- Email: [email protected]
Effect of Proinflammatory Cytokines on the Expression and Regulation of Human Beta-Defensin 2 in Human Dental Pulp Cells
Basic Research—Biology
Effect of Proinflammatory Cytokines on the Expression and Regulation of Human Beta-Defensin 2 in Human Dental Pulp Cells Young-Suk Kim, PhD,* Kyung-San Min, DDS, PhD,† Sang-Im Lee, MSD,* Su-Jung Shin, DDS, MSD,‡ Kyoung-Seob Shin, DDS,* and Eun-Cheol Kim, DDS, PhD* Abstract Introduction: Although the expression of human betadefensin-2 (hBD-2) in odontoblasts from human dental pulp (HDP) has been reported, the production of hBD2 and its regulation remains poorly understood. The aim of this study was to investigate the effect of cytokines on the induction of hBD-2 and its signaling mechanisms in HDP cells. Methods: After stimulation with tumor necrosis factor a (TNF-a) and interleukin 1a (IL1a), reverse-transcriptase polymerase chain reaction, Western blot, and enzyme-linked immunosorbent assay experiments were performed to evaluate the effects of these cytokines on the production of hBD-2. Results: TNF-a and IL-1a synergistically increased hBD-2 messenger RNA levels, protein expression, and activity. The up-regulation of hBD-2 by cytokines was attenuated by pretreatment with inhibitors of PKC, JNK, p38, ERK MAPK, nuclear factor-kB, and adenosine monophosphate-activated protein kinase (AMPK). Conclusion: These results suggest that TNF-a and IL-1a up-regulate HBD-2 expression in HDP cells through the PKC, JNK MAPK, p38, ERK, NF-kB, and AMPK pathways. Thus, the induction of hBD-2 by proinflammatory cytokines might up-regulate the pulpal host immune defense system. (J Endod 2010;36:64–69)
Key Words Adenosine monophosphate-activated protein kinase, human b-defensin 2, human dental pulp cells, nuclear factor-kB, protein kinase C
From the Department of *Oral and Maxillofacial Pathology and †Conservative Dentistry, College of Dentistry, Wonkwang University, Iksan, South Korea; and ‡Department of Conservative Dentistry, College of Dentistry, Yonsei University, Seoul, South Korea. This study was supported by a grant from the Korea Healthcare Technology R&D Project, Ministry for Health, Welfare & Family Affairs, Republic of Korea (A084458). Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology, Dental College, Wonkwang University, Sinyoungdong 344-2, Iksan City, Jeonbuk, 570-749, South Korea. E-mail address: eckwkop@ wonkwang.ac.kr. 0099-2399/$0 - see front matter Copyright ª 2010 by the American Association of Endodontists. All rights reserved. doi:10.1016/j.joen.2009.09.022
64
Kim et al.
D
ental pulp tissues are capable of innate and adaptive immune responses under various inflammatory conditions (1, 2). In particular, interleukin-1 (IL-1) and tumor necrosis factor a (TNF-a) play important roles in the immune response to infection (3, 4). However, the mechanisms of host defense against bacterial infection in human dental pulp (HDP) cells are not completely understood. One host-defense system that involves the innate immune response upon exposure to the external environment is the production of defensin (5). Human b-defensin (hBD) is a small cationic antimicrobial peptide made by epithelial cells and expressed in all human epithelia tested to date, including oral epithelia (6). hBD-1 is constitutively expressed in epithelial tissues, whereas hBD-2 is expressed when the epithelia are stimulated with bacteria, Candida albicans, IL-1, or TNF-a (7–10). Differential gene expression of hBD-1 and -2 has been shown in healthy and inflamed dental pulp (11, 12). In healthy dental pulp, hBD-1 expression was significantly higher than that of hBD-2. In contrast, the levels of both hBD-1 and hBD-2 messenger RNAs (mRNAs) were significantly lower during the clinical stage of an irreversible pulpitis (11). Recently, hBD-2 stimulation was found to lead to the up-regulation of the IL-6, IL-8, and cytosolic phospholipase-A-2 mRNA levels, suggesting that the synthesis of hBD2 in odontoblast cells enhances the immunoinflammatory reactivity of dental pulp (13). The induction of HBD-2 expression by cytokines and bacterial factors is influenced by the activities of protein kinase C (PKC) and mitogen-activated protein kinases (MAPKs) as well as transcriptional factors, in particular nuclear factor-kB (NF-kB) (14–16). Adenosine monophosphate-activated protein kinase (AMPK), a serine/threonine protein kinase, monitors the cellular energy status and responds to a variety of stressors (17). Recent studies have suggested that AMPK plays an important role in the treatment of type 2 diabetes mellitus, protection from apoptosis, and regulation of angiogenesis; exerts antiatherosclerotic effects; and is involved in anti-inflammatory signaling (17, 18). Furthermore, the levels of the main AMPK subunit isoform increased time dependently under hypoxia in rat dental pulp cells (19). This suggests that AMPK plays an important role in the reactions of pulp cell to stimuli, presumably in maintaining energy homeostasis. However, the involvement of the AMPK pathway in proinflammatory cytokine-induced innate immunity had not been assessed. The aim of this study was to investigate the modulating effect of proinflammatory cytokines on the innate immune responses of HDP cells. We also examined the involvement of the MAPK, NF-kB, PKC, and AMPK signaling pathways in TNF-a- and IL-1-a-induced hBD-2 expression in HDP cells.
Materials and Methods Reagents Dulbecco’s Modified Eagle Medium, fetal bovine serum, and other tissue culture reagents were obtained from Gibco BRL Co (Grand Island, NY). Recombinant human TNF-a and recombinant human IL-1a were purchased from Sigma-Aldrich (St Louis, MO). Anti-hBD-2, antiphospho AMPK, anti-AMPK, and b-actin monoclonal antibodies were purchased from Santa Cruz Biotechnology (Heidelberg, Germany). Pyrrolidine dithiocarbamate (PDTC); Ro318220; and the MAP kinase inhibitors SB203580, PD98059, and SP600125 were purchased from Calbiochem (La Jolla, CA).
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology Cell Culture We used the HDP cell lines immortalized by transfection with the telomerase catalytic subunit hTERT gene (20). Cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidified atmosphere of 5% CO2 at 37 C. RNA Isolation and Reverse-transcriptase Polymerase Chain Reaction Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. Reverse transcription of the RNA was performed by using AccuPower RT PreMix (Bioneer, Daejon, Korea). Amplification was performed in a thermal cycler. The primers used for complementary DNA amplification were as follows: for hBD-2, 50 -CATGAGGGTCTTGTATCTCCTCT-30 (sense) and 50 -CCTCCTCATGGCTTTT TGCAGC-30 (antisense), for IL-6, 50 -ATGAACTCCTTCTCCACAAGC-30 (sense) and 50 -CTACATTTGCCGAAGAGCCC-30 (antisense), for IL-8, 50 -ATGACTTC CAAGCTGGCCGTGG-30 (sense) and 50 -TGAATTCTCAGCCCTCTTCAAAAAC-30 (antisense), for IL-17, 50 -CGATGACTCCTGGGAAGACCTC-30 (sense) and 50 -GTGTGGGCTCCCCAGAGCTCTTA-30 (antisense), for heme oxygenase-1 (HO-1), 50 -AAGATTGCCCAGAAAGCCCTGGAC-30 (sense) and 50 -AACTGTCG CCACCAGAAAGCTGAG-30 (antisense), and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 50 - CGGAGTCAACGGATTTGGTCGTAT -30 (sense) and 50 - AGCTTCTCCATGGTGGTGAAGAC -30 (antisense). The reaction conditions for polymerase chain reaction were 30 cycles, denaturation at 94 C for 30 seconds, annealing at 56 C for 30 seconds, and extension at 72 C for 30 seconds. The polymerase chain reaction products were resolved on a 1.5% agarose gel and stained with ethidium bromide. Western Blot Analysis Cell extracts were prepared by solubilizing cells in sodium dodecyl sulfate-protein lysis buffer (5 mmol/L EDTA, 1 mmol/L MgCl2, 50 mmol/ L Tris-HCl [pH = 7.5], 0.5% Triton X-100, 2 mmol/L phenylmethylsulfonyl fluoride, and 1 mmol/L N-ethylmaleimide) for 30 minutes on ice. The cell lysates were centrifuged at 14,000g for 20 minutes. Equivalent amounts of total protein from each cell extract were separated by electrophoresis in a 12.5% sodium dodecyl sulfate-polyacrylamide gel. After electrophoresis, the proteins were transferred onto a polyvinylidene difluoride membrane, which was then treated with blocking solution for 1 hour and incubated with primary (hBD-2, phospho-AMPK, AMPK, and b-actin) and horseradish peroxidase-conjugated secondary antibodies for 1 hour each at 37 C. The proteins were visualized using an enhanced chemiluminescence system (Amersham, Piscataway, NJ). Measurement by Enzyme-linked Immunosorbent Assay The concentrations of hBD-2 in the culture supernatants were determined by an enzyme-linked immunosorbent assay kit (Assay Designs, Ann Arbor, MI) according to the manufacturer’s recommended procedure. The plates were read at 450 nm on a microplate reader (Molecular Devices, Sunnyvale, CA). hBD-2 Small Interfering RNA Transfection Small interfering RNA (siRNA) was used for transient gene knockdown studies. All transient transfections were performed in triplicate using Opti-MEM (Invitrogen Life Technologies, Carlsbad, CA) following the manufacturer’s instructions. Cells in the exponential growth phase were plated in six-well plates at a density of 5 105 cells/well, grown for 20 hours, and then transfected with 80 pmol of hBD-2 siRNA by using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. Silencer negative control siRNA was used as a negaJOE — Volume 36, Number 1, January 2010
tive control and was introduced into the cells using the same protocol. After transfection, cells were cultured in six-well plates at 37 C until needed. The efficiency of gene knockdown was evaluated by reversetranscriptase polymerase chain reaction.
Statistical Analysis Differences among groups were analyzed by using one-way analysis of variance combined with the Bonferroni test. All values are expressed as means standard deviation; differences were considered significant at p < 0.05. The intensity of each protein or mRNA expression after normalization with b-actin or GAPDH was quantified on the photographed gels with a densitometer (Quantity One; Bio-Rad, Hercules, CA).
Results Effects of TNF-a and IL-1a on hBD-2 Production Because hBD-2 was reported to be induced by various stimuli, we initially determined whether HDP cells express hBD-2 mRNA in response to cytokines. The cytokine combination of TNF-a (10 ng/ mL) plus IL-1a (10 ng/mL) resulted in synergistic hBD-2 mRNA expression after 72 hours of incubation. The increases in hBD-2 protein expression and activity appeared to correspond to increased hBD-2 mRNA levels in HDP cells (Fig. 1A-C). Effects of Various Signaling Pathway Inhibitors on Cytokine-induced hBD-2 Expression To investigate the signal transduction pathways involved in regulating hBD-2 expression in response to cytokines, we examined the effects of various pharmacologic inhibitors of signaling intermediates on the hBD-2 mRNA, protein, and activity levels. As shown in Figure 2, we found that pretreatment of cells with SP600125 (JNK inhibitor), PD98059 (ERK inhibitor), SB203580 (p38 inhibitor), PDTC (NF-kB inhibitor), Ro-318220 (PKC inhibitor), and GO¨6976 (PKC alpha inhibitor) blocked proinflammatory cytokine-induced hBD-2 mRNA, protein, and activity, but Rottlerin (PKC delta inhibitor) did not. Role of AMPK Pathway on Proinflmmatory Cytokineinduced hBD-2 Expression We investigated whether AMPK induced hBD-2 production in response to proinflammatory cytokines through the activation of AMPK by phosphorylation. As shown in Figure 3A and B, cytokine increased the phosphorylation levels of AMPKa but not the level of total AMPKa. We next examined whether the AMPK pathway played an important role in hHD-2 expression by using an activator (5-aminoimidazole carboxamide riboside [AICAR]) of AMPK activity. As shown in Figure 3B and C, pretreatment with AICAR for 1 hour attenuated proinflammatory cytokine-induced hBD-2 mRNA, protein, and activity in a dose-dependent manner. Effects of hBD-2 siRNA on Proinflmmatory Cytokineinduced Host Immune Defense Genes Expression hBD-2 siRNA was transfected into HDP cells, and the mRNA expression of IL-6, IL-8, IL-17, and HO-1 was measured to determine whether hBD-2 is directly responsible for the induction of immune defense gene. hBD-2 siRNA blocked the induction effects of cytokines on IL-6, IL-8, IL-17, and HO-1 mRNA expression, which suggests that hBD-2 plays an important role in immune defense actions in HDP cells (Fig. 3D). Effect of Proinflammatory Cytokines on hBD-2 in HDPC
65
Basic Research—Biology #
A
#
48 h
24 h TNF-α IL-1α
-
+ - +
+ +
+ - +
72 h + +
+ - +
+ +
hBD-2
Fold increase
20
* 15 10 5
GAPDH
0
TNF-α α IL-1α
-
+ - +
+ +
+ - +
+ +
48 h
24 h
+ - +
+ +
72 h
B #
-
TNFIL-1
+ - +
+ +
+ - +
72 h + +
+ - +
+ +
hBD-2 -actin
Fold increase
15
48 h
24 h
#
*
10
*
5
0
TNFIL-1
-
+ - +
24 h
C
+ +
+ - +
+ +
48 h
+ - +
+ +
72 h
#
hBD-2 (pg/ml)
50
#
*
*
30
*
#
#
40
#
#
*
*
20 10 0
TNFIL-1
-
+ - +
24 h
+ +
+ - +
48 h
+ +
+ - +
+ +
72 h
Figure 1. The effects of proinflammatory cytokines on (A) hBD-2 mRNA, (B) protein, and (C) activity in HDP cells. HDP cells were incubated with 10 ng/ml of IL1a or 10 ng/mL of TNF-a for the indicated times. mRNA and protein expression and activity levels were determined by semiquantitative reverse-transcriptase polymerase chain reaction, Western blotting, and ELISA, respectively. Similar Western blot and reverse-transcriptase polymerase chain reaction data were obtained from three independent experiments. Values are mean standard deviation of three experiments. The graph shows the quantification of gene expression by densitometry, presented as fold increases compared with expression in nonstimulated control cells. *Statistically significant difference compared with control, p < 0.05.
Discussion The production of proinflammatory cytokines, such as IL-1, by monocytes and macrophages involves a variety of regulated cellular processes (4). IL-1 can be induced by lipopolysaccharide and bacterial products in human pulp cells (21). An immunohistochemistry study showed that IL-1a–positive cells were present in rat pulp after surgical pulp exposure (3). In experimentally induced rat pulpitis, large amounts of IL-1a and TNF-a were identified in dental pulp fibroblasts (22). These reports indicate that proinflammatory cytokines, such as IL-1a and TNF-a, play a key role in pulpal inflammation and injury. According to Dommisch et al (11), odontoblasts from dental pulp in caries-free and uninfected wisdom teeth express hBD-1 and hBD-2. Thus, hBD may play an important role in the innate host defense of HDP. 66
Kim et al.
However, the production and molecular signal transduction pathways of hBD-2 in human pulp cells are not completely understood. In this study, we investigated the signaling mechanisms of HBD-2 up-regulation after IL-1a or TNF-a stimulation in HDP cells. Consistent with our data on HDP cells, proinflammatory cytokines, such as IL-1b and TNF-a, are potent stimulators of HBD-2 expression in corneal epithelial cells (15), A549 cells (16), and astrocytes (23). In the present study, IL-1a and TNF-a synergistically up-regulated hBD2 mRNA and protein expression and activity in HDP cells. The MAPK family has been shown to regulate hBD-2 mRNA expression through various inflammatory stimuli (14–16). In the present study, we observed that pretreatment with PD98059, SP600125, and SB203580 attenuates IL-1a-and TNF-a–induced hBD-2 mRNA and protein expression and activity, suggesting that p38, ERK MAPK,
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology
hBD-2 GAPDH
15
*
* *
10
# #
5
#
#
SP
PD
0 22 6 rin 18 697 ttle SO 3 o M o R GÖ R D
Fold increase
TNF- + IL-1
SB PD TC
SP
A
PD
#
#
0
TNF- + IL-1 S PD B TC R
hBD-2 -actin
20
*
*
15
*
10
# # #
0
SP
TNF- + IL-1
# #
5
PD
R 50 40
*
30 20
*
# #
#
SP
hBD-2 (pg/ml)
C
0 6 in O 22 97 ler S 18 Ö6 tt DM o 3 G Ro
S PD B TC
PD
Fold increase
TNF- + IL-1
SB PD TC
SP
B
20 in 82 976 tler SO 1 6 t o3 Ö Ro DM R G
0 6 in O 22 97 ler S 18 Ö6 tt DM o3 G Ro
PD
#
*
# #
10 0
TNF- + IL-1 S PD B TC
0 6 in O 22 97 ler S 18 Ö6 ott DM 3 o G R R
Figure 2. The effects of MAP kinase, NF-kB, and PKC inhibitors on proinflammatory cytokine-induced (A) hBD-2 mRNA, (B) protein, and (C) activity. Cells were pretreated with various key signal pathway inhibitors (10 mmol/L of the JNK inhibitor SP600125, 20 mmol/L of the ERK 1/2 inhibitor PD98059, 20 mmol/L of the p38 MAPK inhibitor SB203580, 1 mmol/L of the NF-kB inhibitor PDTC, 20 mmol/L of the PKC inhibitor RO318220, 20 mmol/LM of the PKC a inhibitor GO¨6976, and 20 mmol/L of the PKC d inhibitor Rottlerin for 1 hour and then stimulated with cytokines for 72 hours). The data are representative of three independent experiments. The graph shows the quantification of gene expression by densitometry and is presented as fold increases compared with nonstimulated control cells. *Statistically significant difference compared with the control, p < 0.05. #Statistically significant difference compared with the combination of TNF-a and IL1a, p < 0.05.
and JNK mediate cytokine-induced hBD-2 expression in HDP cells. In contrast, p38 MAPK and JNK mediate IL-1b–induced HBD-2 expression in A549 cells (14) and corneal epithelial cells (15). Therefore, different cells may respond differently to cytokine, which may exert an inducible or suppressive effect on hBD-2 expression. The NF-kB signaling pathway has been implicated in the expression of hBD-2 by various stimuli, including IL-1b (14, 15). In this study, we showed that pretreatment with the NF-kB inhibitor PDTC effectively suppresses IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and HBD-2 activity. Therefore, NF-kB mediates cytokineinduced hBD-2 expression. PKCs form a family of serine/threonine kinases that mediates various cellular functions. Donnarumma et al (24) have shown that Malassezia furfur induces the expression of hBD-2 in keratinocytes in a PKC-dependent manner. Furthermore, IL-1b–induced hBD-2 mRNA expression in A549 cells is dependent on PKC because pretreatment with the PKC inhibitors STS, GO¨6976, or GF109203X attenuates the IL-1b–induced up-regulation of hBD-2 mRNA expression and luciferase activity (14). In agreement with this result, we have found that the PKC inhibitors Ro318220 and GO¨6976 significantly blocked
JOE — Volume 36, Number 1, January 2010
IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and hBD-2 activity, but Rottlerin did not. AMPK is a sensor that maintains intracellular energy homeostasis and mediates a number of physiologic signals (17). For example, adiponectin stimulates nitric oxide production through AMPK-induced endothelial nitric oxide synthase phosphorylation in endothelial cells (25). H2O2 induces the expression of AMPKa, a prominent catalytic subunit isoform, activating it through phosphorylation in rat dental pulp cells (26). The results of the present study showed that AMPKa is activated by exposure to proinflammatory cytokines as evidenced by increased phospho-AMPKa levels. Moreover, activation of the AMPK pathway by AICAR decreased IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and HBD-2 activity in HDP cells. Defense reactions of the dentin/pulp complex involve a variety of biological systems in which the immune system plays a pivotal role. HO-1 and cytokines such as IL-6, IL-8, and IL-17 are critical molecules expressed in response to invading pathogens and are necessary for normal host defenses (27, 28). In the present study, we demonstrated that IL-6, IL-8, IL-17, and HO-1 mRNA are up-regulated by IL-1a and TNF-a. Moreover, hBD-2 siRNA transfection blocked the
Effect of Proinflammatory Cytokines on hBD-2 in HDPC
67
Basic Research—Biology A
B
C
D
Figure 3. The effects of proinflammatory cytokines on the phosphorylation of (A) AMPKa protein, effects of the AMPK activator AICAR on proinflammatory cytokine-induced hBD-2 mRNA, (B) protein, (C) hBD-2 activity, and (D) effects of hBD-2 siRNA on cytokine-induced immune defense genes expression . A, Cells incubated with TNF-a and IL-1a for the indicated times. B and C, cells pretreated with AICAR for 1 hour and then incubated with cytokine for 72 hours. Cellular supernatants were used for hBD-2 quantification with an ELISA kit. D, cells were transiently transfected with hBD-2 siRNA, followed by treatment with TNF-a and IL1a for 24 hours. IL-6, IL-8, IL-17, and HO-1 expression were determined by reverse-transcriptase polymerase chain reaction, respectively. The data are representative of three independent experiments. The graph shows the quantification of gene expression by densitometry and is presented as fold increases compared with unstimulated control cells. *Statistically significant difference compared with control, p < 0.05. #Statistically significant difference compared to the combination of TNF-a and IL-1 a, p < 0.05.
cytokine-induced increase in IL-6, IL-8, IL-17, and HO-1 expression and was associated with decreasing hBD-2 mRNA. These data suggest that hBD-2 inhibition exerts antidefense effects in in vitro HDP cells model. To our knowledge, this study is the first to show that IL-1a and TNF-a induce hBD-2 mRNA and protein expression and hBD-2 activity 68
Kim et al.
in HDP cells via the activation of PKC, ERK MAPK, p38, JNK, NF-kB, and AMPK. Figure 4 is a schematic representation of the signaling pathway involved in hBD-2 activation in response to IL-1a and TNF-a in HDP cells. These findings suggest that hBD-2 expressed in HDP cells plays an important role in the host immune defense against caries and pulpal inflammation.
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology
Figure 4. A schematic diagram showing the AMPK and other signaling pathways triggered by exposure to TNF-a and IL-1a in HDP cells.
References 1. Hahn L, Liewehr FR. Update on the adaptive immune responses of the dental pulp. J Endod 2007;33:773–81. 2. Hahn CL, Liewehr FR. Relationships between caries bacteria, host responses, and clinical signs and symptoms of pulpitis. J Endod 2007;33:213–9. 3. D’Souza R, Brown LR, Newland JR, et al. Detection and charaterization of IL-1 in human dental pulps. Arch Oral Biol 1989;34:307–13. 4. Martinez ZR, Naruishi K, Yamashiro K, et al. Gene profiles during root canal treatment in experimental rat periapical lesions. J Endod 2007;33:936–43. 5. Ganz T. Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 2003;3:710–20. 6. Dale BA, Fredericks LP. Antimicrobial peptides in the oral environment: expression and function in health and disease. Curr Issues Mol Biol 2005;7:119–33. 7. Harder J, Meyer-Hoffert U, Teran LM, et al. Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol 2000;22:714–21.
JOE — Volume 36, Number 1, January 2010
8. O’Neil DA, Porter EM, Elewaut D, et al. Expression and regulation of the human beta-defensins hBD-1 and hBD-2 in intestinal epithelium. J Immunol 1999;163: 6718–67. 9. Krisanaprakornkit S, Kimball JR, Weinberg A, et al. Inducible expression of human beta-defensin 2 by Fusobacterium nucleatum in oral epithelial cells. Multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier. Infect Immun 2000;68:2907–15. 10. Dale BA, Kimball JR, Krisanaprakornkit S, et al. Localized antimicrobial peptide expression in human gingiva. J Periodontal Res 2001;36:285–94. 11. Dommisch H, Winter J, Acil Y, et al. Human beta-defensin (hBD-1, -2) expression in dental pulp. Oral Microbiol Immunol 2005;20:163–6. 12. Paris S, Wolgin M, Kielbassa AM, et al. Gene expression of human beta-defensins in healthy and inflamed human dental pulps. J Endod 2009;35:520–3. 13. Dommisch H, Winter J, Willebrand C, et al. Immune regulatory functions of human beta-defensin-2 in odontoblast-like cells. Int Endod J 2007;40:300–7. 14. Jang BC, Lim KJ, Paik JH, et al. Up-regulation of human beta-defensin 2 by interleukin-1beta in A549 cells: involvement of PI3K, PKC, p38 MAPK, JNK, and NF-kappaB. Biochem Biophys Res Commun 2004;320:1026–33. 15. McDermott AM, Redfern RL, Zhang B, et al. Defensin expression by the cornea: multiple signalling pathways mediate IL-1beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest Ophthalmol Vis Sci 2003;44:1859–65. 16. Jang BC, Lim KJ, Suh MH, et al. Dexamethasone suppresses interleukin-1betainduced human beta-defensin 2 mRNA expression: involvement of p38 MAPK, JNK, MKP-1, and NF-kappaB transcriptional factor in A549 cells. FEMS Immunol Med Microbiol 2007;51:171–84. 17. Carling D. The AMP-activated protein kinase cascade-a unifying system for energy control. Trends Biochem Sci 2004;29:18–24. 18. Hattori Y, Suzuki K, Hattori S, et al. Metformin inhibits cytokine-induced nuclear factor kappaB activation via AMP-activated protein kinase activation in vascular endothelial cells. Hypertension 2006;47:1183–8. 19. Fukuyama Y, Ohta K, Okoshi R, et al. Hypoxia induces expression and activation of AMPK in rat dental pulp cells. J Dent Res 2007;86:903–7. 20. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:727–31. 21. Coil J, Tam E, Waterfield JD. Proinflammatory cytokine profiles in pulp fibroblasts stimulated with lipopolysaccaride and methyl mercaptan. J Endod 2004;30:88–91. 22. Chang YC, Yang SF, Huang FM, et al. Induction of tissue plasminogen activator gene expression by proinflammatory cytokines in human pulp and gingival fibroblasts. J Endod 2003;29:114–7. 23. Hao HN, Zhao J, Lotoczky G, et al. Induction of human beta-defensin-2 expression in human astrocytes by lipopolysaccharide and cytokines. J Neurochem 2001;77: 1027–35. 24. Donnarumma G, Paoletti I, Buommino E, et al. Malassezia furfur induces the expression of beta-defensin-2 in human keratinocytes in a protein kinase C-dependent manner. Arch Dermatol Res 2004;295:474–81. 25. Chen H, Montagnani M, Funahashi T, et al. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem 2003;278:45021–6. 26. Fukuyama Y, Ohta K, Okoshi R, et al. Hydrogen peroxide induces expression and activation of AMP-activated protein kinase in a dental pulp cell line. Int Endod J 2008;41:197–203. 27. Jontell M, Okiji T, Dahlgren U, et al. Immune defense mechanisms of the dental pulp. Crit Rev Oral Biol Med 1998;9:179–200. 28. Chung SW, Hall SR, Perrella MA. Role of haem oxygenase-1 in microbial host defence. Cell Microbiol 2009;11:199–207.
Effect of Proinflammatory Cytokines on hBD-2 in HDPC
69
Effect of Proinflammatory Cytokines on the Expression and Regulation of Human Beta-Defensin 2 in Human Dental Pulp Cells Young-Suk Kim, PhD,* Kyung-San Min, DDS, PhD,† Sang-Im Lee, MSD,* Su-Jung Shin, DDS, MSD,‡ Kyoung-Seob Shin, DDS,* and Eun-Cheol Kim, DDS, PhD* Abstract Introduction: Although the expression of human betadefensin-2 (hBD-2) in odontoblasts from human dental pulp (HDP) has been reported, the production of hBD2 and its regulation remains poorly understood. The aim of this study was to investigate the effect of cytokines on the induction of hBD-2 and its signaling mechanisms in HDP cells. Methods: After stimulation with tumor necrosis factor a (TNF-a) and interleukin 1a (IL1a), reverse-transcriptase polymerase chain reaction, Western blot, and enzyme-linked immunosorbent assay experiments were performed to evaluate the effects of these cytokines on the production of hBD-2. Results: TNF-a and IL-1a synergistically increased hBD-2 messenger RNA levels, protein expression, and activity. The up-regulation of hBD-2 by cytokines was attenuated by pretreatment with inhibitors of PKC, JNK, p38, ERK MAPK, nuclear factor-kB, and adenosine monophosphate-activated protein kinase (AMPK). Conclusion: These results suggest that TNF-a and IL-1a up-regulate HBD-2 expression in HDP cells through the PKC, JNK MAPK, p38, ERK, NF-kB, and AMPK pathways. Thus, the induction of hBD-2 by proinflammatory cytokines might up-regulate the pulpal host immune defense system. (J Endod 2010;36:64–69)
Key Words Adenosine monophosphate-activated protein kinase, human b-defensin 2, human dental pulp cells, nuclear factor-kB, protein kinase C
From the Department of *Oral and Maxillofacial Pathology and †Conservative Dentistry, College of Dentistry, Wonkwang University, Iksan, South Korea; and ‡Department of Conservative Dentistry, College of Dentistry, Yonsei University, Seoul, South Korea. This study was supported by a grant from the Korea Healthcare Technology R&D Project, Ministry for Health, Welfare & Family Affairs, Republic of Korea (A084458). Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology, Dental College, Wonkwang University, Sinyoungdong 344-2, Iksan City, Jeonbuk, 570-749, South Korea. E-mail address: eckwkop@ wonkwang.ac.kr. 0099-2399/$0 - see front matter Copyright ª 2010 by the American Association of Endodontists. All rights reserved. doi:10.1016/j.joen.2009.09.022
64
Kim et al.
D
ental pulp tissues are capable of innate and adaptive immune responses under various inflammatory conditions (1, 2). In particular, interleukin-1 (IL-1) and tumor necrosis factor a (TNF-a) play important roles in the immune response to infection (3, 4). However, the mechanisms of host defense against bacterial infection in human dental pulp (HDP) cells are not completely understood. One host-defense system that involves the innate immune response upon exposure to the external environment is the production of defensin (5). Human b-defensin (hBD) is a small cationic antimicrobial peptide made by epithelial cells and expressed in all human epithelia tested to date, including oral epithelia (6). hBD-1 is constitutively expressed in epithelial tissues, whereas hBD-2 is expressed when the epithelia are stimulated with bacteria, Candida albicans, IL-1, or TNF-a (7–10). Differential gene expression of hBD-1 and -2 has been shown in healthy and inflamed dental pulp (11, 12). In healthy dental pulp, hBD-1 expression was significantly higher than that of hBD-2. In contrast, the levels of both hBD-1 and hBD-2 messenger RNAs (mRNAs) were significantly lower during the clinical stage of an irreversible pulpitis (11). Recently, hBD-2 stimulation was found to lead to the up-regulation of the IL-6, IL-8, and cytosolic phospholipase-A-2 mRNA levels, suggesting that the synthesis of hBD2 in odontoblast cells enhances the immunoinflammatory reactivity of dental pulp (13). The induction of HBD-2 expression by cytokines and bacterial factors is influenced by the activities of protein kinase C (PKC) and mitogen-activated protein kinases (MAPKs) as well as transcriptional factors, in particular nuclear factor-kB (NF-kB) (14–16). Adenosine monophosphate-activated protein kinase (AMPK), a serine/threonine protein kinase, monitors the cellular energy status and responds to a variety of stressors (17). Recent studies have suggested that AMPK plays an important role in the treatment of type 2 diabetes mellitus, protection from apoptosis, and regulation of angiogenesis; exerts antiatherosclerotic effects; and is involved in anti-inflammatory signaling (17, 18). Furthermore, the levels of the main AMPK subunit isoform increased time dependently under hypoxia in rat dental pulp cells (19). This suggests that AMPK plays an important role in the reactions of pulp cell to stimuli, presumably in maintaining energy homeostasis. However, the involvement of the AMPK pathway in proinflammatory cytokine-induced innate immunity had not been assessed. The aim of this study was to investigate the modulating effect of proinflammatory cytokines on the innate immune responses of HDP cells. We also examined the involvement of the MAPK, NF-kB, PKC, and AMPK signaling pathways in TNF-a- and IL-1-a-induced hBD-2 expression in HDP cells.
Materials and Methods Reagents Dulbecco’s Modified Eagle Medium, fetal bovine serum, and other tissue culture reagents were obtained from Gibco BRL Co (Grand Island, NY). Recombinant human TNF-a and recombinant human IL-1a were purchased from Sigma-Aldrich (St Louis, MO). Anti-hBD-2, antiphospho AMPK, anti-AMPK, and b-actin monoclonal antibodies were purchased from Santa Cruz Biotechnology (Heidelberg, Germany). Pyrrolidine dithiocarbamate (PDTC); Ro318220; and the MAP kinase inhibitors SB203580, PD98059, and SP600125 were purchased from Calbiochem (La Jolla, CA).
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology Cell Culture We used the HDP cell lines immortalized by transfection with the telomerase catalytic subunit hTERT gene (20). Cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidified atmosphere of 5% CO2 at 37 C. RNA Isolation and Reverse-transcriptase Polymerase Chain Reaction Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. Reverse transcription of the RNA was performed by using AccuPower RT PreMix (Bioneer, Daejon, Korea). Amplification was performed in a thermal cycler. The primers used for complementary DNA amplification were as follows: for hBD-2, 50 -CATGAGGGTCTTGTATCTCCTCT-30 (sense) and 50 -CCTCCTCATGGCTTTT TGCAGC-30 (antisense), for IL-6, 50 -ATGAACTCCTTCTCCACAAGC-30 (sense) and 50 -CTACATTTGCCGAAGAGCCC-30 (antisense), for IL-8, 50 -ATGACTTC CAAGCTGGCCGTGG-30 (sense) and 50 -TGAATTCTCAGCCCTCTTCAAAAAC-30 (antisense), for IL-17, 50 -CGATGACTCCTGGGAAGACCTC-30 (sense) and 50 -GTGTGGGCTCCCCAGAGCTCTTA-30 (antisense), for heme oxygenase-1 (HO-1), 50 -AAGATTGCCCAGAAAGCCCTGGAC-30 (sense) and 50 -AACTGTCG CCACCAGAAAGCTGAG-30 (antisense), and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 50 - CGGAGTCAACGGATTTGGTCGTAT -30 (sense) and 50 - AGCTTCTCCATGGTGGTGAAGAC -30 (antisense). The reaction conditions for polymerase chain reaction were 30 cycles, denaturation at 94 C for 30 seconds, annealing at 56 C for 30 seconds, and extension at 72 C for 30 seconds. The polymerase chain reaction products were resolved on a 1.5% agarose gel and stained with ethidium bromide. Western Blot Analysis Cell extracts were prepared by solubilizing cells in sodium dodecyl sulfate-protein lysis buffer (5 mmol/L EDTA, 1 mmol/L MgCl2, 50 mmol/ L Tris-HCl [pH = 7.5], 0.5% Triton X-100, 2 mmol/L phenylmethylsulfonyl fluoride, and 1 mmol/L N-ethylmaleimide) for 30 minutes on ice. The cell lysates were centrifuged at 14,000g for 20 minutes. Equivalent amounts of total protein from each cell extract were separated by electrophoresis in a 12.5% sodium dodecyl sulfate-polyacrylamide gel. After electrophoresis, the proteins were transferred onto a polyvinylidene difluoride membrane, which was then treated with blocking solution for 1 hour and incubated with primary (hBD-2, phospho-AMPK, AMPK, and b-actin) and horseradish peroxidase-conjugated secondary antibodies for 1 hour each at 37 C. The proteins were visualized using an enhanced chemiluminescence system (Amersham, Piscataway, NJ). Measurement by Enzyme-linked Immunosorbent Assay The concentrations of hBD-2 in the culture supernatants were determined by an enzyme-linked immunosorbent assay kit (Assay Designs, Ann Arbor, MI) according to the manufacturer’s recommended procedure. The plates were read at 450 nm on a microplate reader (Molecular Devices, Sunnyvale, CA). hBD-2 Small Interfering RNA Transfection Small interfering RNA (siRNA) was used for transient gene knockdown studies. All transient transfections were performed in triplicate using Opti-MEM (Invitrogen Life Technologies, Carlsbad, CA) following the manufacturer’s instructions. Cells in the exponential growth phase were plated in six-well plates at a density of 5 105 cells/well, grown for 20 hours, and then transfected with 80 pmol of hBD-2 siRNA by using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. Silencer negative control siRNA was used as a negaJOE — Volume 36, Number 1, January 2010
tive control and was introduced into the cells using the same protocol. After transfection, cells were cultured in six-well plates at 37 C until needed. The efficiency of gene knockdown was evaluated by reversetranscriptase polymerase chain reaction.
Statistical Analysis Differences among groups were analyzed by using one-way analysis of variance combined with the Bonferroni test. All values are expressed as means standard deviation; differences were considered significant at p < 0.05. The intensity of each protein or mRNA expression after normalization with b-actin or GAPDH was quantified on the photographed gels with a densitometer (Quantity One; Bio-Rad, Hercules, CA).
Results Effects of TNF-a and IL-1a on hBD-2 Production Because hBD-2 was reported to be induced by various stimuli, we initially determined whether HDP cells express hBD-2 mRNA in response to cytokines. The cytokine combination of TNF-a (10 ng/ mL) plus IL-1a (10 ng/mL) resulted in synergistic hBD-2 mRNA expression after 72 hours of incubation. The increases in hBD-2 protein expression and activity appeared to correspond to increased hBD-2 mRNA levels in HDP cells (Fig. 1A-C). Effects of Various Signaling Pathway Inhibitors on Cytokine-induced hBD-2 Expression To investigate the signal transduction pathways involved in regulating hBD-2 expression in response to cytokines, we examined the effects of various pharmacologic inhibitors of signaling intermediates on the hBD-2 mRNA, protein, and activity levels. As shown in Figure 2, we found that pretreatment of cells with SP600125 (JNK inhibitor), PD98059 (ERK inhibitor), SB203580 (p38 inhibitor), PDTC (NF-kB inhibitor), Ro-318220 (PKC inhibitor), and GO¨6976 (PKC alpha inhibitor) blocked proinflammatory cytokine-induced hBD-2 mRNA, protein, and activity, but Rottlerin (PKC delta inhibitor) did not. Role of AMPK Pathway on Proinflmmatory Cytokineinduced hBD-2 Expression We investigated whether AMPK induced hBD-2 production in response to proinflammatory cytokines through the activation of AMPK by phosphorylation. As shown in Figure 3A and B, cytokine increased the phosphorylation levels of AMPKa but not the level of total AMPKa. We next examined whether the AMPK pathway played an important role in hHD-2 expression by using an activator (5-aminoimidazole carboxamide riboside [AICAR]) of AMPK activity. As shown in Figure 3B and C, pretreatment with AICAR for 1 hour attenuated proinflammatory cytokine-induced hBD-2 mRNA, protein, and activity in a dose-dependent manner. Effects of hBD-2 siRNA on Proinflmmatory Cytokineinduced Host Immune Defense Genes Expression hBD-2 siRNA was transfected into HDP cells, and the mRNA expression of IL-6, IL-8, IL-17, and HO-1 was measured to determine whether hBD-2 is directly responsible for the induction of immune defense gene. hBD-2 siRNA blocked the induction effects of cytokines on IL-6, IL-8, IL-17, and HO-1 mRNA expression, which suggests that hBD-2 plays an important role in immune defense actions in HDP cells (Fig. 3D). Effect of Proinflammatory Cytokines on hBD-2 in HDPC
65
Basic Research—Biology #
A
#
48 h
24 h TNF-α IL-1α
-
+ - +
+ +
+ - +
72 h + +
+ - +
+ +
hBD-2
Fold increase
20
* 15 10 5
GAPDH
0
TNF-α α IL-1α
-
+ - +
+ +
+ - +
+ +
48 h
24 h
+ - +
+ +
72 h
B #
-
TNFIL-1
+ - +
+ +
+ - +
72 h + +
+ - +
+ +
hBD-2 -actin
Fold increase
15
48 h
24 h
#
*
10
*
5
0
TNFIL-1
-
+ - +
24 h
C
+ +
+ - +
+ +
48 h
+ - +
+ +
72 h
#
hBD-2 (pg/ml)
50
#
*
*
30
*
#
#
40
#
#
*
*
20 10 0
TNFIL-1
-
+ - +
24 h
+ +
+ - +
48 h
+ +
+ - +
+ +
72 h
Figure 1. The effects of proinflammatory cytokines on (A) hBD-2 mRNA, (B) protein, and (C) activity in HDP cells. HDP cells were incubated with 10 ng/ml of IL1a or 10 ng/mL of TNF-a for the indicated times. mRNA and protein expression and activity levels were determined by semiquantitative reverse-transcriptase polymerase chain reaction, Western blotting, and ELISA, respectively. Similar Western blot and reverse-transcriptase polymerase chain reaction data were obtained from three independent experiments. Values are mean standard deviation of three experiments. The graph shows the quantification of gene expression by densitometry, presented as fold increases compared with expression in nonstimulated control cells. *Statistically significant difference compared with control, p < 0.05.
Discussion The production of proinflammatory cytokines, such as IL-1, by monocytes and macrophages involves a variety of regulated cellular processes (4). IL-1 can be induced by lipopolysaccharide and bacterial products in human pulp cells (21). An immunohistochemistry study showed that IL-1a–positive cells were present in rat pulp after surgical pulp exposure (3). In experimentally induced rat pulpitis, large amounts of IL-1a and TNF-a were identified in dental pulp fibroblasts (22). These reports indicate that proinflammatory cytokines, such as IL-1a and TNF-a, play a key role in pulpal inflammation and injury. According to Dommisch et al (11), odontoblasts from dental pulp in caries-free and uninfected wisdom teeth express hBD-1 and hBD-2. Thus, hBD may play an important role in the innate host defense of HDP. 66
Kim et al.
However, the production and molecular signal transduction pathways of hBD-2 in human pulp cells are not completely understood. In this study, we investigated the signaling mechanisms of HBD-2 up-regulation after IL-1a or TNF-a stimulation in HDP cells. Consistent with our data on HDP cells, proinflammatory cytokines, such as IL-1b and TNF-a, are potent stimulators of HBD-2 expression in corneal epithelial cells (15), A549 cells (16), and astrocytes (23). In the present study, IL-1a and TNF-a synergistically up-regulated hBD2 mRNA and protein expression and activity in HDP cells. The MAPK family has been shown to regulate hBD-2 mRNA expression through various inflammatory stimuli (14–16). In the present study, we observed that pretreatment with PD98059, SP600125, and SB203580 attenuates IL-1a-and TNF-a–induced hBD-2 mRNA and protein expression and activity, suggesting that p38, ERK MAPK,
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology
hBD-2 GAPDH
15
*
* *
10
# #
5
#
#
SP
PD
0 22 6 rin 18 697 ttle SO 3 o M o R GÖ R D
Fold increase
TNF- + IL-1
SB PD TC
SP
A
PD
#
#
0
TNF- + IL-1 S PD B TC R
hBD-2 -actin
20
*
*
15
*
10
# # #
0
SP
TNF- + IL-1
# #
5
PD
R 50 40
*
30 20
*
# #
#
SP
hBD-2 (pg/ml)
C
0 6 in O 22 97 ler S 18 Ö6 tt DM o 3 G Ro
S PD B TC
PD
Fold increase
TNF- + IL-1
SB PD TC
SP
B
20 in 82 976 tler SO 1 6 t o3 Ö Ro DM R G
0 6 in O 22 97 ler S 18 Ö6 tt DM o3 G Ro
PD
#
*
# #
10 0
TNF- + IL-1 S PD B TC
0 6 in O 22 97 ler S 18 Ö6 ott DM 3 o G R R
Figure 2. The effects of MAP kinase, NF-kB, and PKC inhibitors on proinflammatory cytokine-induced (A) hBD-2 mRNA, (B) protein, and (C) activity. Cells were pretreated with various key signal pathway inhibitors (10 mmol/L of the JNK inhibitor SP600125, 20 mmol/L of the ERK 1/2 inhibitor PD98059, 20 mmol/L of the p38 MAPK inhibitor SB203580, 1 mmol/L of the NF-kB inhibitor PDTC, 20 mmol/L of the PKC inhibitor RO318220, 20 mmol/LM of the PKC a inhibitor GO¨6976, and 20 mmol/L of the PKC d inhibitor Rottlerin for 1 hour and then stimulated with cytokines for 72 hours). The data are representative of three independent experiments. The graph shows the quantification of gene expression by densitometry and is presented as fold increases compared with nonstimulated control cells. *Statistically significant difference compared with the control, p < 0.05. #Statistically significant difference compared with the combination of TNF-a and IL1a, p < 0.05.
and JNK mediate cytokine-induced hBD-2 expression in HDP cells. In contrast, p38 MAPK and JNK mediate IL-1b–induced HBD-2 expression in A549 cells (14) and corneal epithelial cells (15). Therefore, different cells may respond differently to cytokine, which may exert an inducible or suppressive effect on hBD-2 expression. The NF-kB signaling pathway has been implicated in the expression of hBD-2 by various stimuli, including IL-1b (14, 15). In this study, we showed that pretreatment with the NF-kB inhibitor PDTC effectively suppresses IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and HBD-2 activity. Therefore, NF-kB mediates cytokineinduced hBD-2 expression. PKCs form a family of serine/threonine kinases that mediates various cellular functions. Donnarumma et al (24) have shown that Malassezia furfur induces the expression of hBD-2 in keratinocytes in a PKC-dependent manner. Furthermore, IL-1b–induced hBD-2 mRNA expression in A549 cells is dependent on PKC because pretreatment with the PKC inhibitors STS, GO¨6976, or GF109203X attenuates the IL-1b–induced up-regulation of hBD-2 mRNA expression and luciferase activity (14). In agreement with this result, we have found that the PKC inhibitors Ro318220 and GO¨6976 significantly blocked
JOE — Volume 36, Number 1, January 2010
IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and hBD-2 activity, but Rottlerin did not. AMPK is a sensor that maintains intracellular energy homeostasis and mediates a number of physiologic signals (17). For example, adiponectin stimulates nitric oxide production through AMPK-induced endothelial nitric oxide synthase phosphorylation in endothelial cells (25). H2O2 induces the expression of AMPKa, a prominent catalytic subunit isoform, activating it through phosphorylation in rat dental pulp cells (26). The results of the present study showed that AMPKa is activated by exposure to proinflammatory cytokines as evidenced by increased phospho-AMPKa levels. Moreover, activation of the AMPK pathway by AICAR decreased IL-1a– and TNF-a–induced hBD-2 mRNA and protein expression and HBD-2 activity in HDP cells. Defense reactions of the dentin/pulp complex involve a variety of biological systems in which the immune system plays a pivotal role. HO-1 and cytokines such as IL-6, IL-8, and IL-17 are critical molecules expressed in response to invading pathogens and are necessary for normal host defenses (27, 28). In the present study, we demonstrated that IL-6, IL-8, IL-17, and HO-1 mRNA are up-regulated by IL-1a and TNF-a. Moreover, hBD-2 siRNA transfection blocked the
Effect of Proinflammatory Cytokines on hBD-2 in HDPC
67
Basic Research—Biology A
B
C
D
Figure 3. The effects of proinflammatory cytokines on the phosphorylation of (A) AMPKa protein, effects of the AMPK activator AICAR on proinflammatory cytokine-induced hBD-2 mRNA, (B) protein, (C) hBD-2 activity, and (D) effects of hBD-2 siRNA on cytokine-induced immune defense genes expression . A, Cells incubated with TNF-a and IL-1a for the indicated times. B and C, cells pretreated with AICAR for 1 hour and then incubated with cytokine for 72 hours. Cellular supernatants were used for hBD-2 quantification with an ELISA kit. D, cells were transiently transfected with hBD-2 siRNA, followed by treatment with TNF-a and IL1a for 24 hours. IL-6, IL-8, IL-17, and HO-1 expression were determined by reverse-transcriptase polymerase chain reaction, respectively. The data are representative of three independent experiments. The graph shows the quantification of gene expression by densitometry and is presented as fold increases compared with unstimulated control cells. *Statistically significant difference compared with control, p < 0.05. #Statistically significant difference compared to the combination of TNF-a and IL-1 a, p < 0.05.
cytokine-induced increase in IL-6, IL-8, IL-17, and HO-1 expression and was associated with decreasing hBD-2 mRNA. These data suggest that hBD-2 inhibition exerts antidefense effects in in vitro HDP cells model. To our knowledge, this study is the first to show that IL-1a and TNF-a induce hBD-2 mRNA and protein expression and hBD-2 activity 68
Kim et al.
in HDP cells via the activation of PKC, ERK MAPK, p38, JNK, NF-kB, and AMPK. Figure 4 is a schematic representation of the signaling pathway involved in hBD-2 activation in response to IL-1a and TNF-a in HDP cells. These findings suggest that hBD-2 expressed in HDP cells plays an important role in the host immune defense against caries and pulpal inflammation.
JOE — Volume 36, Number 1, January 2010
Basic Research—Biology
Figure 4. A schematic diagram showing the AMPK and other signaling pathways triggered by exposure to TNF-a and IL-1a in HDP cells.
References 1. Hahn L, Liewehr FR. Update on the adaptive immune responses of the dental pulp. J Endod 2007;33:773–81. 2. Hahn CL, Liewehr FR. Relationships between caries bacteria, host responses, and clinical signs and symptoms of pulpitis. J Endod 2007;33:213–9. 3. D’Souza R, Brown LR, Newland JR, et al. Detection and charaterization of IL-1 in human dental pulps. Arch Oral Biol 1989;34:307–13. 4. Martinez ZR, Naruishi K, Yamashiro K, et al. Gene profiles during root canal treatment in experimental rat periapical lesions. J Endod 2007;33:936–43. 5. Ganz T. Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 2003;3:710–20. 6. Dale BA, Fredericks LP. Antimicrobial peptides in the oral environment: expression and function in health and disease. Curr Issues Mol Biol 2005;7:119–33. 7. Harder J, Meyer-Hoffert U, Teran LM, et al. Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol 2000;22:714–21.
JOE — Volume 36, Number 1, January 2010
8. O’Neil DA, Porter EM, Elewaut D, et al. Expression and regulation of the human beta-defensins hBD-1 and hBD-2 in intestinal epithelium. J Immunol 1999;163: 6718–67. 9. Krisanaprakornkit S, Kimball JR, Weinberg A, et al. Inducible expression of human beta-defensin 2 by Fusobacterium nucleatum in oral epithelial cells. Multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier. Infect Immun 2000;68:2907–15. 10. Dale BA, Kimball JR, Krisanaprakornkit S, et al. Localized antimicrobial peptide expression in human gingiva. J Periodontal Res 2001;36:285–94. 11. Dommisch H, Winter J, Acil Y, et al. Human beta-defensin (hBD-1, -2) expression in dental pulp. Oral Microbiol Immunol 2005;20:163–6. 12. Paris S, Wolgin M, Kielbassa AM, et al. Gene expression of human beta-defensins in healthy and inflamed human dental pulps. J Endod 2009;35:520–3. 13. Dommisch H, Winter J, Willebrand C, et al. Immune regulatory functions of human beta-defensin-2 in odontoblast-like cells. Int Endod J 2007;40:300–7. 14. Jang BC, Lim KJ, Paik JH, et al. Up-regulation of human beta-defensin 2 by interleukin-1beta in A549 cells: involvement of PI3K, PKC, p38 MAPK, JNK, and NF-kappaB. Biochem Biophys Res Commun 2004;320:1026–33. 15. McDermott AM, Redfern RL, Zhang B, et al. Defensin expression by the cornea: multiple signalling pathways mediate IL-1beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest Ophthalmol Vis Sci 2003;44:1859–65. 16. Jang BC, Lim KJ, Suh MH, et al. Dexamethasone suppresses interleukin-1betainduced human beta-defensin 2 mRNA expression: involvement of p38 MAPK, JNK, MKP-1, and NF-kappaB transcriptional factor in A549 cells. FEMS Immunol Med Microbiol 2007;51:171–84. 17. Carling D. The AMP-activated protein kinase cascade-a unifying system for energy control. Trends Biochem Sci 2004;29:18–24. 18. Hattori Y, Suzuki K, Hattori S, et al. Metformin inhibits cytokine-induced nuclear factor kappaB activation via AMP-activated protein kinase activation in vascular endothelial cells. Hypertension 2006;47:1183–8. 19. Fukuyama Y, Ohta K, Okoshi R, et al. Hypoxia induces expression and activation of AMPK in rat dental pulp cells. J Dent Res 2007;86:903–7. 20. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:727–31. 21. Coil J, Tam E, Waterfield JD. Proinflammatory cytokine profiles in pulp fibroblasts stimulated with lipopolysaccaride and methyl mercaptan. J Endod 2004;30:88–91. 22. Chang YC, Yang SF, Huang FM, et al. Induction of tissue plasminogen activator gene expression by proinflammatory cytokines in human pulp and gingival fibroblasts. J Endod 2003;29:114–7. 23. Hao HN, Zhao J, Lotoczky G, et al. Induction of human beta-defensin-2 expression in human astrocytes by lipopolysaccharide and cytokines. J Neurochem 2001;77: 1027–35. 24. Donnarumma G, Paoletti I, Buommino E, et al. Malassezia furfur induces the expression of beta-defensin-2 in human keratinocytes in a protein kinase C-dependent manner. Arch Dermatol Res 2004;295:474–81. 25. Chen H, Montagnani M, Funahashi T, et al. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem 2003;278:45021–6. 26. Fukuyama Y, Ohta K, Okoshi R, et al. Hydrogen peroxide induces expression and activation of AMP-activated protein kinase in a dental pulp cell line. Int Endod J 2008;41:197–203. 27. Jontell M, Okiji T, Dahlgren U, et al. Immune defense mechanisms of the dental pulp. Crit Rev Oral Biol Med 1998;9:179–200. 28. Chung SW, Hall SR, Perrella MA. Role of haem oxygenase-1 in microbial host defence. Cell Microbiol 2009;11:199–207.
Effect of Proinflammatory Cytokines on hBD-2 in HDPC
69