty et al. (2016) and Huang et al. (2017) Total bacterial 16S rRNA gene sequences (V1 and V3) and fungal ITS sequences (T1 and T2) were recovered from samples. The library samples were then clustered into bacterial and fungal Operational Taxonomic Units (OTUs) at 97% similarity. Briefly, the samples were ground using liquid nitrogen and the total genomic DNA was extracted using USUP-DNA extraction assay kit (Sangon Biotech. Co., Ltd., Shanghai, China). Universal bacterial primer PRK341F and PRK806R set and universal fungal primer set ITS1 (5′ TCCGTAGGTG AACCT GCGG 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) were used to amplify the 16S rRNA genes and ITS genes respectively. The PCR products extracted after 2% agarose gel electrophoresis was purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA), and were quantified using a QuantiFluor™ -ST (Promega, Madison, WI, USA). Total bacterial 16S rRNA gene sequences (V3 and V4) and fungal ITS sequences (T3 and T4) were then recovered from the samples. Sequences data processing: The raw image data file was obtained from IlluminaMiseq™ and was translated into raw sequenced reads through CASAVA Base Calling analysis, which was called raw reads. The results were stored in FASTQ (fq) file format, which contains sequences information and its corresponding sequences quality information and was further analyzed as described by Huang et al. (2017).

Amino acids (g/100 g) 2

Ala Gly2 Asp2 Cys Val1 Met1 Leu1 Iso1 Pro2 Glu2, Ser2 Thr1, Phe1, Lys1 Arg2 His1 Tyr2 Total (g/100 g)

UFM 0.34 0.58 0.46 0.52 0.45 0.32 0.54 0.53 0.52 0.57 0.57 0.53 0.65 0.57 0.46 0.38 0.27 8.08

NFM ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

c

0.01 0.01c 0.03c 0.01 c 0.02 c 0.031 c 0.01 c 0.01 b 0.02 c 0.12 c 0.01 c 0.01 c 0.02 c 0.01 c 0.01 c 0.04 c 0.01 b 0.01 c

FMA b

4.15 ± 0.01 4.38 ± 0.01a 8.26 ± 0.01b 2.77 ± 0.12 b 5.25 ± 0.01 b 1.17 ± 0.12 b 6.34 ± 0.01 b 4.37 ± 0.12 a 4.32 ± 0.01 b 9.37 ± 0.12 b 4.36 ± 0.01 b 3.46 ± 0.02 b 6.45 ± 0.02 b 6.37 ± 0.01 b 5.26 ± 0.01 b 2.08 ± 0.01 b 3.07 ± 0.02 a 81.05 ± 0.02 b

4.32 ± 0.01a 4.08 ± 0.01b 9.77 ± 0.02a 3.13 ± 0.06 a 5.82 ± 0.02 a 1.27 ± 0.12 a 6.48 ± 0.01 a 4.33 ± 0.06 a 4.46 ± 0.01 a 11.52 ± 0.02 a 5.22 ± 0.01 a 4.12 ± 0.01 a 6.82 ± 0.01 a 6.37 ± 0.02 a 5.78 ± 0.01 a 2.15 ± 0.01 a 3.08 ± 0.01 a 88.51 ± 0.06 a

Statistical analysis using ANOVA (n = 3) at 95% confidence interval (p ≤ 0.05). Different superscript along the row indicates significant difference between samples: 1-essential amino acids (EAA); 2 – non-essential amino acids (NEAA). UFM= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash.

2005). Thus processing the African oil bean seed with the ash further made the bean seed a better protein source than raw and roasted groundnut seed, beef, pork sardine, mackerel, oysters (Adeyeye, 2009, 2010). The FMA was made a better source of valine for both infant and adult protein diet than soybean (1.66 g/100 g cp) (Goldflus, Ceccantini, & Santos, 2006), groundnut (1.31 g/100 g cp) (Adeyeye, 2010) fermented African locust bean (4.23 g/100 g cp) (Oluwole & Oluremi, 2012) and some Nigerian fish Clarias anguillaris (2.8 g/100 g cp) (Adeyeye, 2009). Valine is an important amino acid as it helps remove potentially toxic excess nitrogen from the liver and transport nitrogen to other tissues in the body (Eshun, Adu, Barimah, Dossou, & Van Twisk, 2015). The lysine content of the FMA is comparable to that of Fermented African locust bean 5.91 g/100 g cp (Oluwole & Oluremi, 2012). Lysine assists in calcium absorption and in maintaining the correct nitrogen balance in the body (Shweta, Santosh, & Manjul, 2017). This implies that the FMA could serve as a good source of protein for the fortification of cereal/cereal-based weaning foods where lysine is limiting.

2.9. Sensory analysis Sensory analysis was carried out to determine the quality and acceptability of the NFM and FMA samples. The sensory panel comprised thirty semi-trained members who had previously participated in descriptive panels. The panelists participated in four 1-h training sessions, during which time descriptors were developed. The final descriptors were chosen by the panelists after discussions during training. A scoring range of 1–10 (extremely unpleasant to extremely pleasant) was used for flavor, taste, color, softness and overall acceptability. 2.10. Statistical analysis Experimental results recorded were means ± standard deviation (SD) of triplicate determinations. Data were analyzed by one-way ANOVA and differences among samples were determined by comparison of means using Duncan's multiple range tests at p ≤ 0.05. Statistical analyses were performed using the SPSS version 20.0 and origin version 2018 (SPSS INC., Chicago, IL, USA).. 3. Results and discussion

3.2. Protein quality index

3.1. Amino acid profile

Table 2 shows the protein quality index of the African oil bean samples. The total essential amino acids (TEAA) present in the NFM and FMA samples are 35.29 g/100 g and 37.20 g/100 g crude protein respectively. The results revealed that the TEAA content of the FMA compares favorably with soybean (44.4 g/100 g cp) (Adenike & Adeyeye, 2011), Clarias anguillaris (31.7 g/100 g cp) (Adeyeye, 2009) and fermented African locust bean (40.65 g/100 g cp) (Oluwole & Oluremi, 2012) and could be used in the fortification of cereal and other starchy staple foods low in essential amino acids. Protein efficiency ratios (PER) is one of the vital parameter used to estimate the overall nutritional quality of proteins. Foods with PER values lower than 1.5 are low in protein quality while foods with PER values higher than 2 have high protein quality (Gokhan et al., 2012). The FMA sample had a theoretical PER value higher than 2.0 which implies high protein quality. The essential amino acid index (EAAI) has also become a useful rapid tool for evaluation of food formulations for protein quality. The EAAI of the FMA was 1.9 which is better than

The nutritional quality of any food protein depends mainly on its amino acid composition. Table 1 shows the amino acids profile of the African oil bean seed samples. The result revealed that the FMA had significantly higher concentration of the total amino acid (TAA) content (88.48 g/100 g cp) compared to NFM (81.04 g/100 g cp) and the UFM (8.07/100 g cp). The observed increase in the level of total amino acids in the FMA could be attributed to increased metabolic activities of the fermenting microorganisms. Glycine was the only amino acid that its concentration in the FMA sample was lower compared to the NFM sample. The lower concentration of glycine in FMA sample compared to the NFM sample could be as a result of the lower interconverting activity of serine hydroxymethyltransferase in the FMA sample leading to higher concentration of serine and lower concentration on glycine. Biosynthetic mechanisms, involving Bacillus species have been established to synthesize amino acids (Donatus & Aluwuo, 2008:; Achi, 431

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

Table 2 Effect of the processing on the protein quality index of the African oil bean samples. Protein quality index

UFM

NFM

FMA

TAA TNEAA %TNEAA TEAAWith His %TEAAWith His TNEAA No His %TNEAA No His TArAA %TArAA TSAA %TSAA TAAA %TAAA TBAA %TBAA TNAA %TNAA Leu/Ile ratio Leu-Ile difference %Leu –Ile P-PER1 P-PER2 P-PER3 EAAI

8.07 ± 0.02c 4.17 ± 0.01 c 51.55 3.92 ± 0.01 c 48.45 3.53 ± 0.02 c 43.62 0.93 ± 0.06 c 11.15 0.84 ± 0.01 c 10.29 0.96 ± 0.01 c 11.77 1.38 ± 0.01 c 17.1 5.24 ± 0.03 c 64.68 1.2 ± 0.35 c 0.00 ± 0.00c 0.00 ± 0.00 −0.46 ± 0.01 −0.24 ± 0.01 −1.42 ± 0.02 0±0c

81.04 ± 0.01b 45.72 ± 0.06 b 56.45 35.3 ± 0.02 b 43.55 31.33 ± 0.02 b 38.65 9.6 ± 0.17 b 11.72 3.83 ± 0.06 b 4.69 17.56 ± 0.02 b 21.66 13.69 ± 0.01 b 16.88 49.82 ± 0.02 b 61.46 1.48 ± 0.01 b 2.04 ± 0.01 a 32.07 2.17 ± 0.29 b 2.08 ± 0.01 b 1.16 ± 0.02 b 1.7 ± 0.17 b

88.48 ± 0.02a 51.28 ± 0.02 a 57.96 37.3 ± 0.1 a 42.04 35.07 ± 0.02 a 39.62 9.9 ± 0.02 a 11.18 4.37 ± 0.12 a 4.86 21.28 ± 0.02 a 24.03 14.28 ± 0.01 a 16.13 52.96 ± 0.03 a 59.83 1.6 ± 0.17 a 2.18 ± 0.01 b 33.55 2.07 ± 0.01 a 2.16 ± 0.01 a 1.3 ± 0.01 a 2 ± 0.17 a

c c c

Table 3 Fatty acid composition of the African oil bean samples. Fatty acid 2

Palmitic C16:0 Behenic2 C22:0 Lignoceric2 C24:0 Oleic1 C18:1 cis (n-6) Linoleic1 C18:2 (n-6) Linolenic1 C18:3 (n-3) ∑ FA ∑ SFA ∑ UFA ∑MUFA ∑PUFA ∑SFA/∑UFA n-3 n-6 n-3/n-6

UFM

NFM b

4.08 ± 0.01 20.58 ± 0.02a 3.8 ± 0.02c 19.88 ± 0.01a 0.16 ± 0.01c 10.07 ± 0.02a 58.52 ± 0.02b 28.44 ± 0.02a 30.09 ± 0.01b 19.87 ± 0.02a 10.22 ± 0.02c 0.96 ± 0.01a 0.06 ± 0.01c 20.03 ± 0.02c 0.53 ± 0.06a

FMA a

10.98 ± 0.01 2.73 ± 0.01b 11.1 ± 0a 16.07 ± 0.02b 12.94 ± 0.03a 7.98 ± 0.01b 61.75 ± 0.02a 24.8 ± 0.02b 36.96 ± 0.02a 16.06 ± 0.01b 20.91 ± 0.03a 0.67 ± 0.01c 7.97 ± 0.01a 28.98 ± 0.01a 0.29 ± 0.01b

0.97 ± 0.01c 1.63 ± 0.01c 9.17 ± 0.12b 14.37 ± 0.01c 10.93 ± 0.01b 5.98 ± 0.01c 10.36 ± 0.01c 4.08 ± 0.01c 6.29 ± 0.02c 14.37 ± 0.02c 16.97 ± 0.12b 0.67 ± 0.01b 5.97 ± 0.02b 25.27 ± 0.01b 0.25 ± 0.01c

Statistical analysis using ANOVA (n = 3) at 95% confidence interval (p ≤ 0.05). Different superscript along the row indicates significant difference between samples ∑ = Sum, fatty acid (FA), saturated fatty acid (SFA), unsaturated fatty acid (UFA), monounsaturated fatty acid (MUFA), polyunsaturated fatty acid (PUFA), omega-3 fatty acid (n-3), omega-6- fatty acid (n-6). UFM= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash.

Statistical analysis using ANOVA (n = 3) at 95% confidence interval (p ≤ 0.05). Different superscript along the row indicates significant difference between samples Total amino acid (TAA), Total non-essential amino acids (TNEAA), Total essential amino acid (TEAA), Total aromatic amino Acid (TArAA, Total sulphur amino acid (TSAA), Total acidic amino acid (TAAA), Total basic amino acid (TBAA), Total neutal amino acid (TNAA), P-PER– Predicted protein efficiency ration: EAAI–Essential amino acids index. UFM= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash. 0.00 ± 0.00 means undetected; the value is added to facilitate statistical analysis.

years). The essential amino acid score of all the fermented African oil bean seed samples was above the FAO recommendations (FAO/WHO/ UNU, 1985). Protein food with essential amino acid score below 70% (0.7) is said to have poor protein quality while those with an essential amino acid score above 90% (0.9) is said to be of good nutritional quality (Gokhan et al., 2012). Thus the score represents a simplified model for predicting the dietary protein quality and the result of this current study revealed that the FMA sample had better protein quality than NFM and meets the requirement for the fortification of infant and weaning foods (FAO/WHO/UNU, 1985; Goldflus et al., 2006).

soybean flour 1.26 and groundnut 0.83–1.18 (Adeyeye, 2010). The amino acid score (Fig. 1), shows the essential amino acids as compared to the FAO recommendations for preschool children (2–5

3.3. Fatty acids composition Table 3 shows the fatty acid compositions of the processed African oil bean seed samples. The FMA had the lowest fatty acids concentration (10.35%) compared with the NFM (61.74%) and the UFM (58.51%). Behenic acid (20.57%) was the most abundant FA in the UFM while oleic acid was the most dominant fatty acid in the NFM sample (16.06%) and the FMA (14.36%). The decrease in saturated fatty acid in the fermented samples could probably be due to increased hydrolysis of the glycerides (Oshodi, Olaofe, & Hall, 1993). Epidemiologic and clinic data have shown that high intake of dietary saturated fats generally increases the risk of heart diseases hence the need to always reduce intake of foods high in dietary saturated fats (Barceló-Coblijn et al., 2008; Hu & Willett, 2001). The total polyunsaturated fatty acid of the NFM sample was the highest (20.89%) followed by FMA sample (16.90%) while the UFM sample had the lowest total polyunsaturated fatty acids (10.21%.). Eating diets high in polyunsaturated fats in place of saturated fats reduces harmful low-density lipoprotein (LDL) cholesterol and improves high-density lipoprotein (HDL) profile in the bloodstream (Brucw & Cora, 2004; Hu & Willett, 2001; Oshodi et al., 1993). 3.4. Volatile compounds

Fig. 1. The essential amino acid score of the African oil been seed samples. WHO/FAO/UNU ideal protein for pre-school children aged 2–5 years; Percentage (%) amino acid score = (amino acid in sample/ideal). (WHO/FAO/ UNU (1985)). UFM= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash.

The result of the analysis of the volatile composition of the African oil bean samples is presented in Table 4. The result showed that the major volatile compositions of the samples are acids, esters, alcohols, aldehydes, phenol, hydrocarbons, and furans. Ugba is widely utilized as a flavoring agent in soup, stew and other delicacies; however, its beany 432

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

Table 4 Volatile compounds (mean GC-FID peak area × 108) and their relative peak area (RPA, %) in UFM, NFM and FMA. Compound identified

Acids Butanoic acid n-Hexadecanoic acid Pentadecanoic acid 7,9-Octadecadienoic acid (Z,Z)Esters 2-Propenoic acid, 2-(dimethylamino)ethyl ester Octadecanoic acid, 3,3-dihydroxypropyl ester 9-Octadecenoic acid (Z), methyl ester 13,15-Octadecadienoic acid, methyl ester Octadecanoic acid, ethyl ester Hexadecanoic acid, methyl ester Hexadecanoic acid, ethyl ester Hexadecanoic acid, 2,3-dihydroxypropyl ester Linoleic acid methyl ester 9,12-Pentadecadienoic acid, methyl ester Benzeneacetic acid, ethyl ester 1,4-Benzenedicarboxylic acid, mono (2-ethylhexyl) ester 10,14-Eicosadienoic acid, methyl ester. Alcohols Hexanol (Z)6, (Z)9-Pentadecadien-1-ol 2-Hydroxymethyl-2-methylcyclo-pentanol Aldehydes 2,4-Hexadienal 7,11-Octadecadienal 7, 9,-Octadecadienal, (Z) Phenol Ethyl phenol Hydrocarbon Isobutylcycloheptane 7,9-Dimethyl-1,6- octadiene Hexyl-3-nitrocyclohexane Furan 2-butyltetrahydrofuran 2-penty furan

UFM Peak area

RPA (%0)

NFM Peak area

RPA (%)

FMA Peak area

0.00 0.01 0.00 0.00

1.16 0.22 0.68 0.68

± ± ± ±

0.06a 0.02a 0.12a 0.12a

9.4 1.70 5.48 5.48

0.03 0.02 0.00 0.00

± ± ± ±

0.01b 0.01b 0.00b 0.00b

0.64 0.4 0.00 0.00

1.76 0.04 0.23 0.00 0.19 0.23 0.01 0.00 1.13 0.00 2.43 0.00 0.00

± ± ± ± ± ± ± ± ± ± ± ± ±

0.06a 0.01a 0.06b 0.00 c 0.01c 0.02c 0.01 c 0.00 b 0.06 c 0.00 c 0.06 b 0.00 b 0.00 c

14.29 0.30 1.89 0.00 1.51 1.89 0.11 0.00 9.18 0.00 19.7 0.00 0.00

0.00 0.53 0.27 0.43 0.61 0.37 0.02 0.00 1.33 0.03 0.00 0.00 0.05

± ± ± ± ± ± ± ± ± ± ± ± ±

0.00b 0.04a 0.12a 0.03b 0.35b 0.12b 0b 0.00 b 0.06 b 0.01 a 0.00 c 0.00 b 0b

0.00 12.73 6.36 10.18 14.56 8.75 0.48 0.00 31.82 0.64 0.00 0.00 1.19

0.00 ± 0.00 c 0.00 ± 0.00 c 0.00 ± 0.00 b

0.00 0.00 0.00

0.03 ± 0.01 b 0.3 ± 0.01 a 0.00 ± 0.00 b

0.64 7.16 0.00

0.21 ± 0.01 0.31 ± 0.01 0.17 ± 0.01

a

1.67 2.54 1.35

0.03 ± 0.01 b 0.13 ± 0.06 b 0.00 ± 0.00 b

0.00 ± 0.00

c

0.00

1.17 ± 0.12 1.03 ± 0.06

a

0.23 ± 0.06 1.32 ± 0.01

a

a a

a

a

± ± ± ±

RPA (%)

0.00c 0.01b 0.00b 0.00b

0.00 0.11 0.00 0.00

0.00 ± 0.00b 0.55 ± 0.03b 0.24 ± 0.04c 0.74 ± 0.03a 2.37 ± 0.46a 0.4 ± 0.17a 0.08 ± 0.01 a 0.06 ± 0a 2.47 ± 0.12 a 0.03 ± 0.01 a 4.07 ± 0.29 a 0.37 ± 0.12 a 0.06 ± 0.01 a

0.00 4.68 2.08 6.35 20.2 3.42 0.71 0.51 21.1 0.29 34.8 3.14 0.48

0.04 ± 0.01 0.27 ± 0.06 0.06 ± 0.01

a

0.37 2.28 0.51

0.64 3.18 0.00

0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.0 b

c

0.3 ± 0.01 b

7.16

0.69 ± 0.12

a

5.87

9.4 8.37

0.02 ± 0.01 b 0.04 ± 0.01 b

0.4 0.88

0.02 ± 0.01 0.02 ± 0.01

c c

0.14 0.14

1.89 10.7

0.00 ± 0.00 b 0.05 ± 0.01 b

0.00 1.11

0.00 ± 0.0 b 0.00 ± 0.00

c

0.00 0.00

a

0.00 0.00 0.00

c

Statistical analysis using ANOVA (n = 3) at 95% confidence interval (p ≤ 0.05). Same superscript along the row indicates no significant difference between samples:RPA (%) = (peak area of compound/total peak area) × 100% and 0.00 ± 0.00: undetected; the value was added to facilitate statistical analysis. FMA= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash. 0.00 ± 0.00 means undetected; the value is added to facilitate statistical analysis.

flavor sometimes limits its acceptability. This beany flavor is derived from lipoxygenase catalytic oxidation of unsaturated fatty acids such as linoleic and linolenic acid in the oil bean seed into furans and aldehydes (Yu, Liu, Hu, & Xu, 2018). In this study, 2-butyltetrahydrofuran and 2penty furan known to be particularly responsible for the beany flavor of most bean seeds were completely metabolized hence were not detected in the FMA sample. Hexadienal which is also often associated with the grassy flavor in bean products (Hsieh, Huang, & Chang, 2010) was also completely metabolized together with other odorous aldehydes family in the FMA sample. The concentrations of essential aroma compounds such as esters and alcohol increased in the FMA compared to the NFM and UFM samples. Aroma is a very important and critical quality parameter of any flavoring agent hence the replacement of the beany flavor in the UFM sample with the aromatic flavor of esters and some alcohols further increased the acceptability of the FMA as a flavoring agent (Nwokeleme & Obeta, 2015). Hence the processing aid significantly improved the concentrations of essential volatile compounds thereby increasing its value as a flavoring agent.

Table 5 The anti-nutritional composition of the African oil been samples. Anti-nutrient Trypsin Inhibitor (TUI/ mg) Phytate (mg/100 g) Tannins (% as catechin equivalent)

UFM 74.46 ± 0.06

NFM a

634.87 ± 0.58a 0.62 ± 0.01a

23.2 ± 0.06

FMA b

223.9 ± 4.62b 0.00 ± 00 b

10.97 ± 0.58c 111.11 ± 1.73c 0.00 ± 00 b

Statistical analysis using ANOVA (n = 3) at 95% confidence interval (p ≤ 0.05). Same superscript along the row indicates no significant difference between samples. UFM= Unfermented African oil bean seed; NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash. 0.00 ± 0.00 means undetected; the value is added to facilitate statistical analysis.

(Zhou et al., 2017). Tannins add astringent taste to food in addition to its ability to precipitate proteins and amino acid thereby reducing protein bioavailability (Chung, Wong, Wei, Huang, & Lin, 1998). In this study the concentrations of Trypsin Inhibitor, Phytate and Tannins decreased from 74.46 ± 0.06 (TUI/mg) to 10.97 ± 0.58 (TUI/mg), 634.87 ± 0.58 (mg/100 g) to 111.11 ± 1.73 (mg/100 g) and 0.62 ± 0.01 (% catechin equivalent) to 0.0 (% catechin equivalent) in the UFM and FMA respectively. This decreased in the anti-nutritional factor in the FMA sample further improves its nutritional value.

3.5. The anti-nutritional composition of the African oil bean samples The result of changes in phytate, tannins and trypsin inhibitor activity concentrations in the processed African oil bean samples is shown in Table 5. Phytate, tannins, and trypsin inhibitor are common antinutrient found in African oil bean seed and other bean products. Phytate reduces mineral bioavailability while trypsin inhibitor decreases digestion of dietary protein, reduced nitrogen and sulphur absorption 433

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

Table 6 Microbial diversity index of the fermented African oil bean samples. NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash. 16S rRNA

Seq num

OUT num

Shannon index

ACE index

Chao 1 index

Coverage

Simpson

NFM FMA ITS NFM FMA

46687 45910

2318 879

2.07 1.35

27112.43 5671.64

38911.03 23121.76

0.41 0.58

0.47 0.64

7626 29528

994 1286

1.56 3.01

7624.43 14523.29

1123.43 1023.43

0.44 0.59

0.58 0.39

of the fermented African oil bean seed samples. Species classification information corresponding to each OTU was obtained using the RDP classifier Bayesian algorithm at 97% similarity level. Taxonomic classification of bacteria and fungi are shown in Table 7. The dominance of the genus Bacillussp., especially in the FMA, further support that protein hydrolysis is the major biochemical changes in the fermentation of African oil bean as previously reported by Ogueke et al. (2010). Hence it provides evidence for the increased amino acid content of the FMA. Bifidobacteria were also identified in the FMA; Bifidobacteria are very difficult to cultivate and are very popular for their participation in the synthesis of B-complex vitamins and vitamin K in the intestine. These vitamins are important for bone health and blood clotting. Bifidobacteria have also been showed to support the growth and multiplication of other functional gut microbiota thereby simultaneously decreasing the concentrations of carcinogenic and putrefactive compounds as well as pathogenic microorganisms in the digestive system (Fiorda et al., 2017). The FMA had greater yeasts diversity; yeast produces alcohol and other volatile compounds that improve the aroma of fermented products (Chakravorty et al., 2016; Fiorda et al., 2017). Hence the higher protein hydrolysis and fermentative activity in the FMA provides evidence to its better chemical composition than the NFM.

3.6. Microbial diversity index Single diversity analysis (Alpha diversity) was used to determine the microbial diversity index in the NFM and FMA samples (Table 6). The result reflects the abundance and diversity of the microbial communities in the NFM and FMA samples. The ACE indices were 27112 and 5671 for the 16s rRNA and 7624 and 14523 for ITS region for the NFM and FMA respectively. The (Abundance-based coverage estimator) ACE index was used to estimate the total number of operational taxonomic unit (OTU) at 97% similarity hence reflect the total number of species in the microbial community in the NFM and FMA respectively. High ACE and Chao1 values indicate high community richness. The NFM bacterial community was richer than the FMA sample while the fungal community of the FMA sample was richer than the NFM sample. This implies that the processing aid selectively encouraged the growth of a few species of bacteria while supporting the growth of a diverse group of fermentative yeasts. The higher Shannon index and lower Simpson values of the bacterial community in the NFM sample imply greater diversity than the FMA sample. This provides evidence that naturally fermented African oil bean seeds are prone to post-fermentation spoilage as the NFM sample had more spoilage bacteria like Alcaligenes sp. than the FMA sample (Table 7). The higher Shannon index and lower Simpson values of the fungal community in the FMA sample also imply greater diversity than NFM sample. The Coverage rate index shows that the sequencing was detailed and represents the real microbial situation in the sample.

3.8. Sensory evaluation The result of the sensory evaluation is presented in Fig. 2. The result showed that the FMA had better color, taste, flavor, softness and general acceptability compared to the NFM sample. The better flavor of the FMA sample could be due to higher concentrations of aromatic esters and alcohols. The higher concentration of amino acids and lower concentrations of residual anti-nutritional factors could have also

3.7. Molecular identification of the microbial community In this study, metagenomic sequencing was used to reveal the relationship between microbiota composition and chemical composition

Table 7 Bacterial (16S rRNA) and fungal (ITS) composition of the fermented African oil bean samples. 16S rRNA

Bacillus sp. Alcaligenes sp. Komagataeibacter sp. Corynebacterium sp. Micococcus sp. Gluconobacter sp. Nguyenibacter sp. lactobacillus sp. Proteus sp. Pseudomonas sp. Leuconostoc sp. Tanticharoenia sp. Clostridium sp. Comamonas sp. Bifidobacterium sp. Unclassified

NFM

FMA

% Abundance

% Abundance

82.13 1.23 1.92 0.03 0.01 0.00 0.01 0.03 0.01 0.00 0.07 0.04 0.00 0.00 0.00 14.52

98.72 0.03 0.07 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.01 1.18

ITS

Candida tropicalis Candida kruisii Candida elateridarum Saccharomyces cerevisiae Geotrichum candidum Aspergillus penicillioides Kazachstania humilis Penicillium multicolor Cladosporium sphaerospermum Talaromyces euchlorocarpius Penicillium bialowiezense Mortierella alpina Issatchenkia orientalis Clavaria fragilis Peniophora sp Rhizopus arrhizus Pichia membranifaciens Dekkera bruxellensis Unclassified

NFM

FMA

% Abundance

%Abundance

88.84 5.93 0.42 0.55 0.81 0.42 0.84 0.08 0.56 0.28 0.00 0.30 0.01 0.00 0.00 0.00 0.03 0.00 0.93

78.38 3.80 0.02 0.26 0.30 0.12 0.00 0.00 0.00 2.97 0.18 3.03 2.97 0.18 0.00 2.60 0.00 2.59 2.58

NFM = African oil bean fermented without Oil palm inflorescence ash; FMA = African oil bean seed fermented with oil palm inflorescence ash. 434

LWT - Food Science and Technology 111 (2019) 429–435

F. Azi, et al.

Brucw, J. G., & Cora, J. D. (2004). Saturated fats: What dietary intake. American Journal of Clinical Nutrition, 80(3), 550–559. Chakravorty, S., Bhattacharya, S., Chatzinotas, A., Chakraborty, W., Bhattacharya, D., & Gachhui, R. (2016). Kombucha tea fermentation: Microbial and biochemical dynamics. International Journal of Food Microbiology, 220, 63–72. Chua, J. Y., Lu, Y., & Liu, S. Q. (2017). Biotransformation of soy whey into soy alcoholic beverage by four commercial strains of saccharomyces cerevisiae. International Journal of Food Microbiology, 262, 14–22. Chung, K. T., Wong, T. Y., Wei, C. I., Huang, Y. W., & Lin, Y. (1998). Tannins and human health: A review. CRC Critical Reviews In Food Technology, 38(6), 44. Donatus, E. O., & Aluwuo, C. J. (2008). Studies on the phytochemical composition and fermentation of the seeds of african oil bean tree (pentaclerhra macrophylla benth). International Journal of Chemical Sciences, 6(2), 773–788. Enujiugha, V. N., & Ayodele-Oni, O. (2003). Evaluation of nutrients and some ant-nutrients in lesser-known and underutilized oilseeds. International Journal of Food Science and Technology, 38, 525–528. Enujiugha, V. N. (2003). Nutrient changes during the fermentation of african oil bean (pentaclethra macrophylla benth) seeds. Pakistan Journal of Nutrition, 2(5), 320–323. Enujiugha, V. N., & Akanbi, C. T. (2005). compositional changes in african oil bean (Pentaclethra macrophylla, benth) seeds during thermal processing. Pakistan Journal of Nutrition, 4(1), 27–31. Eshun, N. A., Adu, E., Barimah, J., Dossou, mV. M., & Van Twisk, C. (2015). Amino acid profiles of some varieties of rice, soybean and groundnut grown in Ghana. FAO Food and Nutrition Paper 51 FAO Rome, 6(2), 1–3. https://doi.org/10.4172/2157-7110. 1000420. FAO/WHO/UNU. (1985). Energy and protein requirementWHO technical report Series 724Geneva: WHO. Fiorda, F. A., de Melo Pereira, G. V., Thomaz-Soccol, V., Rakshit, S. K., Pagnoncelli, M. G. B., de Souza Vandenberghe, L. P., et al. (2017). Microbiological, biochemical, and functional aspects of sugary kefir fermentation-A review. Food Microbiology, 66, 86–95. Gokhan, Z., Abdurrahman, A., Gokalp-Ozmen, G., Yavuz-Selim, C., Julio, G., Manuel, A., et al. (2012). Nutritional quality of protein in the leaves of eleven Asphodeline species (Liliaceae) from Turkey. Food Chemistry, 135, 1360–1364. Goldflus, F., Ceccantini, M., & Santos, W. (2006). Amino acid content of soybean samples collected in different Brazilian states – harvest. Brazilian Journal of Poultry Science, 8(2), 105–111. Hsieh, A. L., Huang, A. S., & Chang, S. S. (2010). Isolation and identification of objectionable volatile flavor compounds in defatted soybean flour. Journal of Food Science, 47(1), 16–18. Huang, Y., Yi, Z., Jin, Y., Zhao, Y., He, K., Liu, D., et al. (2017). New microbial resource: Microbial diversity, function and dynamics in Chinese liquor starter. Scientific Reports, 7(1), 14577. Hu, F. B., & Willett, W. C. (2001). Types of dietary fat and risk of coronary heart disease: A critical review. Journal American Collanary Nutrition, 20, 5–19. Latta, M., & Eskin, M. (1980). A colorimetric method, for phytate determination. Journal of Agricultural and Food Chemistry, 28, 1313–1315. Mbajunwa, O. K. (1995). Effect of processing on some ant-nutritive and toxic components and on the nutritional composition of the African oil bean seed (Pentaclethra macrophylla Benth). Journal of the Science of Food and Agriculture, 68(2), 153–158. Mubarak, A. E. (2005). Nutritional composition and antinutritional factors of mung bean seeds ( phaseolus aureus ) as affected by some home traditional processes. Food Chemistry, 89(4), 489–495. Nwokeleme, C. O., & Obeta, U. J. (2015). Evolution of volatile flavour compounds during fermentation of african oil bean (\r, pentaclethra macrophylla\r, benth) seeds for “ugba” production. International Journal of Food Science, 15, 1–8. Ogueke, C. C., Nwosu, J. N., Owuamanam, C. I., & Iwoono, J. N. (2010). Ugba, the fermented african OilBean seed: Its production, chemical composition, preservation safety and health benefits. Pakistan Journal of Biological Sciences, 13(10), 489–496. Oguntoyinbo, F. A. (2014). Safety challenges associated with traditional foods of West Africa. Food Review Inernational, 30, 338–358. Ohiri, R. C., & Bassey, E. E. (2017). Fermentation induced changes in volatile components of african oil bean (pentaclethra macrophylla benth) seeds. Food Sciences and Nutrition, 5(4), 948–955. Olasupo, N. A., Okorie, C. A., & Oguntoyinbo, F. A. (2016). The biotechnology of ugba, a Nigerian traditional fermented food condiment. Frontiers in Microbiology, 7, 11–53. Oluwole, S. I., & Oluremi, O. K. (2012). Comparison between the amino acid, fatty acid,mineral and nutritional quality of raw, germinated and fermented african locust bean (parkia biglobosa) flour. Acta Scientiarum Polonorum Technologia Alimentaria, 11(2), 151–165. Oshodi, A. A., Olaofe, O., & Hall, G. M. (1993). Amino acid, fatty acid and mineral composition of pigeon pea (Cajanus cajan). International Journal Food Science Nutrition, 43, 187–191. Price, M. L., Socoyoc, S. V., & Butler, L. G. (1978). A critical evaluation of the vanillin reaction as an assay for tannin in sorghum grain. Journal of Agricultural and Food Chemistry, 26, 1214–1218. Shweta, T., Santosh, K. S., & Manjul, S. (2017). Amino acid profile of some new varieties of leguminous seeds. Journal Institute of integrative Omics and Applied Biotechnology, 8(4), 48–53. Steinke, F. H., Prescher, E. E., & Hopkins, D. T. (1980). Nutritional evaluation (PER) of isolated soybean protein and combinations of food proteins. Journal of Food Science, 45, 323–327. WHO (2013). Malnutrition-the global picture. World Health Organizationhttp://www.who. int/home-page/. Yu, H., Liu, R., Hu, Y., & Xu, B. (2018). Flavor profiles of soymilk processed with four different processing technologies and 26 soybean cultivars grown in China. International Journal of Food Properties, 1–12. Zhou, T., Han, S., Li, Z., & He, P. (2017). Purification and quantification of kunitz trypsin inhibitor in soybean using two-dimensional liquid chromatography. Food Analytical Methods, 10(10), 3350–3360.

Fig. 2. Sensory quality of the fermented African oil bean seed.

contributed to the better taste of the FMA sample. The brilliant blue color of the FMA sample also further enhanced its ecstatic value hence was preferred by the panelist. Thus FMA sample had better sensory property hence had greater general acceptability. 4. Conclusions In the current study, the effect of processing aid on the chemical composition and metagenomics of fermented African oil bean seed (Pentaclethra macrophylla Benth) was investigated. The finding of the study showed that African oil bean seed processed with oil palm inflorescence ash had improved protein quality and could be used in the fortification of protein deficient staple foods, especially in developing countries. The African oil bean seed processed with the oil palm inflorescence ash had higher concentrations of aromatic volatile compounds and lower residual anti-nutritional content hence had better sensory quality. The metagenomic analysis showed the African oil bean processed with the aid had lower spoilage bacteria and higher fermentative yeasts hence had a better chemical composition and general acceptability. The results of this study thus provide evidence that processing African oil bean seed with oil palm inflorescence ash improves its chemical composition and reduce the number of potential spoilage microorganisms. Metabolomic study needs to be done to further provide insight into the pathways used by the microorganisms to produce the nutritional and volatile compound found in the fermented African oil bean seed. Acknowledgments We thank the Department of Food Science and Technology, Ebonyi State University, Abakaliki, Nigeria and IESL laboratory Portharcourt, Nigeria, for providing us with the laboratory and facilities for this research. References Achi, O. K. (2005). The potential of upgrading of traditional fermented foods through biotechnology. African Journal of Biotechnology, 4, 375–380. Adenike, M. O.,., & Adeyeye, E. I. (2011). The amino acids profile of the brain and eyes of African giant pouch rat (Cricetomys gambianus). Agriculture and Biological Journal of North America, 2(2), 368–375. Adeyeye, E. I. (2009). Amino acid composition of three species of Nigerian fish: Clarias anguillaris, Oreochromis niloticus and cynoglossus senegalensis. Food Chemistry, 113, 43–46. Adeyeye, E. I. (2010). Effect of cooking and roasting on the amino acid composition of raw groundnut (Arachis hypogaea) seeds. Acta Scientiarum Polonorum Technologia Alimentaria, 9(2), 201–216. Ayodele, S., & Iwhiwhu, O. (2011). Comparative efficacy of oil palm inflorescence ash, orange peels ash and benlate in preservation of cassava tubers (manihot esculenta crantz). British Journal of Clinical Pharmacology, 2(1), 1–5. Baoua, I. B., Amadou, L., Margam, V., & Murdock, L. L. (2012). Comparative evaluation of six storage methods for postharvest preservation of cowpea grain. Journal of Stored Products Research, 49, 171–175. Barceló-Coblijn, G., Murphy, E. J., Othman, R., Moghadasian, M. H., Kashour, T., & Friel, J. K. (2008). Flaxseed oil and fish-oil capsule consumption alters human red blood cell n–3 fatty acid composition: A multiple-dosing trial comparing 2 sources of n–3 fatty acid. American Journal of Clinical Nutrition, 88, 801–809.

435