- Email: [email protected]
p70S6k signaling pathway in cardiac muscle
+Model
ARTICLE IN PRESS
SCISPO-3352; No. of Pages 8 Science & Sports (2019) xxx, xxx—xxx
Disponible en ligne sur
ScienceDirect www.sciencedirect.com
ORIGINAL ARTICLE
Effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in cardiac muscle Effet de l’entraînement en résistance et de Spirulina platensis sur la voie de signalisation PI3K/Akt/mTOR/p70S6k dans le muscle cardiaque F. Ahmadi a, M. Ghanbar Zadeh a,∗, A.H. Habibi a, F. Karimi b a
Department of Exercise Physiology, Faculty of Sport Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran b Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Received 22 February 2019; accepted 6 June 2019
KEYWORDS Resistance training; Spirulina platensis; Hypertrophy signaling pathway; Cardiac muscle
∗
Summary Background. — Resistance training and spirulina change the expression of genes involved in the hypertrophy. We investigated the effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in rat cardiac muscle. Methods. — For this purpose, 32 male Sprague—Dawley rats were divided into four groups: control (Co; n = 8), spirulina platensis (SP; n = 8), resistance training (RE; n = 8), spirulina platensis + resistance training (SP +RE; n = 8). The resistance training group practiced five sessions each week for eight weeks. Spirulina 200 mg/kg/day was used in the supplement group and exercise + spirulina platensis group. Twenty-four hours after the last training session, the expression of genes was measured by Real-time PCR. Results. — Results showed the expression of mTOR increased significantly in the RE group (P = 0.001) and the SP +RE (P = 0.02). The expression of Akt in the RE group increased significantly (P = 0.01). The expression of Pi3k in the RE group (P = 0.001) and the SP+ RE group (P = 0.001) increased significantly. The expression of P70-S6K in the RE group increased significantly (P = 0.05).
Corresponding author. E-mail address: [email protected] (M. Ghanbar Zadeh).
https://doi.org/10.1016/j.scispo.2019.06.003 0765-1597/© 2019 Published by Elsevier Masson SAS.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
2
F. Ahmadi et al. Conclusion. — Using spirulina platensis alone does not have an effect on the signaling pathway in the heart. However, the combination of resistance training can affect some of the components of the signaling pathway (PI3K/mTOR). And also, the effect of resistance training alone can have a significant effect on all components of the signaling pathway. © 2019 Published by Elsevier Masson SAS.
MOTS CLÉS Entraînement en résistance ; La spiruline platensis ; Voie de signalisation de l’hypertrophie ; Muscle cardiaque
Résumé Contexte. — L’entraînement en résistance et la spiruline modifient l’expression des gènes impliqués dans l’hypertrophie. Nous avons étudié l’effet de l’entraînement en résistance avec Spirulina platensis sur la voie de signalisation PI3K/Akt/mTOR/p70S6k dans le muscle cardiaque. Méthodes. — À cette fin, 32 rats Sprague—Dawley mâles ont été divisés en quatre groupes : contrôle (Co ; n = 8), spiruline platensis (SP ; n = 8), entraînement à la résistance (RE ; n = 8), spiruline platensis + résistance, formation (SP + RE ; n = 8). Le groupe d’entraînement en résistance a pratiqué cinq séances par semaine pendant huit semaines. De la spiruline à 200 mg/kg/jour a été utilisée dans le groupe des suppléments et dans le groupe de l’exercice + spiruline à platensis. Vingt-quatre heures après la dernière séance d’entraînement, l’expression des gènes a été mesurée par PCR en temps réel. Résultats. — Les résultats ont montré que l’expression de mTOR augmentait significativement dans le groupe RE (p = 0,001) et le SP + RE (p = 0,02). L’expression de Akt dans le groupe RE a augmenté de manière significative (p = 0,01). L’expression de Pi3k dans le groupe RE (p = 0,001) et le groupe SP + RE (p = 0,001) a augmenté de manière significative. L’expression de P70-S6K dans le groupe RE a augmenté de manière significative (p = 0,05). Conclusion. — L’utilisation de Spirulina platensis seule n’a pas d’effet sur la voie de signalisation dans le cœur. Cependant, la combinaison avec un entraînement en résistance peut affecter certains des composants de la voie de signalisation (PI3K/mTOR). De plus, l’effet de l’entraînement en résistance seul peut avoir un effet significatif sur toutes les composantes de la voie de signalisation. © 2019 Publi´ e par Elsevier Masson SAS.
1. Introduction The efforts of health centers around the world to prevent heart disease with an emphasis on physical activity has led to an increase in the number of participants in recreational and competitive sports programs. Because regular exercise is consistent with structural, functional and electrical changes in the heart [1]. In response to increased workload, the heart should work harder than normal conditions and rest, leading to an increase in heart rate. Since the person’s ability to perform exercise activities depends on the performance and function of various body systems, including the cardiovascular system. With regular and prolonged exercise training, the heart has undergone a change that is a reflection of cardiovascular fitness in response to exercise or physiological changes [2]. Also, cardiac hypertrophy is a development of the left ventricular mass of the heart that affects the Stroke volume and cardiac output [3]. The heart muscle grows in response to mechanical stress and various stimuli, and hypertrophy of myocytes is the primary cause of its molecular cause [4]. Pressure overload in strength exercises increases the ventricular wall thickness with no change in the inner radius that causes the concentric hypertrophy [5]. Researchers have arranged a set of information that the left ventricular compatibility is specific to the type of exercise [6]. On the other hand, Nowadays, the use of food
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
supplements in exercise is very wide [7]. Spirulina platensis is a green-blue alga [8], which has been considered for protein and vitamin sources [9]. Studies have shown that Spirulina platensis can increase muscle isometric strength and endurance [10] as well as the amount of protein synthesis in the muscle [11]. Duan et al. argued that spirulina is useful for heart muscle. Empirical research has shown that Spirulina is a healthy diet, with nutritional and medicinal value [12]. Several factors such as mechanical forces and growth hormones (e.g. insulin growth factor 1, insulin and thyroid hormone) by activating several signals such as PI3K, Akt, and mTOR pathways cause physiological cardiac hypertrophy [13]. Because exercise with increased growth hormone secretion and increase systemic and topical IGF-1 in the heart, can affect this important pathway [14]. Resistance exercise activates intramuscular messaging cascades (i.e. the mTOR pathway). In addition to exercise, these pathways are also affected by nutrients, as well as drugs and nutrients, medicines and energizing drugs [15]. The mTOR molecule (the target molecule of rapamycin in mammals) is a serine/threonine kinase protein initially identified as the cellular goal of the Rapamycin drug was recognize. This kinase regulates the growth, proliferation, mobility, and survival of the cells, as well as the transcription of the gene and protein synthesis that are stimulated in response to hormones, growth factors, and nutrients [14].
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
Effect of resistance training with Spirulina platensis on cardiac muscle The size of the mouse’s heart is particularly affected by the PI3K [16]. This makes PI3K a candidate for intervention in cardiac hypertrophy [17]. Activating PI3K and serine-threonine kinase downstream (Akt) plays an important role in protecting the heart through tyrosine kinase receptor signaling [18]. Akt promotes the development of cardiac hypertrophy by modulating various signaling pathway [19]. Resistive exercises can increase the phosphorylation factor of the pathway of Akt/mTOR/p70S6K [20]. Burd et al. reported that phosphorylation of Akt, mTOR, and p70S6K significantly increased after low and high load resistance training [21]. These findings indicate the stimulatory effect of resistance activity on the molecular pathways of anabolic and protein synthesis. The activation of the signal pathway used to diagnose physiological hypertrophy. This pathway that involves signaling pathway PI3K/Akt/mTOR/P70s6k is of particular importance [22]. In the present study, we examine the effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in rat cardiac muscle.
2. Materials and methods 2.1. Experimental animals and ethical aspects In this study, 32 male Sprague—Dawley rats 290 ± 20 g in weight, and 9 weeks of age were obtained from the animal center house of Shiraz University of Medical Sciences and then transferred to the laboratory polycarbonate cages in the University of Marvdasht. Each rat is kept in a separate cage of transparent polycarbonate and maintained in an environment with a temperature of 22 ± 2 ◦ C, a humidity of 55 ± 4% under 12/12 h light/dark cycle. During the research process, the animals were fed with provided pellet food for animal breeding, reproduction, and stem cells. All animals were provided with free access to standard rat food (specially designed for rats supplied by the company of Pars feed) and healthy water and were provided with human care in accordance with the relevant instructions. All procedures involving animal experiments were approved and carried out in strict accordance with the United States Institute of Animal Research guidelines for the care and use of laboratory animals by animal care.
2.2. Experimental animal groups For accurate comparison of study data, animal models will be randomly divided into four groups (each group, 8 heads): • control (Cn: without resistance training, without supplementation with spirulina); • supplementation with spirulina (SP: without resistance training); • resistance training (RT: without spirulina supplementation); • resistance training + supplementation with spirulina (RT + SP). Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
3
2.3. Resistance training protocol After a week of acclimatization, the animals were first trained to climb the vertical ladder as the exercise for this study. The climbing familiarization sessions were conducted three to four replicates every day for a week without weights attached. The resistance training protocol included an eight-week climb of a ladder with a height of one meter, with the distance between the two steps being four centimeters and its slope vertically. Before the start of the training program, the rat went up to the ladder three repetitions without lifting and without rest between the repetitions to warm. For 8 weeks, the training groups underwent 5 exercise sessions of climbing the ladder with attached weights weighing 30—100% of body weight per week. Resistance training consists of 3 sets of 5 repetitions with 1-minute rest between each repetition and 2 minutes of rest between sets [23].
2.4. Spirulina supplementation Each day, spirulina was added to the drinking water of rats in the spirulina supplement group at a dose of 200 mg/kg/day [24].
2.5. Sampling The animals from the groups were decapitated 24 hours after the last training session [23]. Rat was anesthetized for about 5 minutes by injecting ketamine 10% (50 mg/kg body weight) and xylosin 2% (10 mg/kg body weight) to measure the parameters. Then the heart of the animal was removed from the chest and the left ventricle was also removed. The left ventricular tissue will be placed immediately in the nitrogen tanks and will be transferred to an 80-degree freezer for extraction of ribonucleic acid (RNA).
2.6. RNA isolation and real-time PCR analysis Total RNA was isolated from the tissues using RNA extraction kit (Cinnagen Inc., Iran). The purity, integrity, and concentration of RNA were determined by measuring the optical density 260/280 and agarose gel (1%) electrophoresis. Complementary DNA (cDNA) was synthesized from 1 g of RNA using Revert AidTM first strand cDNA synthesis kit (Fermentas Inc.). Real-time PCR was performed according to the protocol of Real Q Plus 2x Master Mix Green (Ampliqon Inc.) in applied Bio Systems Step OneTM Instrument (ABI, Step One, USA). Real-time PCR for expression analysis of the primer pairs for Pi3k, mTOR, P70-S6K, Akt, and 2M were designed, as shown in Table 1. The 2 M housekeeping gene was also used as the internal control of real-time PCR reactions. The real-time PCR conditions were set for 10 minutes at 94 ◦ C followed by 40 cycles of 15 seconds at 94 ◦ C, 60 seconds at 60 ◦ C and extension steps. After each real-time PCR run, gel electrophoresis and melting curve analysis were carried out to confirm specific amplification of targets. The amplification signals of different samples were normalized to 2M Ct (cycle threshold), and then delta-delta CT (2- et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
4
F. Ahmadi et al. Table 1
Real-time PCR (qPCR) primer pairs used in the study.
Genes
Primer sequences
Sizes (bp)
Pi3k
Forward: 5 -AGAGTTTCCTGGGCATCAATAA -3 Reverse: 5 -CTAACGCAGACATCCTGGAAT-3 Forward: 5 - CATTGGCTGGTGTCCTTTCT-3 Reverse: 5 - GAAGCACAGACCAAGGTACAA-3 Forward: 5 - CTACAGAGACCTGAAGCCGGAGA-3 Reverse: 5 - AATGTGTGCGTGACTGTTCCATC-3 Forward: 5 - TCGTGTGGCAAGATGTGTAT -3 Reverse: 5 - GAGCTGTGAACTCCTCATCAA -3 Forward: 5 - CGTGCTTGCCATTCAGAAA -3 Reverse: 5 - ATATACATCGGTCTCGGTGG -3
127
mTOR P70-S6K Akt 2M
84 114 102 244
bp: base pair; Pi3k: phosphoinositide 3-kinase; mTOR: mammalian target of rapamycin; P70-S6K: p70S6 kinase; Akt: Protein kinase B; 2M: beta-2-microglobulin.
CT) method was applied for comparing mRNA levels of test versus control which represented as fold change in data analysis.
increased significantly, while in the SP group it increased (P = 0.12) (Fig. 1A).
3.4. Akt 2.7. Statistical analysis Two-way ANOVA was used for comparing the effect of resistance training and supplementation with spirulina and the combination of them on signaling pathway. Analysis of data was performed using SPSS version 18 and applied to measures of central tendency and dispersion. Statistical significance was considered when P-value < 0.05. The software to be used is Graph Pad Prism 6.
3. Results 3.1. Animal body weight
Results showed that the expression of Akt in the groups changed after the end of the period. The expression of Akt in the RE group increased significantly (P = 0.01), while in the RE + SP group (P = 0.1) and SP group (P = 0.8) it increased (Fig. 1B).
3.5. mTOR Results showed that the expression of mTOR in the groups changed after the end of the period. The expression of mTOR increased significantly in the RE group (P = 0.001) and the RE + SP group (P = 0.02), while in the SP group it increased (P = 0.5) (Fig. 1C).
Changes in animal weight in the Spirulina, resistance exercise, Spirulina + resistance exercise and control group within eight weeks are shown in Table 2. After eight weeks, rats body weight increased in CO, SP, RE and SP+ RE groups. Body weight in CO, RE and SP+ RE groups was significantly increased during the experimental study, while this increase in the SP group significantly only at first 2 weeks then was slightly increased during the experimental study.
Results showed that the expression of P70-S6K in the groups changed after the end of the period. The expression of P70S6K significantly increased in the RE group (P = 0.05), while in the RE + SP group (P = 0.3) and SP group (P = 0.8) it increased (Fig. 1D).
3.2. Heart and left ventricular weight
4. Discussion
The Spirulina, resistance exercise effects on heart and left ventricular weight changes in CO, SP, RE and SP+ RE groups are presented in Table 2. The heart weight in the RE and SP+ RE groups were significantly higher and SP a little higher than CO group. The Left ventricular weight in the SP, RE and SP+ RE groups significantly higher compared with that in the CO group.
3.3. Pi3k Results showed that the expression of Pi3k in the groups changed after the end of the period. The expression of Pi3k in the RE group (P = 0.001) and the SP+ RE group (P = 0.001) Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
3.6. P70S6 K
In the present study, we demonstrate that the effect of eight weeks of resistance exercise along with the use of Spirulina platensis on the gene expression of the main components of the pathway of hypertrophy (PI3K, Akt, mTOR, and p70S6k) in the heart muscle of healthy male rats. The results of our study showed that expression of PI3k in the resistance exercise group and also in the resistance exercise + Spirulina platensis group increased significantly. Weeks et al. identified PI3K as an essential regulator of cardiovascular protection from exercise [25]. It has been shown that PI3K is one of the critical regulators that causes hypertrophy by exercise, and also it is representative in protection pathway that caused by et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model
ARTICLE IN PRESS
SCISPO-3352; No. of Pages 8
Effect of resistance training with Spirulina platensis on cardiac muscle
5
Table 2 Comparison of the effects of Spirulina, resistance exercise or Spirulina + resistance exercise on changes in rat weight, heart weight, and left ventricular weight after the experimental study. Parameter
Group CO
Heart (mg) Left ventricular (mg) Rat (g) Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8
SP
0.933 ± 0.091 0.551 ± 0.023 149.75 163.12 175.75 187.75 199.25 211.37 219.25 227.75
± ± ± ± ± ± ± ±
5.14 7.21* 8.29* 10.43* 12.22* 10.97* 6.54* 6.71*
RE
1.119 ± 0.056 0.562 ± 0.011* 151.62 167.50 177.87 188.62 198.12 207.50 209.50 211.12
± ± ± ± ± ± ± ±
6.82 6.32* 18.15 33.23 26.52 15.55 13.98 13.84
SP + RE
1.421 ± 0.024* 0.895 ± 0.023* 147.12 155.75 180.50 196.25 210.57 237.57 246.85 257.28
± ± ± ± ± ± ± ±
15.83 11.20* 10.81* 6.84* 5.12* 11.67* 11.49* 12.22*
1.198 ± 0.077* 0.719 ± 0.013* 149.12 168.25 189.87 203.87 214.50 224.85 234.57 242.57
± ± ± ± ± ± ± ±
13.68 12.84* 11.59* 10.49* 9.42* 7.01* 7.32* 5.19*
CO: control; SP: Spirulina; RE: resistance exercise; SP + RE: Spirulina + resistance exercise. * P-value < 0.05 considered as significant.
Figure 1 The effects of SP, RE and SP+ RE on the expression of Pi3k (part: A), Akt (part: B), mTOR (part: C) and P70S6K (part: D), in cardiac muscle. CO: control; SP: Spirulina platensis; RE: resistance exercise; SP +RE: Spirulina platensis + resistance exercise. Data are presented as the mean ± standard error of the mean. * P-value < 0.05 considered as significant.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
6
F. Ahmadi et al.
exercise because it lies at the bottom of the pathway for tyrosine kinase receptors [26]. The PI3K/Akt pathway is a vital link in the development of physiological cardiac output from exercise. Exercise intervention indicates that functional and molecular disorders associated with cardiac pathology are reversed by increasing PI3K activity [18]. One of the findings of our study showed that the expression of Akt in the training group increased significantly. The excessive expression of Akt by insulin, which is an mTOR upstream regulator, results in hypertrophy of the heart muscle [27]. And adjusting the size of the cell by Akt through its downstream phosphorylation, the mTOR mediates in the 2448 series [28]. The result of the study was shown that overexpression of Akt in cardiac enhance cardiac function by left ventricular hypertrophy [29]. It has been reported that Ca2+ handling increased and cardiac inotropism improved by PI3K-AKT signaling. This condition is mediated through the fixation of the L-type calcium 2+ channel (LTCC) [30]. Akt is effective in various cellular processes (e.g. metabolism, survival, angiogenesis and regulating cell growth). Akt by modulating various signaling pathway promotes the development of cardiac hypertrophy. The eukaryotic initiation factor (E4-BP1) that preventing the initiation of translation by the mTOR inhibited. Based on this, cardiac hypertrophy increased by PI3K-Akt-mTOR signaling pathway. Response to protective hypertrophy inhibited by reducing the mTOR in the cardiac muscle and impairs heart function during pressure overload [31]. One of the factors that cause protein synthesis in the heart muscle is the Activation of the AKT/mTOR signaling cascade and is positive setting after exercise training. In other words, post-transcription regulation can provide an alternative to regulating the physiological hypertrophy by gene expression [32]. Activating Akt initially promotes cardiac growth while maintaining cardiac function [33]. If this signaling pathway is activated too much, leading to impaired cardiac function and pathological hypertrophy [34]. Evidence suggests that mice that are transgenic for PI3K, and mice that are under exercise, increase the expression of Akt (4, 6, 6, and 1.5—2 times respectively) [35]. It has been shown that excessive expression of the active form of AKT in the mouse heart causes significant cardiac hypertrophy, apparently due to increased cardiomyocyte levels in transgenic mice. A large number of studies conclude that cardiac AKT causes heart failure in models of cardiac hypertrophy or ischemia and the role of AKT in left ventricular hypertrophy due to exercise is strongly restricted in physiological conditions [3]. The results showed that the expression of mTOR in the resistance exercise group and in the resistance exercise + supplementation spirulina group increased significantly. Resistance exercise has a strong and acute effect on signaling of mTOR [36]. In addition, nutrition especially dietary proteins can increase levels of serum amino acids. Energy and carbon sources for many other metabolic pathways and essential building blocks of proteins provide by amino acids. The activation of mTOR is heavily dependent on changes in diet due to amino acid concentrations. Potentially suggests two separate points of convergence in the activation of mTOR (PI3K-Akt-mTOR insulin receptor pathway and hVps34-mTOR Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
amino acid pathway) [37] have shown that exercising resistance training alone stimulates muscle protein synthesis [38]. Other studies have shown that the use of amino acids in combination with exercise stimulates mTOR signaling pathway [39]. In addition, Drummond et al. reported that Rapamycin (as an inhibitor of mTOR) prevents increased protein synthesis of muscle after exercise and nutrition [40]. It is established that exercise training increases the synthesis of protein synthesis in the heart muscle, this increase in synthesis is due to the activation of the Akt/mTOR signaling. In other word, post-transcription regulation can by gene expression induce regulating the physiological hypertrophy. Increases biogenesis of the ribosomal and 50 cap recognition of mRNA with subsequent translation into the ribosome, it is due to releasing eIF-4E and increasing S6 ribosomal protein phosphorylation with its protein binding inhibitor (4E-BP1) [22]. Overall, this activity increases and consequently, it increases protein synthesis by the ribosomal machinery in the cardiomyocyte. The activating the Akt/mTOR signaling cascade in the heart promotes the growth of the heart muscle that is enhanced by contraction performance and Ca2þ handling. This causes physiological hypertrophy in the rat after exercise training [41]. These are the evidence indicate that the AKT downstream signaling pathway not only provides for contraction changes but may also partially be regulated by the Akt. In addition, the results showed that a significant increase in expression of P70-S6K in the training group. It has been determined that the mTOR in its messaging pathway causes phosphorylation of the ‘‘70 kD protein S6 kinase (p70S6K) ribosomal’’, which is essential for protein synthesis [42]. The p70S6K is a member of the AGC protein family of kinases, and by phosphorylation of several substrates including SKAR, PDCD4, eEF-2K, eIF4B, and ribosomal protein S6, it increases the translation of mRNA. In fact, the role of p70S6K in enhancing translation of mRNA, as the eEF-2 kinase phosphorylated agent (eEf-2K), is best described. eEf-2K via phosphorylation of eEF2, it suppresses and reduces translation of mRNA, However, p70S6K is directly phosphorylated and inhibits by eEf-2K [42]. In this way, mTOR and p70S6K increase the translation process and expression of the muscle building proteins required. Numerous evidence identified mTOR as the key regulatory in initiating translation via S6K1 and 4E-BP1 as its downstream targets [43,44]. Moreover, binding of mRNA to the ribosome simplified by phosphorylation of S6K1. Multiple pieces of evidence have shown that S6K1 enhanced phosphorylation followed protein consumption and/or resistance training is accompanied by stimulation of human muscle protein synthesis [21,45]. Physical activity and Exercise was an important lifestyle factor that enhances cardiac health. In this area the biochemical and molecular mechanisms of exercise and physical activity alter physiological cardiac hypertrophy [46]. Heart known as dynamic recovering situation, it is associated with continual disintegration and cardiac proteins synthesis as contractile segments. Nowadays it is accepted that both classical energy supplies and amino acids known as anabolic regulators in this cycling. Because of their ability to regulate protein turnover, as well as the function of the et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
Effect of resistance training with Spirulina platensis on cardiac muscle heart, amino acids have the potential therapeutic potential [47]. Although much progress has been made in explaining the underlying mechanisms of physiological hypertrophy, many issues remain unresolved [48]. The heart can with stand pressure overload without hypertrophy [49]. In summary, using Spirulina platensis alone does not have a significant effect on the signaling pathway in the heart. However, the combination of resistance training + Spirulina platensis can effect on mTOR and PI3K. On the other hand, the effect of resistance training alone can have a significant effect on hypertrophy signaling pathway (e.g. P70 S6 k, mTOR, Akt, and PI3K).
Disclosure of interest The authors declare that they have no competing interest.
Acknowledgments We are grateful to all coworkers of this study. This paper is published as a part of the Ph.D. degree thesis of Mrs. Fatemeh Ahmadi.
References [1] Curtis GL, et al. Impact of physical activity in cardiovascular and musculoskeletal health: can motion be medicine? J Clin Med Res 2017;9(5):375—81. [2] Gaeini A, et al. The effect of 8-week aerobic interval training and a detraining period on left ventricular structure and function in non-athlete healthy men. Zahedan J Res Med Sci 2012;13(9):16—20. [3] Soci UPR, et al. MicroRNAs 29 are involved in the improvement of ventricular compliance promoted by aerobic exercise training in rats. Physiol Genomics 2011;43(11):665—73. [4] Gupta S, Das B, Sen S. Cardiac hypertrophy: mechanisms and therapeutic opportunities. Antioxid Redox Signal 2007;9(6):623—52. [5] Fagard R. Athlete’s heart. Heart 2003;89(12):1455—61. [6] George KP, Gates PE, Tolfrey K. The impact of aerobic training upon left ventricular morphology and function in prepubescent children. Ergonomics 2005;48(11—14):1378—89. [7] Maughan R, editor. Nutrition in sport. The encyclopedia of sports medicine. Oxford: John Wiley & Sons; 2008. [8] Karkos P, et al. Spirulina in clinical practice: evidencebased human applications. Evid Based Complement Altern Med 2011;2011(1):1—4. [9] Belay A, et al. Current knowledge on potential health benefits of Spirulina. J Appl Phycol 1993;5(2):235—41. [10] Sandhu J, Shenoy S. Efficacy of spirulina supplementation on isometric strength and isometric endurance of quadriceps in trained and untrained individuals — a comparative study. Ibnosina J Med Biomed Sci 2009;2(2):79—86. [11] Voltarelli F, et al. Nutrition recovery with Spirulina diet improves body growth and muscle protein ofprotein-restricted rats. Int J Nutr Metab 2011;3(3):22—30. [12] Duan M, et al. Determination of micro-elements in natural spirulina using FAAS. Guang pu xue yu guang pu fen xi = Guang pu 2001;21(6):868—70. [13] Lyon RC, et al. Mechanotransduction in cardiac hypertrophy and failure. Circ Res 2015;116(8):1462—76. [14] Liu P, et al. Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov 2009;8(8):627—44.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
7
[15] Wackerhage H, editor. Molecular exercise physiology: an introduction. Routledge; 2014. [16] Leevers SJ. Growth control: invertebrate insulin surprises! Curr Biol 2001;11(6):R209—12. [17] Scheid MP, Woodgett JR. Unravelling the activation mechanisms of protein kinase B/Akt. FEBS Lett 2003;546(1):108—12. [18] Bernardo BC, et al. Molecular distinction between physiological and pathological cardiac hypertrophy: experimental findings and therapeutic strategies. Pharmacol Ther 2010;128(1):191—227. [19] Zhang D, et al. MTORC1 regulates cardiac function and myocyte survival through 4E-BP1 inhibition in mice. J Clin Invest 2010;120(8):2805—16. [20] Wilkinson SB, et al. Differential effects of resistance and endurance exercise in the fed state on signaling molecule phosphorylation and protein synthesis in human muscle. J Physiol 2008;586(15):3701—17. [21] Burd NA, et al. Low-load high volume resistance exercise stimulates muscle protein synthesis more than high-load low volume resistance exercise in young men. PloS One 2010; 5(8):e12033. [22] Walsh K. Akt signaling and growth of the heart. Am Heart Assoc 2006;113:2032—4. [23] Dehghan F, et al. Saffron with resistance exercise improves diabetic parameters through the GLUT4/AMPK pathway in-vitro and in-vivo. Sci Rep 2016;6:25139. [24] Liping L, et al. Spirulina platensis extract supplementation attenuates oxidative stress in acute exhaustive exercise: a pilot study. Int J Phys Sci 2011;6(12):2901—6. [25] Weeks KL, et al. Phosphoinositide 3-kinase p110␣ is a master regulator of exercise-induced cardioprotection and PI3K gene therapy rescues cardiac dysfunction. Circulation: Heart Failure 2012;5(4):523—34. [26] McMullen JR, et al. Phosphoinositide 3-kinase (p110␣) plays a critical role in the induction of physiological, but not pathological, cardiac hypertrophy. Proc Natl Acad Sci U S A 2003;100(21):12355—60. [27] Shioi T, et al. Rapamycin attenuates load-induced cardiac hypertrophy in mice. Circulation 2003;107(12):1664—70. [28] Lollo P, et al. L-Leucine supplemented whey protein. Doseresponse effect on heart mTOR activation of sedentary and trained rats. Food Res Int 2013;53(1):543—50. [29] Kim Y-K, et al. Mechanism of enhanced cardiac function in mice with hypertrophy induced by overexpressed Akt. J Biol Chem 2003;278(48):47622—8. [30] Catalucci D, et al. Akt regulates L-type Ca2+ channel activity by modulating Cav␣1 protein stability. J Cell Biol 2009;184(6):923—33. [31] Vinciguerra M, et al. Local IGF-1 isoform protects cardiomyocytes from hypertrophic and oxidative stresses via SirT1 activity. Aging (Albany NY) 2010;2(1):43. [32] Kemi OJ, et al. Activation or inactivation of cardiac Akt/mTOR signaling diverges physiological from pathological hypertrophy. J Cell Physiol 2008;214(2):316—21. [33] Shioi T, et al. Akt/protein kinase B promotes organ growth in transgenic mice. Mol Cell Biol 2002;22(8):2799—809. [34] Shiojima I, et al. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest 2005;115(8):2108—18. [35] McMullen JR, et al. Inhibition of mTOR signaling with rapamycin regresses established cardiac hypertrophy induced by pressure overload. Circulation 2004;109(24):3050—5. [36] Pallafacchina G, et al. A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification. Proc Natl Acad Sci U S A 2002;99(14):9213—8. [37] Dreyer HC, et al. Leucine-enriched essential amino acid and carbohydrate ingestion following resistance exercise enhances
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
8
F. Ahmadi et al.
[38]
[39]
[40]
[41]
[42]
[43]
mTOR signaling and protein synthesis in human muscle. Am J Physiol Endocrinol Metab 2008;294(2):E392—400. Biology G, et al. Insulin action on muscle protein kinetics and amino acid transport during recovery after resistance exercise. Diabetes 1999;48(5):949—57. Børsheim E, et al. Effect of carbohydrate intake on net muscle protein synthesis during recovery from resistance exercise. J Appl Physiol 2004;96(2):674—8. Drummond MJ, et al. Rapamycin administration in humans blocks the contraction-induced increase in skeletal muscle protein synthesis. J Physiol 2009;587(7):1535—46. Kemi OJ, et al. Phosphorylation of regulatory proteins CaMK, PLN, and AKT precedes cardiomyocyte adaptation to exercise training. J Mol Cell Cardiol 2006;40(6):1006. Sengupta S, Peterson TR, Sabatini DM. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol Cell 2010;40(2):310—22. Drummond MJ, et al. Nutritional and contractile regulation of human skeletal muscle protein synthesis and mTORC1 signaling. J Appl Physiol 2009;106(4):1374—84.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
[44] Wang X, Proud CG. The mTOR pathway in the control of protein synthesis. Physiology 2006;21(5):362—9. [45] Atherton PJ, et al. Muscle full effect after oral protein: time-dependent concordance and discordance between human muscle protein synthesis and mTORC1 signaling. Am J Clin Nutr 2010;92(5):1080—8. [46] Ma Z, et al. Swimming exercise training-induced left ventricular hypertrophy involves microRNAs and synergistic regulation of the PI3K/AKT/mTOR signaling pathway. Eur J Appl Physiol 2013;113(10):2473—86. [47] Sanchez Canedo C, et al. Activation of the cardiac mTOR/p70S6K pathway by leucine requires PDK1 and correlates with PRAS40 phosphorylation. Am J Physiol Endocrinol Metab 2010;298(4):E761—9. [48] Nakamura M, Sadoshima J. Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol 2018;15(7):387—407. [49] Gold JI, et al. Determining the absolute requirement of G protein-coupled receptor kinase 5 for pathological cardiac hypertrophy. Circ Res 2012;111(8):1048—53.
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
ARTICLE IN PRESS
SCISPO-3352; No. of Pages 8 Science & Sports (2019) xxx, xxx—xxx
Disponible en ligne sur
ScienceDirect www.sciencedirect.com
ORIGINAL ARTICLE
Effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in cardiac muscle Effet de l’entraînement en résistance et de Spirulina platensis sur la voie de signalisation PI3K/Akt/mTOR/p70S6k dans le muscle cardiaque F. Ahmadi a, M. Ghanbar Zadeh a,∗, A.H. Habibi a, F. Karimi b a
Department of Exercise Physiology, Faculty of Sport Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran b Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Received 22 February 2019; accepted 6 June 2019
KEYWORDS Resistance training; Spirulina platensis; Hypertrophy signaling pathway; Cardiac muscle
∗
Summary Background. — Resistance training and spirulina change the expression of genes involved in the hypertrophy. We investigated the effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in rat cardiac muscle. Methods. — For this purpose, 32 male Sprague—Dawley rats were divided into four groups: control (Co; n = 8), spirulina platensis (SP; n = 8), resistance training (RE; n = 8), spirulina platensis + resistance training (SP +RE; n = 8). The resistance training group practiced five sessions each week for eight weeks. Spirulina 200 mg/kg/day was used in the supplement group and exercise + spirulina platensis group. Twenty-four hours after the last training session, the expression of genes was measured by Real-time PCR. Results. — Results showed the expression of mTOR increased significantly in the RE group (P = 0.001) and the SP +RE (P = 0.02). The expression of Akt in the RE group increased significantly (P = 0.01). The expression of Pi3k in the RE group (P = 0.001) and the SP+ RE group (P = 0.001) increased significantly. The expression of P70-S6K in the RE group increased significantly (P = 0.05).
Corresponding author. E-mail address: [email protected] (M. Ghanbar Zadeh).
https://doi.org/10.1016/j.scispo.2019.06.003 0765-1597/© 2019 Published by Elsevier Masson SAS.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
2
F. Ahmadi et al. Conclusion. — Using spirulina platensis alone does not have an effect on the signaling pathway in the heart. However, the combination of resistance training can affect some of the components of the signaling pathway (PI3K/mTOR). And also, the effect of resistance training alone can have a significant effect on all components of the signaling pathway. © 2019 Published by Elsevier Masson SAS.
MOTS CLÉS Entraînement en résistance ; La spiruline platensis ; Voie de signalisation de l’hypertrophie ; Muscle cardiaque
Résumé Contexte. — L’entraînement en résistance et la spiruline modifient l’expression des gènes impliqués dans l’hypertrophie. Nous avons étudié l’effet de l’entraînement en résistance avec Spirulina platensis sur la voie de signalisation PI3K/Akt/mTOR/p70S6k dans le muscle cardiaque. Méthodes. — À cette fin, 32 rats Sprague—Dawley mâles ont été divisés en quatre groupes : contrôle (Co ; n = 8), spiruline platensis (SP ; n = 8), entraînement à la résistance (RE ; n = 8), spiruline platensis + résistance, formation (SP + RE ; n = 8). Le groupe d’entraînement en résistance a pratiqué cinq séances par semaine pendant huit semaines. De la spiruline à 200 mg/kg/jour a été utilisée dans le groupe des suppléments et dans le groupe de l’exercice + spiruline à platensis. Vingt-quatre heures après la dernière séance d’entraînement, l’expression des gènes a été mesurée par PCR en temps réel. Résultats. — Les résultats ont montré que l’expression de mTOR augmentait significativement dans le groupe RE (p = 0,001) et le SP + RE (p = 0,02). L’expression de Akt dans le groupe RE a augmenté de manière significative (p = 0,01). L’expression de Pi3k dans le groupe RE (p = 0,001) et le groupe SP + RE (p = 0,001) a augmenté de manière significative. L’expression de P70-S6K dans le groupe RE a augmenté de manière significative (p = 0,05). Conclusion. — L’utilisation de Spirulina platensis seule n’a pas d’effet sur la voie de signalisation dans le cœur. Cependant, la combinaison avec un entraînement en résistance peut affecter certains des composants de la voie de signalisation (PI3K/mTOR). De plus, l’effet de l’entraînement en résistance seul peut avoir un effet significatif sur toutes les composantes de la voie de signalisation. © 2019 Publi´ e par Elsevier Masson SAS.
1. Introduction The efforts of health centers around the world to prevent heart disease with an emphasis on physical activity has led to an increase in the number of participants in recreational and competitive sports programs. Because regular exercise is consistent with structural, functional and electrical changes in the heart [1]. In response to increased workload, the heart should work harder than normal conditions and rest, leading to an increase in heart rate. Since the person’s ability to perform exercise activities depends on the performance and function of various body systems, including the cardiovascular system. With regular and prolonged exercise training, the heart has undergone a change that is a reflection of cardiovascular fitness in response to exercise or physiological changes [2]. Also, cardiac hypertrophy is a development of the left ventricular mass of the heart that affects the Stroke volume and cardiac output [3]. The heart muscle grows in response to mechanical stress and various stimuli, and hypertrophy of myocytes is the primary cause of its molecular cause [4]. Pressure overload in strength exercises increases the ventricular wall thickness with no change in the inner radius that causes the concentric hypertrophy [5]. Researchers have arranged a set of information that the left ventricular compatibility is specific to the type of exercise [6]. On the other hand, Nowadays, the use of food
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
supplements in exercise is very wide [7]. Spirulina platensis is a green-blue alga [8], which has been considered for protein and vitamin sources [9]. Studies have shown that Spirulina platensis can increase muscle isometric strength and endurance [10] as well as the amount of protein synthesis in the muscle [11]. Duan et al. argued that spirulina is useful for heart muscle. Empirical research has shown that Spirulina is a healthy diet, with nutritional and medicinal value [12]. Several factors such as mechanical forces and growth hormones (e.g. insulin growth factor 1, insulin and thyroid hormone) by activating several signals such as PI3K, Akt, and mTOR pathways cause physiological cardiac hypertrophy [13]. Because exercise with increased growth hormone secretion and increase systemic and topical IGF-1 in the heart, can affect this important pathway [14]. Resistance exercise activates intramuscular messaging cascades (i.e. the mTOR pathway). In addition to exercise, these pathways are also affected by nutrients, as well as drugs and nutrients, medicines and energizing drugs [15]. The mTOR molecule (the target molecule of rapamycin in mammals) is a serine/threonine kinase protein initially identified as the cellular goal of the Rapamycin drug was recognize. This kinase regulates the growth, proliferation, mobility, and survival of the cells, as well as the transcription of the gene and protein synthesis that are stimulated in response to hormones, growth factors, and nutrients [14].
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
Effect of resistance training with Spirulina platensis on cardiac muscle The size of the mouse’s heart is particularly affected by the PI3K [16]. This makes PI3K a candidate for intervention in cardiac hypertrophy [17]. Activating PI3K and serine-threonine kinase downstream (Akt) plays an important role in protecting the heart through tyrosine kinase receptor signaling [18]. Akt promotes the development of cardiac hypertrophy by modulating various signaling pathway [19]. Resistive exercises can increase the phosphorylation factor of the pathway of Akt/mTOR/p70S6K [20]. Burd et al. reported that phosphorylation of Akt, mTOR, and p70S6K significantly increased after low and high load resistance training [21]. These findings indicate the stimulatory effect of resistance activity on the molecular pathways of anabolic and protein synthesis. The activation of the signal pathway used to diagnose physiological hypertrophy. This pathway that involves signaling pathway PI3K/Akt/mTOR/P70s6k is of particular importance [22]. In the present study, we examine the effect of resistance training with Spirulina platensis on PI3K/Akt/mTOR/p70S6k signaling pathway in rat cardiac muscle.
2. Materials and methods 2.1. Experimental animals and ethical aspects In this study, 32 male Sprague—Dawley rats 290 ± 20 g in weight, and 9 weeks of age were obtained from the animal center house of Shiraz University of Medical Sciences and then transferred to the laboratory polycarbonate cages in the University of Marvdasht. Each rat is kept in a separate cage of transparent polycarbonate and maintained in an environment with a temperature of 22 ± 2 ◦ C, a humidity of 55 ± 4% under 12/12 h light/dark cycle. During the research process, the animals were fed with provided pellet food for animal breeding, reproduction, and stem cells. All animals were provided with free access to standard rat food (specially designed for rats supplied by the company of Pars feed) and healthy water and were provided with human care in accordance with the relevant instructions. All procedures involving animal experiments were approved and carried out in strict accordance with the United States Institute of Animal Research guidelines for the care and use of laboratory animals by animal care.
2.2. Experimental animal groups For accurate comparison of study data, animal models will be randomly divided into four groups (each group, 8 heads): • control (Cn: without resistance training, without supplementation with spirulina); • supplementation with spirulina (SP: without resistance training); • resistance training (RT: without spirulina supplementation); • resistance training + supplementation with spirulina (RT + SP). Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
3
2.3. Resistance training protocol After a week of acclimatization, the animals were first trained to climb the vertical ladder as the exercise for this study. The climbing familiarization sessions were conducted three to four replicates every day for a week without weights attached. The resistance training protocol included an eight-week climb of a ladder with a height of one meter, with the distance between the two steps being four centimeters and its slope vertically. Before the start of the training program, the rat went up to the ladder three repetitions without lifting and without rest between the repetitions to warm. For 8 weeks, the training groups underwent 5 exercise sessions of climbing the ladder with attached weights weighing 30—100% of body weight per week. Resistance training consists of 3 sets of 5 repetitions with 1-minute rest between each repetition and 2 minutes of rest between sets [23].
2.4. Spirulina supplementation Each day, spirulina was added to the drinking water of rats in the spirulina supplement group at a dose of 200 mg/kg/day [24].
2.5. Sampling The animals from the groups were decapitated 24 hours after the last training session [23]. Rat was anesthetized for about 5 minutes by injecting ketamine 10% (50 mg/kg body weight) and xylosin 2% (10 mg/kg body weight) to measure the parameters. Then the heart of the animal was removed from the chest and the left ventricle was also removed. The left ventricular tissue will be placed immediately in the nitrogen tanks and will be transferred to an 80-degree freezer for extraction of ribonucleic acid (RNA).
2.6. RNA isolation and real-time PCR analysis Total RNA was isolated from the tissues using RNA extraction kit (Cinnagen Inc., Iran). The purity, integrity, and concentration of RNA were determined by measuring the optical density 260/280 and agarose gel (1%) electrophoresis. Complementary DNA (cDNA) was synthesized from 1 g of RNA using Revert AidTM first strand cDNA synthesis kit (Fermentas Inc.). Real-time PCR was performed according to the protocol of Real Q Plus 2x Master Mix Green (Ampliqon Inc.) in applied Bio Systems Step OneTM Instrument (ABI, Step One, USA). Real-time PCR for expression analysis of the primer pairs for Pi3k, mTOR, P70-S6K, Akt, and 2M were designed, as shown in Table 1. The 2 M housekeeping gene was also used as the internal control of real-time PCR reactions. The real-time PCR conditions were set for 10 minutes at 94 ◦ C followed by 40 cycles of 15 seconds at 94 ◦ C, 60 seconds at 60 ◦ C and extension steps. After each real-time PCR run, gel electrophoresis and melting curve analysis were carried out to confirm specific amplification of targets. The amplification signals of different samples were normalized to 2M Ct (cycle threshold), and then delta-delta CT (2- et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
4
F. Ahmadi et al. Table 1
Real-time PCR (qPCR) primer pairs used in the study.
Genes
Primer sequences
Sizes (bp)
Pi3k
Forward: 5 -AGAGTTTCCTGGGCATCAATAA -3 Reverse: 5 -CTAACGCAGACATCCTGGAAT-3 Forward: 5 - CATTGGCTGGTGTCCTTTCT-3 Reverse: 5 - GAAGCACAGACCAAGGTACAA-3 Forward: 5 - CTACAGAGACCTGAAGCCGGAGA-3 Reverse: 5 - AATGTGTGCGTGACTGTTCCATC-3 Forward: 5 - TCGTGTGGCAAGATGTGTAT -3 Reverse: 5 - GAGCTGTGAACTCCTCATCAA -3 Forward: 5 - CGTGCTTGCCATTCAGAAA -3 Reverse: 5 - ATATACATCGGTCTCGGTGG -3
127
mTOR P70-S6K Akt 2M
84 114 102 244
bp: base pair; Pi3k: phosphoinositide 3-kinase; mTOR: mammalian target of rapamycin; P70-S6K: p70S6 kinase; Akt: Protein kinase B; 2M: beta-2-microglobulin.
CT) method was applied for comparing mRNA levels of test versus control which represented as fold change in data analysis.
increased significantly, while in the SP group it increased (P = 0.12) (Fig. 1A).
3.4. Akt 2.7. Statistical analysis Two-way ANOVA was used for comparing the effect of resistance training and supplementation with spirulina and the combination of them on signaling pathway. Analysis of data was performed using SPSS version 18 and applied to measures of central tendency and dispersion. Statistical significance was considered when P-value < 0.05. The software to be used is Graph Pad Prism 6.
3. Results 3.1. Animal body weight
Results showed that the expression of Akt in the groups changed after the end of the period. The expression of Akt in the RE group increased significantly (P = 0.01), while in the RE + SP group (P = 0.1) and SP group (P = 0.8) it increased (Fig. 1B).
3.5. mTOR Results showed that the expression of mTOR in the groups changed after the end of the period. The expression of mTOR increased significantly in the RE group (P = 0.001) and the RE + SP group (P = 0.02), while in the SP group it increased (P = 0.5) (Fig. 1C).
Changes in animal weight in the Spirulina, resistance exercise, Spirulina + resistance exercise and control group within eight weeks are shown in Table 2. After eight weeks, rats body weight increased in CO, SP, RE and SP+ RE groups. Body weight in CO, RE and SP+ RE groups was significantly increased during the experimental study, while this increase in the SP group significantly only at first 2 weeks then was slightly increased during the experimental study.
Results showed that the expression of P70-S6K in the groups changed after the end of the period. The expression of P70S6K significantly increased in the RE group (P = 0.05), while in the RE + SP group (P = 0.3) and SP group (P = 0.8) it increased (Fig. 1D).
3.2. Heart and left ventricular weight
4. Discussion
The Spirulina, resistance exercise effects on heart and left ventricular weight changes in CO, SP, RE and SP+ RE groups are presented in Table 2. The heart weight in the RE and SP+ RE groups were significantly higher and SP a little higher than CO group. The Left ventricular weight in the SP, RE and SP+ RE groups significantly higher compared with that in the CO group.
3.3. Pi3k Results showed that the expression of Pi3k in the groups changed after the end of the period. The expression of Pi3k in the RE group (P = 0.001) and the SP+ RE group (P = 0.001) Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
3.6. P70S6 K
In the present study, we demonstrate that the effect of eight weeks of resistance exercise along with the use of Spirulina platensis on the gene expression of the main components of the pathway of hypertrophy (PI3K, Akt, mTOR, and p70S6k) in the heart muscle of healthy male rats. The results of our study showed that expression of PI3k in the resistance exercise group and also in the resistance exercise + Spirulina platensis group increased significantly. Weeks et al. identified PI3K as an essential regulator of cardiovascular protection from exercise [25]. It has been shown that PI3K is one of the critical regulators that causes hypertrophy by exercise, and also it is representative in protection pathway that caused by et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model
ARTICLE IN PRESS
SCISPO-3352; No. of Pages 8
Effect of resistance training with Spirulina platensis on cardiac muscle
5
Table 2 Comparison of the effects of Spirulina, resistance exercise or Spirulina + resistance exercise on changes in rat weight, heart weight, and left ventricular weight after the experimental study. Parameter
Group CO
Heart (mg) Left ventricular (mg) Rat (g) Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8
SP
0.933 ± 0.091 0.551 ± 0.023 149.75 163.12 175.75 187.75 199.25 211.37 219.25 227.75
± ± ± ± ± ± ± ±
5.14 7.21* 8.29* 10.43* 12.22* 10.97* 6.54* 6.71*
RE
1.119 ± 0.056 0.562 ± 0.011* 151.62 167.50 177.87 188.62 198.12 207.50 209.50 211.12
± ± ± ± ± ± ± ±
6.82 6.32* 18.15 33.23 26.52 15.55 13.98 13.84
SP + RE
1.421 ± 0.024* 0.895 ± 0.023* 147.12 155.75 180.50 196.25 210.57 237.57 246.85 257.28
± ± ± ± ± ± ± ±
15.83 11.20* 10.81* 6.84* 5.12* 11.67* 11.49* 12.22*
1.198 ± 0.077* 0.719 ± 0.013* 149.12 168.25 189.87 203.87 214.50 224.85 234.57 242.57
± ± ± ± ± ± ± ±
13.68 12.84* 11.59* 10.49* 9.42* 7.01* 7.32* 5.19*
CO: control; SP: Spirulina; RE: resistance exercise; SP + RE: Spirulina + resistance exercise. * P-value < 0.05 considered as significant.
Figure 1 The effects of SP, RE and SP+ RE on the expression of Pi3k (part: A), Akt (part: B), mTOR (part: C) and P70S6K (part: D), in cardiac muscle. CO: control; SP: Spirulina platensis; RE: resistance exercise; SP +RE: Spirulina platensis + resistance exercise. Data are presented as the mean ± standard error of the mean. * P-value < 0.05 considered as significant.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
6
F. Ahmadi et al.
exercise because it lies at the bottom of the pathway for tyrosine kinase receptors [26]. The PI3K/Akt pathway is a vital link in the development of physiological cardiac output from exercise. Exercise intervention indicates that functional and molecular disorders associated with cardiac pathology are reversed by increasing PI3K activity [18]. One of the findings of our study showed that the expression of Akt in the training group increased significantly. The excessive expression of Akt by insulin, which is an mTOR upstream regulator, results in hypertrophy of the heart muscle [27]. And adjusting the size of the cell by Akt through its downstream phosphorylation, the mTOR mediates in the 2448 series [28]. The result of the study was shown that overexpression of Akt in cardiac enhance cardiac function by left ventricular hypertrophy [29]. It has been reported that Ca2+ handling increased and cardiac inotropism improved by PI3K-AKT signaling. This condition is mediated through the fixation of the L-type calcium 2+ channel (LTCC) [30]. Akt is effective in various cellular processes (e.g. metabolism, survival, angiogenesis and regulating cell growth). Akt by modulating various signaling pathway promotes the development of cardiac hypertrophy. The eukaryotic initiation factor (E4-BP1) that preventing the initiation of translation by the mTOR inhibited. Based on this, cardiac hypertrophy increased by PI3K-Akt-mTOR signaling pathway. Response to protective hypertrophy inhibited by reducing the mTOR in the cardiac muscle and impairs heart function during pressure overload [31]. One of the factors that cause protein synthesis in the heart muscle is the Activation of the AKT/mTOR signaling cascade and is positive setting after exercise training. In other words, post-transcription regulation can provide an alternative to regulating the physiological hypertrophy by gene expression [32]. Activating Akt initially promotes cardiac growth while maintaining cardiac function [33]. If this signaling pathway is activated too much, leading to impaired cardiac function and pathological hypertrophy [34]. Evidence suggests that mice that are transgenic for PI3K, and mice that are under exercise, increase the expression of Akt (4, 6, 6, and 1.5—2 times respectively) [35]. It has been shown that excessive expression of the active form of AKT in the mouse heart causes significant cardiac hypertrophy, apparently due to increased cardiomyocyte levels in transgenic mice. A large number of studies conclude that cardiac AKT causes heart failure in models of cardiac hypertrophy or ischemia and the role of AKT in left ventricular hypertrophy due to exercise is strongly restricted in physiological conditions [3]. The results showed that the expression of mTOR in the resistance exercise group and in the resistance exercise + supplementation spirulina group increased significantly. Resistance exercise has a strong and acute effect on signaling of mTOR [36]. In addition, nutrition especially dietary proteins can increase levels of serum amino acids. Energy and carbon sources for many other metabolic pathways and essential building blocks of proteins provide by amino acids. The activation of mTOR is heavily dependent on changes in diet due to amino acid concentrations. Potentially suggests two separate points of convergence in the activation of mTOR (PI3K-Akt-mTOR insulin receptor pathway and hVps34-mTOR Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
amino acid pathway) [37] have shown that exercising resistance training alone stimulates muscle protein synthesis [38]. Other studies have shown that the use of amino acids in combination with exercise stimulates mTOR signaling pathway [39]. In addition, Drummond et al. reported that Rapamycin (as an inhibitor of mTOR) prevents increased protein synthesis of muscle after exercise and nutrition [40]. It is established that exercise training increases the synthesis of protein synthesis in the heart muscle, this increase in synthesis is due to the activation of the Akt/mTOR signaling. In other word, post-transcription regulation can by gene expression induce regulating the physiological hypertrophy. Increases biogenesis of the ribosomal and 50 cap recognition of mRNA with subsequent translation into the ribosome, it is due to releasing eIF-4E and increasing S6 ribosomal protein phosphorylation with its protein binding inhibitor (4E-BP1) [22]. Overall, this activity increases and consequently, it increases protein synthesis by the ribosomal machinery in the cardiomyocyte. The activating the Akt/mTOR signaling cascade in the heart promotes the growth of the heart muscle that is enhanced by contraction performance and Ca2þ handling. This causes physiological hypertrophy in the rat after exercise training [41]. These are the evidence indicate that the AKT downstream signaling pathway not only provides for contraction changes but may also partially be regulated by the Akt. In addition, the results showed that a significant increase in expression of P70-S6K in the training group. It has been determined that the mTOR in its messaging pathway causes phosphorylation of the ‘‘70 kD protein S6 kinase (p70S6K) ribosomal’’, which is essential for protein synthesis [42]. The p70S6K is a member of the AGC protein family of kinases, and by phosphorylation of several substrates including SKAR, PDCD4, eEF-2K, eIF4B, and ribosomal protein S6, it increases the translation of mRNA. In fact, the role of p70S6K in enhancing translation of mRNA, as the eEF-2 kinase phosphorylated agent (eEf-2K), is best described. eEf-2K via phosphorylation of eEF2, it suppresses and reduces translation of mRNA, However, p70S6K is directly phosphorylated and inhibits by eEf-2K [42]. In this way, mTOR and p70S6K increase the translation process and expression of the muscle building proteins required. Numerous evidence identified mTOR as the key regulatory in initiating translation via S6K1 and 4E-BP1 as its downstream targets [43,44]. Moreover, binding of mRNA to the ribosome simplified by phosphorylation of S6K1. Multiple pieces of evidence have shown that S6K1 enhanced phosphorylation followed protein consumption and/or resistance training is accompanied by stimulation of human muscle protein synthesis [21,45]. Physical activity and Exercise was an important lifestyle factor that enhances cardiac health. In this area the biochemical and molecular mechanisms of exercise and physical activity alter physiological cardiac hypertrophy [46]. Heart known as dynamic recovering situation, it is associated with continual disintegration and cardiac proteins synthesis as contractile segments. Nowadays it is accepted that both classical energy supplies and amino acids known as anabolic regulators in this cycling. Because of their ability to regulate protein turnover, as well as the function of the et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
Effect of resistance training with Spirulina platensis on cardiac muscle heart, amino acids have the potential therapeutic potential [47]. Although much progress has been made in explaining the underlying mechanisms of physiological hypertrophy, many issues remain unresolved [48]. The heart can with stand pressure overload without hypertrophy [49]. In summary, using Spirulina platensis alone does not have a significant effect on the signaling pathway in the heart. However, the combination of resistance training + Spirulina platensis can effect on mTOR and PI3K. On the other hand, the effect of resistance training alone can have a significant effect on hypertrophy signaling pathway (e.g. P70 S6 k, mTOR, Akt, and PI3K).
Disclosure of interest The authors declare that they have no competing interest.
Acknowledgments We are grateful to all coworkers of this study. This paper is published as a part of the Ph.D. degree thesis of Mrs. Fatemeh Ahmadi.
References [1] Curtis GL, et al. Impact of physical activity in cardiovascular and musculoskeletal health: can motion be medicine? J Clin Med Res 2017;9(5):375—81. [2] Gaeini A, et al. The effect of 8-week aerobic interval training and a detraining period on left ventricular structure and function in non-athlete healthy men. Zahedan J Res Med Sci 2012;13(9):16—20. [3] Soci UPR, et al. MicroRNAs 29 are involved in the improvement of ventricular compliance promoted by aerobic exercise training in rats. Physiol Genomics 2011;43(11):665—73. [4] Gupta S, Das B, Sen S. Cardiac hypertrophy: mechanisms and therapeutic opportunities. Antioxid Redox Signal 2007;9(6):623—52. [5] Fagard R. Athlete’s heart. Heart 2003;89(12):1455—61. [6] George KP, Gates PE, Tolfrey K. The impact of aerobic training upon left ventricular morphology and function in prepubescent children. Ergonomics 2005;48(11—14):1378—89. [7] Maughan R, editor. Nutrition in sport. The encyclopedia of sports medicine. Oxford: John Wiley & Sons; 2008. [8] Karkos P, et al. Spirulina in clinical practice: evidencebased human applications. Evid Based Complement Altern Med 2011;2011(1):1—4. [9] Belay A, et al. Current knowledge on potential health benefits of Spirulina. J Appl Phycol 1993;5(2):235—41. [10] Sandhu J, Shenoy S. Efficacy of spirulina supplementation on isometric strength and isometric endurance of quadriceps in trained and untrained individuals — a comparative study. Ibnosina J Med Biomed Sci 2009;2(2):79—86. [11] Voltarelli F, et al. Nutrition recovery with Spirulina diet improves body growth and muscle protein ofprotein-restricted rats. Int J Nutr Metab 2011;3(3):22—30. [12] Duan M, et al. Determination of micro-elements in natural spirulina using FAAS. Guang pu xue yu guang pu fen xi = Guang pu 2001;21(6):868—70. [13] Lyon RC, et al. Mechanotransduction in cardiac hypertrophy and failure. Circ Res 2015;116(8):1462—76. [14] Liu P, et al. Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov 2009;8(8):627—44.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
7
[15] Wackerhage H, editor. Molecular exercise physiology: an introduction. Routledge; 2014. [16] Leevers SJ. Growth control: invertebrate insulin surprises! Curr Biol 2001;11(6):R209—12. [17] Scheid MP, Woodgett JR. Unravelling the activation mechanisms of protein kinase B/Akt. FEBS Lett 2003;546(1):108—12. [18] Bernardo BC, et al. Molecular distinction between physiological and pathological cardiac hypertrophy: experimental findings and therapeutic strategies. Pharmacol Ther 2010;128(1):191—227. [19] Zhang D, et al. MTORC1 regulates cardiac function and myocyte survival through 4E-BP1 inhibition in mice. J Clin Invest 2010;120(8):2805—16. [20] Wilkinson SB, et al. Differential effects of resistance and endurance exercise in the fed state on signaling molecule phosphorylation and protein synthesis in human muscle. J Physiol 2008;586(15):3701—17. [21] Burd NA, et al. Low-load high volume resistance exercise stimulates muscle protein synthesis more than high-load low volume resistance exercise in young men. PloS One 2010; 5(8):e12033. [22] Walsh K. Akt signaling and growth of the heart. Am Heart Assoc 2006;113:2032—4. [23] Dehghan F, et al. Saffron with resistance exercise improves diabetic parameters through the GLUT4/AMPK pathway in-vitro and in-vivo. Sci Rep 2016;6:25139. [24] Liping L, et al. Spirulina platensis extract supplementation attenuates oxidative stress in acute exhaustive exercise: a pilot study. Int J Phys Sci 2011;6(12):2901—6. [25] Weeks KL, et al. Phosphoinositide 3-kinase p110␣ is a master regulator of exercise-induced cardioprotection and PI3K gene therapy rescues cardiac dysfunction. Circulation: Heart Failure 2012;5(4):523—34. [26] McMullen JR, et al. Phosphoinositide 3-kinase (p110␣) plays a critical role in the induction of physiological, but not pathological, cardiac hypertrophy. Proc Natl Acad Sci U S A 2003;100(21):12355—60. [27] Shioi T, et al. Rapamycin attenuates load-induced cardiac hypertrophy in mice. Circulation 2003;107(12):1664—70. [28] Lollo P, et al. L-Leucine supplemented whey protein. Doseresponse effect on heart mTOR activation of sedentary and trained rats. Food Res Int 2013;53(1):543—50. [29] Kim Y-K, et al. Mechanism of enhanced cardiac function in mice with hypertrophy induced by overexpressed Akt. J Biol Chem 2003;278(48):47622—8. [30] Catalucci D, et al. Akt regulates L-type Ca2+ channel activity by modulating Cav␣1 protein stability. J Cell Biol 2009;184(6):923—33. [31] Vinciguerra M, et al. Local IGF-1 isoform protects cardiomyocytes from hypertrophic and oxidative stresses via SirT1 activity. Aging (Albany NY) 2010;2(1):43. [32] Kemi OJ, et al. Activation or inactivation of cardiac Akt/mTOR signaling diverges physiological from pathological hypertrophy. J Cell Physiol 2008;214(2):316—21. [33] Shioi T, et al. Akt/protein kinase B promotes organ growth in transgenic mice. Mol Cell Biol 2002;22(8):2799—809. [34] Shiojima I, et al. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest 2005;115(8):2108—18. [35] McMullen JR, et al. Inhibition of mTOR signaling with rapamycin regresses established cardiac hypertrophy induced by pressure overload. Circulation 2004;109(24):3050—5. [36] Pallafacchina G, et al. A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification. Proc Natl Acad Sci U S A 2002;99(14):9213—8. [37] Dreyer HC, et al. Leucine-enriched essential amino acid and carbohydrate ingestion following resistance exercise enhances
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),
+Model SCISPO-3352; No. of Pages 8
ARTICLE IN PRESS
8
F. Ahmadi et al.
[38]
[39]
[40]
[41]
[42]
[43]
mTOR signaling and protein synthesis in human muscle. Am J Physiol Endocrinol Metab 2008;294(2):E392—400. Biology G, et al. Insulin action on muscle protein kinetics and amino acid transport during recovery after resistance exercise. Diabetes 1999;48(5):949—57. Børsheim E, et al. Effect of carbohydrate intake on net muscle protein synthesis during recovery from resistance exercise. J Appl Physiol 2004;96(2):674—8. Drummond MJ, et al. Rapamycin administration in humans blocks the contraction-induced increase in skeletal muscle protein synthesis. J Physiol 2009;587(7):1535—46. Kemi OJ, et al. Phosphorylation of regulatory proteins CaMK, PLN, and AKT precedes cardiomyocyte adaptation to exercise training. J Mol Cell Cardiol 2006;40(6):1006. Sengupta S, Peterson TR, Sabatini DM. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol Cell 2010;40(2):310—22. Drummond MJ, et al. Nutritional and contractile regulation of human skeletal muscle protein synthesis and mTORC1 signaling. J Appl Physiol 2009;106(4):1374—84.
Please cite this article in press as: Ahmadi F, ulina platensis on PI3K/Akt/mTOR/p70S6k signaling https://doi.org/10.1016/j.scispo.2019.06.003
[44] Wang X, Proud CG. The mTOR pathway in the control of protein synthesis. Physiology 2006;21(5):362—9. [45] Atherton PJ, et al. Muscle full effect after oral protein: time-dependent concordance and discordance between human muscle protein synthesis and mTORC1 signaling. Am J Clin Nutr 2010;92(5):1080—8. [46] Ma Z, et al. Swimming exercise training-induced left ventricular hypertrophy involves microRNAs and synergistic regulation of the PI3K/AKT/mTOR signaling pathway. Eur J Appl Physiol 2013;113(10):2473—86. [47] Sanchez Canedo C, et al. Activation of the cardiac mTOR/p70S6K pathway by leucine requires PDK1 and correlates with PRAS40 phosphorylation. Am J Physiol Endocrinol Metab 2010;298(4):E761—9. [48] Nakamura M, Sadoshima J. Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol 2018;15(7):387—407. [49] Gold JI, et al. Determining the absolute requirement of G protein-coupled receptor kinase 5 for pathological cardiac hypertrophy. Circ Res 2012;111(8):1048—53.
et al. Effect of resistance pathway in cardiac muscle.
training with SpirSci sports (2019),