- Email: [email protected]
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
Journal of Integrative Agriculture
December 2012
2012, 11(12): 2043-2050
RESEARCH ARTICLE
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells TONG Jin-jin, LI Ye, LIU Rong, GAO Xue-jun and LI Qing-zhang Key Laboratory of Dairy Science, Ministry of Education/College of Life Science, Northeast Agricultural University, Harbin 150030, P.R. China
Abstract The aim of this study is to reveal the regulation mechanism of the effect of Semen vaccariae and Taraxacu mogono on the cell-cell adhersion molecule, E-cadherin and b-catenin on the proliferation role and secretion function of bovine mammary epithelial cells cultured in vitro. Firstly, the epithelial character of bovine mammary epithelial cells was authenticated using immunofluorescence, then the cell grow curve was observed and investigated after S. vaccariae and T. mogono treatment. On the effect of S. vaccariae and T. mogono, cell adhesion molecules E-cadherin, b-catenin and CycinD1 mRNA and protein were detected by qRT-PCR and Western blotting, respectively. The results showed that the cellular keratin 18 expressed positively and proliferated vigorously after S. vaccariae and T. mogono treament. The mRNA and protein levels of E-cadherin and CycinD1 were remarkably higher (P<0.05) in 36 h after S. vaccariae and T. mogono treatment. The cell proliferation at 36 h was increased significantly (P<0.05). In conclusion, S. vaccariae and T. mogono have a positive impact on the cell proliferation and an effect on the adhesion molecules E-cadherin, b-catenin and CycinD1 in the Wnt signaling pathway. Key words: E-cadherin, b-catenin, Semen vaccariae, Taraxacu mogono, bovine, mammary epithelial cells
INTRODUCTION The cadherin family of transmembrane glycoprotein is calcium-dependent intercellular adhesion molecules, mediating homotypic cell-cell adhesion, including E-, P-, N-cadherin. E-cadherin is the major cadherin participanting in epithelial cellular adhesion, and plays an important role in establishing and maintaining intercellular connections and morphogenesis (Lapyckyj et al. 2010). This transmembrane glycoprotein has an extra-cellular domain (N terminal) that binds with high specificity to similar domains on adjacent cells, and an intracellular domain (C terminal) that binds to cytoskeleton proteins through catenins (Hirohashi and Kanai Received 27 June, 2011
2003). The mammary gland undergoes several processes of puberty, pregnancy, lactation, and subsequent involution, which depending on complex signaling mechanism is controlled by cell-cell and cell-matrix adhesion molecules. This procedure not only activates some signaling mechanisms but also has an impact on cell proliferation, survival, and differentiation thoughout lactation (Morrison and Cutler 2010). The canonical Wnt signaling pathway is important for early embryonic mammary gland development and differentiation of mammary epithelium (Boras-Granic et al. 2006). Recent studies showed that cadherin with b-catenin plays a part in the Wnt signaling pathway, including activation of CycinD1 and cell proliferation. This was proven
Accepted 12 August, 2011
TONG Jin-jin, E-mail: [email protected]; Correspondence LI Qing-zhang, E-mail: [email protected]
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2044
on a conjunctival epithelial cell line (Dowgiert et al. 2004). Similarly, a recently published study indicated a significant down-regulation in the expression of cell adhesion proteins b-catenin and E-cadherin along with a significant up-regulation of CycinD1 in the keratocystic odontogenic tumor (KCOT) (Hakim et al. 2011). CycinD1 expression stands for cell cycle progression past the restriction point in G1 into S phase. The previous studies demonstrated that CycinD1 gene expression is significantly higher during pregnancy than during lactation supporting mammary development during late pregnancy (Nørgaard et al. 2008). Semen vaccariae and Taraxacu mogono are traditional herbs described in Compendium of Materia Medica, and their functions are to promote lactation, as well as being herbaceous perennial antipyretic detoxicate. Recent studies by Qin et al. (2008) suggested that the dibutyl phthalate (DBP) separated from S. vaccariae and added to the bovine and mouse mammary glands, can stimulate different levels of expression of relevant genes Stat5 and b-casein in addition to promoting the production of lactation. Wan et al. (2010) added S. vaccariae and prolactin (PRL) at different times, and detected changes in the expression of microRNAs in the mammary gland epithelial cells, they also suggested that the concentration of 0.5 mg mL -1 was most effective. However, little investigation of S. vaccariae and T. mogono on cell adhesion of bovine mammary epithelial cells has been conducted. In this study, the aim is to investigate the expression of E-cadherin and related proteins b-catenin and CycinD1. Furthermore, their relationship in the Wnt signaling pathway after using S. vaccariae and T. mogono, was detected by immunofluorescence methods, qRT-PCR and Western blotting.
TONG Jin-jin et al.
continuous removal of fibroblastic cells and subculturing gave us purified bovine mammary epithelial cells (Fig. 1-C). After several subculturing, the cells grew to confluency, formed a monolayer and aggregated with the properties of the cobble-stone morphology of epithelial cells (Fig. 1-D).
Immunofluorescence and confocal microscopy analysis The result of immunofluorescence detected the marker of the bovine mammary epithelial cells, keratin 18, was positive (Fig. 2).
Analysis of gene expression of qRT-PCR The comparison with the effect of S. vaccariae and T. mogono on E-cadherin, b-catenin and CycinD1 mRNA levels is shown in Fig. 3. From the Fig. 3-A, we can know that, E-cadherin mRNA level was gradually decrease after S. vaccariae and T. mogono treatment from 6 to 24 h, respectively. Notably, E-cadherin mRNA level was remarkably high at 36 h after treatment, and lower at 48 h. As described in Fig. 3B, b-catenin mRNA level after treatment with both S. vaccariae and T. mogono slightly increased at 12 h, then decreased at 24 h. At 36 h, after S. vaccariae and T. mogono treatment the level of b-catenin markedly decreased, moreover, after treatment with both
RESULTS Morphology of bovine mammary epithelial cells The bovine mammary epithelial cells were cultivated from tissue clumps to being digested from the plate by trypsin and EDTA. After 6 to 10 d fibroblasts grew surrounding the tissue clumps (Fig. 1-A), then the bovine mammary epithelial cells emerged (Fig. 1-B), and
Fig. 1 Representative photographs of the bovine mammary epithelial cells. A, 6 d later, fibroblasts scratch from the mammary tissue clump, 40×. B, the bovine mammary epithelial cells emerged, 100×. C, some of the cells were elongated, 100×. D, the bovine mammary epithelial cells were round and flat, 100×.
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
2045
Fig. 2 Immunofluorescence test of the bovine mammary epithelial cells. The keratin 18 was green, the nucleolus was red.
creased continually. At 48 h, CycinD1 level with S. vaccariae and T. mogono were nearly the same. All mRNA changes were remarkable at 36 h after S. vaccariae and T. mogono treatment.
Western blotting From Fig. 4, the expression of E-cadherin, b-catenin and CycinD1 protein in mammary epithelial cells after S. vaccariae and T. mogono treament were determined by Western blotting. GAPDH was used as an internal control, and the statistical results of E-cadherin, b-catenin and CycinD1 protein were analysed by the Bandscan 5.0 software. The results showed that all protein changes were remarkable at 36 h after S. vaccariae and T. mogono treatment.
Cell proliferation From Fig. 5 we can get the growth curves of cell proliferation after S. vaccariae and T. mogono treatment, and it can be seen that at 36 h the cell proliferation is to the maximum. Fig. 3 E-cadherin (A), b-catenin (B) and CycinDl (C) mRNA levels with the effect of S. vaccariae and T. mogono changing tendency during 48 h. Data were expressed as means±standard deviation (SD) from three individual experiments. Different letters differed at P<0.05. The same as in Fig. 4.
S. vaccariae and T. mogono was slightly increased at 48 h. From the Fig. 3-C, we can note that the CycinD1 level after S. vaccariae treatment significantly increased at 36 h. At 6 and 12 h, both decreased. After 24 h, CycinD1 level with T. mogono treatment de-
DISCUSSION A relationship between E-cadherin, b-catenin and CycinD1 expression was observed in bovine mammary epithelial cells in this study, corroborating previous descriptions of co-expression of these adhesion molecules after S. vaccariae and T. mogono treatment. In an analusis of E-cadherin, b-catenin and CycinD1 gene
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2046
TONG Jin-jin et al.
Fig. 5 Changes of proliferation after effect of S. vaccariae and T. mogono on mammary epithelial cells, the growth curves gradually increased, at 36 h was the highest. Cell proliferation was measured using a microplate reader. Results presented mean of triplicate experiments±SEM.
Fig. 4 A, Expression of E-cadherin, b-catenin and CycinD1 protein in mammary epithelial cells after S. vaccariae and T. mogono treatment for 36 h. 1, control group; 2, S. vaccariae group; 3, T. mogono group. B-D, relative expression quantity of E-cadherin (B), b-catenin (C) and CycinD1 (D) protein levels with the effect of S. vaccariae and T. mogono changing tendency after 36 h.
expression, the mRNA level at 36 h was changed remarkably. When the E-cadherin degraded, it caused b-catenin upgrade, then induced the CycinD1 rising. It is important to note that E-cadherin, b-catenin and CycinD1 play an important role in the Wnt signaling pathway. This result agrees with previous observations reporting that E-cadherin/b-catenin cell adhesion complex formation and decreases Wnt-induced cyto-
solic and nuclear b-catenin accumulation and transcription of proliferation-associated CycinD1 (Su and Simmen 2009). This finding that is consistent with the Wnt signaling pathway is a key event in normal mammary gland development (Chu et al. 2004). The Wnt signaling pathway is activated in a subset of epithelial cells accompanying initial branch formation, but its functional significance is not yet known. In an analysis of protein expression by Western blotting, we have found that E-cadherin expression was associated with bcatenin. Our results indicate as the E-cadherin protein decreased, b-catenin was upgraded. We can presume that E-cadherin decrease caused b-catenin accumulation in the nucleus, activating the downstream target gene CycinD1 of the Wnt signaling pathway, resulting in a rise in CycinD1 protein level. Previous papers report that during embryogenesis the Wnt signaling pathway, defined by nuclear accumulation of b-catenin, was demonstrated to promote invasive trophoblast differentiation, and it was suggested that activation of the signaling cascade contributed to trophoblastic hyperplasia and local invasion (Schmalhofer et al. 2009; Zhang et al. 2011). It is currently not clear whether this reflects a relatively later requirement for the Wnt signaling pathway in mammary development (Horsley 2009; Heuberger and Birchmeier 2009). Nevertheless, little is known about the role of the Wnt signaling pathway in the normal mammary gland with S. vaccariae and T. mogono treatment particularly regarding the related down-stream protein CycinD1 and the formation on the cell membrane of regulator b-catenin and its adhesion co-element E-cadherin. Therefore, it is important to identify the molecular
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
mechanisms that control the expression of adhesion p r o t e i n s i n t h e n o r ma l ma mm a r y gl a n d a f t e r S. vaccariae and T. mogono treatment. In agreement with our data, the Wnt signaling pathway may be an important factor in the acquisition and maintenance of basal phenotype in normal tissue and in disease (Faraldo 2007). This study is the first to address the Wnt signaling and related adhesion proteins in the normal mammary gland after S. vaccariae and T. mogono treatment. Further, as previously reported b-catenin signaling appears to be necessary for lobulo-alveolar development (Rudolph et al. 2003). Recent studies suggested that bcatenin regulates the cadherin function together with bcatenin, aberrant expression of b-catenin and cadherin leads in turn to decreased cell-cell adhesion and disruption of tissue morphogenesis, which is correlated with neoplastic cell invasion (Hakim et al. 2011; Zeljko et al. 2011). It is important to note that alterations in any component may lead to affected function of adhesion complexes. In our research, adding S. vaccariae and T. mogono caused the E-cadherin, b-catenin and CycinD1 components to change, corresponding with the mRNA and protein levels change. As reported in previous studies of E-cadherin/b-catenin combinations, it was suggested that the loss or reduction of at least one of these molecules was associated with less differentiation (Kuphal and Behrens 2006). The other important component of the Wnt signaling pathway investigated in our study was the CycinD1 gene. Studies have previously analyzed CycinD1 as a b-catenin-dependent gene that plays a critical role in breast carcinogenesis (Yang et al. 2010). In this study, S. vaccariae and T. mogono treatment markedly increased the expression levels of the Wnt downstream target CycinD1 in a time-dependent manner, being particularly high at 36 h. It is possible that the promoting effects of S. vaccariae and T. mogono are due to an increase of CycinD1 expression. Furthermore, other studies suggested that CycinD1 gene expression was higher during pregnancy than during lactation supporting mammary development during late pregnancy (Nørgaard et al. 2008). Considering the results presented, a new approach can be postulated to understand the possible role of the Wnt signaling pathway and subsequent alteration of cellcell adhesion in the development of bovine mammary
2047
epithelial cells after S. vaccariae and T. mogono treatment. Furthermore, we suggest that modulation of the Wnt signaling pathway may be one of the mechanisms implicated in suppression of cell proliferation in bovine mammary epithelial cells by S. vaccariae and T. mogono treatment. We showed that S. vaccariae and T. mogono can promote cell proliferation respectively. These results are consistent with previous reports demonstrating that S. vaccariae and T. mogono affect cell proliferation to different degrees in various mammary epithelial cells (Qin et al. 2008). However, future studies are needed with a larger series and a longer follow up to investigate these adhere molecules interrelationships and correlate them with the effect of lactation function of the cells in the normal mammary gland. Further work is required to determine whether E-cadherin/b-catenin complex molecules can contribute to the activation of the lactation machanism by b-catenin.
CONCLUSION In conclusion, E-cadherin and b-catenin have a significant effect on mammary development and cell proliferation after S. vaccariae and T. mogono treament. Ecadherin and b-catenin have an effect in the Wnt signaling pathway. We are also able to confirm that the expression of adhesion molecules was associated with CycinD1 that plays a critical role in normal mammary gland development.
MATERIALS AND METHODS Reagent and media preparation The cell culture medium was composed of DMEM/F12 (Invitrogen, Carlsbad, CA, USA), 15% fetal calf serum (Invitrogen, Carlsbad, CA, USA), 5 µg mL-1 hydrocortisone (Sigma-Aldrich, Bangalore, India), 5 µg mL-1 insulin (Sigma-Aldrich, Bangalore, India), 100 IU mL-1 penicillin and 100 IU mL-1 streptomycin (Invitrogen, Carlsbad, CA, USA). The D-Hanks’ medium was composed of 8.00 g L-1 NaCl, 0.40 g L-1 KCl, 0.086 g L-1 Na2HPO4, 0.060 g L-1 KH2PO4 , and 0.35 g L-1 NaHCO3. The cells digestive medium consists of D-Hanks’ medium, 0.15% trypsin and 0.02% ethylene diamine tetraacetic acid. The D-Hanks’ medium containing 0.25% trypsin was used to digest the fibroblast cells. When the cells were digested the cell culture me-
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2048
dium added for termination. S. vaccariae and T. mogono were purchased from the medicamentarius, the concentration was 0.5 mg mL-1 after decoctions respectively.
Cultivation bovine mammary epithelial cells Bovine mammary gland tissue clumps was obtained from lactating Holstein after parturition, its condition was well for lactation efficiency and physiological functions, according to a protocol approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University, USA. The tissue was acquired in compliance with Northeast Agricultural University, China. The tissue dipping in 75% alcohol for 2 min, in order to sterilize; then in superclean bench using the culture medium to wash the tissue for three times. The 0.5-1 cm3 sample of mammary gland tissue was minced into 1 mm3 pieces using surgical scissors and the tissue pieces were put into culture plate coated with 0.1% collagen (Sigma-Aldrich, Bangalore, India), added the culture medium to 2.5 mL, then incubated under 37°C in a humidified atmosphere containing 5% CO2 for 48 h. When the monolayer cells was full of the culture plate, the D-Hanks’ medium contain 0.25% trypsin was used to digest the fibroblast cells, for the cells difference of sensitivity. The cells were digested under 37°C and monitored under microscope. When the cells had retraction away from the culture plate (most of the cells were fibroblasts), added the cell culture medium for termination, and collected the digestive medium to discard. The cells digestive medium composed of 0.15% trypsin and 0.02% ethylene diamine tetraacetic acid were continued to digest for 5 min, then the culture medium were used for termination. The cells were pipetted again and again until all the cells were run away from the bottom of the plate and separated into single cell. The medium containing the cells was collected and centrifuged at 1 000 r/min for 5 min under room temperature. Then the supernatant was removed and the cell pellet was resuspended with fresh cells culture medium to the concentration about 5×10 6 cells mL-1. Thus, most of the collected cells were mammary epithelial cells (MECs). Then cells were transferred into a new culture plate incubated under 37°C in a humidified atmosphere containing 5% CO2. The cells were purified continuously using the same method until the purified MECs were obtained, and then the purified MECs were identified using the antibodies keratin 18 that was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Identified the keratin 18 of bovine mammary epithelial cells Cells grew on glass coverslips nearly 80%, fixed with methanol at room temperature for 30 min, washed thoroughly with TBSTx (Tris-buffered saline with 1‰ Triton X-100,
TONG Jin-jin et al.
0.1 mol L-1, pH 7.4). Then blocking with 5% BSA in TBS for 1 h and incubated with keratin 18 antibody at 4°C overnight, and stained with FITC-conjugated secondary antibody (diluted 1:200 in TBSTx) for 1 h. The nuclei of mammary epithelial cell was stained PI for 15 min at room temperature. The coverslip was mounted under antifade mounting medium (Beyotime, Shanghai, China). Confocal microscopic images of the MECs were captured by the Z-stacking function for serial confocal sectioning at 2 µm intervals (Leica TCS SP2, Germany) and then analyzed by leica software. The experiments were conducted in triplicate.
Total RNA extraction Total RNA was extracted from cell plate using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s protocol and dissoluted with RNasefree water. The RNA was quantified by spectrophotometer and the quality was tested on an Agilent (Palo Alto, CA, USA) bioanalyser. The isolated RNA has an OD260/OD280 ratio of 1.8-2.0 when diluted into RNase-free water.
qRT-PCR The cells treated with S. vaccariae and T. mogono dilution in 0.5 mg mL-1 on plate incubated under 37°C in a humidified atmosphere containing 5% CO 2 , cells without S. vaccariae and T. mogono were as the negative control. Then the RNA extracted at 0, 6, 12, 24, 36, and 48 h. Synthesis of cDNA was performed by using PrimeScript® RT Reagent Kit (TaKaRa, Dalian, China) according to manufacturer’s instructions. Quantification of cDNA was performed by use SYBR® Premix Ex TaqTM (TaKaRa, Dalian, China) of real-time PCR on an ABI Prism 7500 SDS (Applied Biosystems, USA) as described by the manufacturer. All primers were designed using Primer Premier 5.0 (Table).
Western blotting The cells treated with S. vaccariae and T. mogono dilution in 0.5 mg mL-1 on six plates incubated under 37°C in a humidified atmosphere containing 5% CO 2 for 36 h respectively, cells without S. vaccariae and T. mogono were as the negative control. Cells grew nearly 80% and protein was extracted with RIPE (Beyotime, Shanghai, China) homogenized and lysed in RIPE buffer 100 µL mL-1 to the plate and 2 µL mL-1 protease inhibitor cocktail (SigmaAldrich, Bangalore, India) respectively. Protein concentrations were determined by Bradford reagent (SigmaAldrich, Bangalore, India). The protein were separated by 12% SDS-PAGE and transferred to the nitrocellulose membranes (Amersham, Freiburg, Germany). After blocking
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
2049
Table Gene names, accession numbers, primers used in real-time PCR Gene E-cadherin b-Catenin CycinD1 GAPDH
Accession no. NM_001002763 NM_001076141 NM_001046273 AB098934
Forward primer (5´
3´)
Reverse primer (5´
CGTATCGGATTTGGAGGGAC CCAAGTGGGTGGCATAGAGG GGACCGCTTCCTGTCGCT TGCTGGTGCTGAGTATGTGGT
with 5% non-fat milk in Tris-buffered saline (TBS, 0.1 mol L-1, pH 7.4) for 90 min then incubated with respective antibodies at 4°C overnight. The antibodies used were Ecadherin (Santa Cruz, CA, USA), dilution 1:200; b-catenin (Santa Cruz, CA, USA), dilution 1:200; Cycin D1 (Santa Cruz, CA, USA), dilution 1:200; GAPDH (Santa Cruz, CA, USA), dilution 1:200. The flowing step to wash the membranes used the TBST (1‰ TBS with Tween-20) for 5 min thrice, membranes were incubated with secondary antibody, HRP-conjugated goat anti-mouse IgG-HRP (Santa Cruz, CA, USA); goat anti-rabbit IgG-HRP (Santa Cruz, CA, USA), donkey anti-goat IgG-HRP (Santa Cruz, CA, USA), diluted at an appropriate dilution in 5% non-fat milk in TBS, for 2 h at room temperature. After each step finished, membranes were washed thrice with TBST for 5 min each time. Protein bands were detected by enhanced chemiluminescence method (ECL, Santa Cruz, CA, USA) on XRAY film (Kodak, Shanghai, China).
Cell proliferation Cells grew on 96 microplate separated to three groups, S. vaccariae, T. mogono dilution in 0.5 mg mL-1, cells without S. vaccariae and T. mogono were as the negative control, then incubated under 37°C in a humidified atmosphere containing 5% CO2 for 0, 12, 24, 36, and 48 h till the cell concentration 2×104/well in a final volume of 100 µL/ well culture medium. 10 µL/well cell proliferation reagent WST-1 (Roche, Sweden) added. The cells were incubate for 4 h under 37°C in a humidified atmosphere containing 5% CO 2 , and shaked throughly for 1 min on a shaker. Measure the absorbance of the samples against a background control as blank using a microplate reader. The wavelength for measuring the absorbance of the formazan product is 450 nm. The reference wavelength should be more than 600 nm.
Statistical analysis Comparisons of the differences between S. vaccariae and T. mogono treatment and control, we examined the association between E-cadherin expression, b-catenin and CycinD1 using SPSS 16.0 software. S. vaccariae and T. mogono treatment and control mRNA was subjected to two-way measures ANOVA with genotype as a fixed factor. Data for different time points (0, 6, 12, 24, 36, and 48 h) for cell proliferation was subjected to evaluate us-
3´)
CATCATCGAGGAACAAGAGCAG GGCTGGTCAGATGACGAAGG GCCAGGTTCCACTTGAGTTTGT AGTCTTCTGGGTGGCAGTGAT
ing the analysis of repeated measures ANOVA. For protein intensity, using the Bandscan 5.0 software, the data were subjected to one-way repeated measures ANOVA for 36 h with genotype as a fixed factor. Data are expressed as mean±SEM.
Acknowledgements This study was financially supported by the National Basic Research Program of China (2011CB100804).
References Arduino P G, Carrozzo M, Pagano M, Broccoletti R, Scully C, Gandolfo S. 2009. Immunohistochemical expression of basement membrane proteins of verrucous carcinoma of the oral mucosa. Clinical Oral Investigations, 14, 297-302. Boras-Granic K, Chang H, Grosschedl R, Hamel P A. 2006. Lef1 is required for the transition of Wnt signaling from mesenchymal to epithelial cells in the mouse embryonic mammary gland. Developmental Biology, 295, 219-231. Chu E Y, Hens J, Andl T, Kairo A, Yamaguchi T, Brisken C, Glick A, Wysolmerski J, Millar S E. 2004. Canonical WNT signaling promotes mammary placode development and i s e s s e n t i a l f o r i n i t ia t i o n o f ma mma ry gl a n d morphogenesis. Development, 131, 4819-4829. Dowgiert J, Sosne G, Kurpakus-Wheater M. 2004. Laminin2 stimulates the proliferation of epithelial cells in a conjunctival epithelial cell line. Cell Proliferation, 37, 161-175. Faraldo M M, Teulière J, Deugnier M A, Birchmeier W, Huelsken J, Thiery J P, Cano A, Glukhova M A. 2007. Beta-catenin regulates P-cadherin expression in mammary basal epithelial cells. FEBS Letters, 581, 831836. Hakim S G, Kosmehl H, Sieg P, Trenkle T, Jacobsen H C, Benedek G A, Ribbat J, Driemel O. 2011. Altered expression of cell-cell adhesion molecules b-catenin/Ecadherin and related Wnt-signaling pathway in sporadic and syndromal keratocystic odontogenic tumors. Clinical Oral Investigations, 15, 321-328. Heuberger J, Birchmeier W. 2009. Interplay of cadherinmediated cell adhesion and canonical Wnt signaling. Cold Spring Harb Perspect in Biology. [2011-07-19]. http://cshperspectives.cshlp.org/content/2/2/a002915. (abstract) Hirohashi S, Kanai Y. 2003. Cell adhesion system and human cancer morphogenesis. Cancer Science, 94, 575-581.
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2050
Horsley V. 2009. Epigenetics, Wnt signaling, and stem cells: the Pygo2 connection. The Journal of Cell Biology, 185, 761-763. Kuphal F, Behrens J. 2006. E-cadherin modulates Wntdependent transcription in colorectal cancer cells but does not alter Wnt-independent gene expression in fibroblasts. Experimental Cell Research, 312, 457-467. Lapyckyj L, Castillo L F, Matos M L, Gabrielli N M, Lüthy I A, Vazquez-Levin M H. 2010. Expression analysis of epithelial cadherin and related proteins in IBH-6 and IBH-4 human breast cancer cell lines. Journal of Cellular Physiology, 3, 596-605. Morrison B, Cutler M L. 2010. The contribution of adhesion signaling to lactogenesis. Journal of Cell Communicatio and Signaling, 4, 131-139. Nørgaard J V, Nielsen M O, Theil P K, Sørensen M T, Safayi S, Sejrsen K. 2008. Development of mammary glands of fat sheep submitted to restricted feeding during late pregnancy. Small Ruminant Research, 76, 155-165. Qin J, LI Q Z, Gao X J. 2008. Effect of main components from semen vaccariae on multiplication and expression of beta-casein of mouse mammary epithelial cell in vitro. Scientia Agricultura Sinica, 8, 2442-2447. (in Chinese) Rudolph M C, McManaman J L, Hunter L, Phang T, Neville MC. 2003. Functional development of the mammary gland: use of expression profiling and trajectory clustering to reveal changes in gene expression during pregnancy, lactation, and involution. Journal of Mammary Gland Biology and Neoplasia, 8, 287-307.
TONG Jin-jin et al.
Schmalhofer O, Brabletz S, Brabletz T. 2009. E-cadherin, bcatenin, and ZEB1 in malignant progression of cancer. Cancer Metastasis Reviews, 28, 151-166. Su Y, Shankar K, Rahal O, Simmen R C. 2011. Bidirectional signaling of mammary epithelium and stroma: implications for breast cancer-preventive actions of dietary factors. Journal of Nutritional Biochemistry, 22, 605-611. Su Y, Simmen R C. 2009. Soy isoflavone genistein upregulates epithelial adhesion molecule E-cadherin expression and attenuates beta-catenin signaling in mammary epithelial cells. Carcinogenesis, 30, 331-339, Wan Z Y, Tong H L, Li Q Z, Gao X J. 2010. Influence on the specific micrornas in bovine mammary gland epithelial cells by semen vaccariae active monomer and prolactin. China Animal Husbandry and Veterinary Medicine, 8, 230-232. Yang L J, Liu Y Q, Gu B, Bian X C, Feng H L, Yang Z L, Liu Y Y. 2010. Effect of forced E-cadherin expression on adhesion and proliferation of human breast carcinoma cells. Chinese Journal of Pathology, 12, 842-847. (in Chinese) Zeljko M, Pecina-Slaus N, Martic T N, Kusec V, Beros V, Tomas D. 2011. Molecular alterations of E-cadherin and beta-catenin in brain metastases. Fronti ers in Bioscience, 3, 616-624. Zhang Y H, Yan W S, Chen X B. 2011. Mutant p53 disrupts MCF-10A cell polarity in three-dimensional culture via epithelial-to-mesenchymal transitions. Journal of Biological Chemistry, 286, 16218-16228. (Managing editor ZHANG Juan)
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
December 2012
2012, 11(12): 2043-2050
RESEARCH ARTICLE
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells TONG Jin-jin, LI Ye, LIU Rong, GAO Xue-jun and LI Qing-zhang Key Laboratory of Dairy Science, Ministry of Education/College of Life Science, Northeast Agricultural University, Harbin 150030, P.R. China
Abstract The aim of this study is to reveal the regulation mechanism of the effect of Semen vaccariae and Taraxacu mogono on the cell-cell adhersion molecule, E-cadherin and b-catenin on the proliferation role and secretion function of bovine mammary epithelial cells cultured in vitro. Firstly, the epithelial character of bovine mammary epithelial cells was authenticated using immunofluorescence, then the cell grow curve was observed and investigated after S. vaccariae and T. mogono treatment. On the effect of S. vaccariae and T. mogono, cell adhesion molecules E-cadherin, b-catenin and CycinD1 mRNA and protein were detected by qRT-PCR and Western blotting, respectively. The results showed that the cellular keratin 18 expressed positively and proliferated vigorously after S. vaccariae and T. mogono treament. The mRNA and protein levels of E-cadherin and CycinD1 were remarkably higher (P<0.05) in 36 h after S. vaccariae and T. mogono treatment. The cell proliferation at 36 h was increased significantly (P<0.05). In conclusion, S. vaccariae and T. mogono have a positive impact on the cell proliferation and an effect on the adhesion molecules E-cadherin, b-catenin and CycinD1 in the Wnt signaling pathway. Key words: E-cadherin, b-catenin, Semen vaccariae, Taraxacu mogono, bovine, mammary epithelial cells
INTRODUCTION The cadherin family of transmembrane glycoprotein is calcium-dependent intercellular adhesion molecules, mediating homotypic cell-cell adhesion, including E-, P-, N-cadherin. E-cadherin is the major cadherin participanting in epithelial cellular adhesion, and plays an important role in establishing and maintaining intercellular connections and morphogenesis (Lapyckyj et al. 2010). This transmembrane glycoprotein has an extra-cellular domain (N terminal) that binds with high specificity to similar domains on adjacent cells, and an intracellular domain (C terminal) that binds to cytoskeleton proteins through catenins (Hirohashi and Kanai Received 27 June, 2011
2003). The mammary gland undergoes several processes of puberty, pregnancy, lactation, and subsequent involution, which depending on complex signaling mechanism is controlled by cell-cell and cell-matrix adhesion molecules. This procedure not only activates some signaling mechanisms but also has an impact on cell proliferation, survival, and differentiation thoughout lactation (Morrison and Cutler 2010). The canonical Wnt signaling pathway is important for early embryonic mammary gland development and differentiation of mammary epithelium (Boras-Granic et al. 2006). Recent studies showed that cadherin with b-catenin plays a part in the Wnt signaling pathway, including activation of CycinD1 and cell proliferation. This was proven
Accepted 12 August, 2011
TONG Jin-jin, E-mail: [email protected]; Correspondence LI Qing-zhang, E-mail: [email protected]
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2044
on a conjunctival epithelial cell line (Dowgiert et al. 2004). Similarly, a recently published study indicated a significant down-regulation in the expression of cell adhesion proteins b-catenin and E-cadherin along with a significant up-regulation of CycinD1 in the keratocystic odontogenic tumor (KCOT) (Hakim et al. 2011). CycinD1 expression stands for cell cycle progression past the restriction point in G1 into S phase. The previous studies demonstrated that CycinD1 gene expression is significantly higher during pregnancy than during lactation supporting mammary development during late pregnancy (Nørgaard et al. 2008). Semen vaccariae and Taraxacu mogono are traditional herbs described in Compendium of Materia Medica, and their functions are to promote lactation, as well as being herbaceous perennial antipyretic detoxicate. Recent studies by Qin et al. (2008) suggested that the dibutyl phthalate (DBP) separated from S. vaccariae and added to the bovine and mouse mammary glands, can stimulate different levels of expression of relevant genes Stat5 and b-casein in addition to promoting the production of lactation. Wan et al. (2010) added S. vaccariae and prolactin (PRL) at different times, and detected changes in the expression of microRNAs in the mammary gland epithelial cells, they also suggested that the concentration of 0.5 mg mL -1 was most effective. However, little investigation of S. vaccariae and T. mogono on cell adhesion of bovine mammary epithelial cells has been conducted. In this study, the aim is to investigate the expression of E-cadherin and related proteins b-catenin and CycinD1. Furthermore, their relationship in the Wnt signaling pathway after using S. vaccariae and T. mogono, was detected by immunofluorescence methods, qRT-PCR and Western blotting.
TONG Jin-jin et al.
continuous removal of fibroblastic cells and subculturing gave us purified bovine mammary epithelial cells (Fig. 1-C). After several subculturing, the cells grew to confluency, formed a monolayer and aggregated with the properties of the cobble-stone morphology of epithelial cells (Fig. 1-D).
Immunofluorescence and confocal microscopy analysis The result of immunofluorescence detected the marker of the bovine mammary epithelial cells, keratin 18, was positive (Fig. 2).
Analysis of gene expression of qRT-PCR The comparison with the effect of S. vaccariae and T. mogono on E-cadherin, b-catenin and CycinD1 mRNA levels is shown in Fig. 3. From the Fig. 3-A, we can know that, E-cadherin mRNA level was gradually decrease after S. vaccariae and T. mogono treatment from 6 to 24 h, respectively. Notably, E-cadherin mRNA level was remarkably high at 36 h after treatment, and lower at 48 h. As described in Fig. 3B, b-catenin mRNA level after treatment with both S. vaccariae and T. mogono slightly increased at 12 h, then decreased at 24 h. At 36 h, after S. vaccariae and T. mogono treatment the level of b-catenin markedly decreased, moreover, after treatment with both
RESULTS Morphology of bovine mammary epithelial cells The bovine mammary epithelial cells were cultivated from tissue clumps to being digested from the plate by trypsin and EDTA. After 6 to 10 d fibroblasts grew surrounding the tissue clumps (Fig. 1-A), then the bovine mammary epithelial cells emerged (Fig. 1-B), and
Fig. 1 Representative photographs of the bovine mammary epithelial cells. A, 6 d later, fibroblasts scratch from the mammary tissue clump, 40×. B, the bovine mammary epithelial cells emerged, 100×. C, some of the cells were elongated, 100×. D, the bovine mammary epithelial cells were round and flat, 100×.
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
2045
Fig. 2 Immunofluorescence test of the bovine mammary epithelial cells. The keratin 18 was green, the nucleolus was red.
creased continually. At 48 h, CycinD1 level with S. vaccariae and T. mogono were nearly the same. All mRNA changes were remarkable at 36 h after S. vaccariae and T. mogono treatment.
Western blotting From Fig. 4, the expression of E-cadherin, b-catenin and CycinD1 protein in mammary epithelial cells after S. vaccariae and T. mogono treament were determined by Western blotting. GAPDH was used as an internal control, and the statistical results of E-cadherin, b-catenin and CycinD1 protein were analysed by the Bandscan 5.0 software. The results showed that all protein changes were remarkable at 36 h after S. vaccariae and T. mogono treatment.
Cell proliferation From Fig. 5 we can get the growth curves of cell proliferation after S. vaccariae and T. mogono treatment, and it can be seen that at 36 h the cell proliferation is to the maximum. Fig. 3 E-cadherin (A), b-catenin (B) and CycinDl (C) mRNA levels with the effect of S. vaccariae and T. mogono changing tendency during 48 h. Data were expressed as means±standard deviation (SD) from three individual experiments. Different letters differed at P<0.05. The same as in Fig. 4.
S. vaccariae and T. mogono was slightly increased at 48 h. From the Fig. 3-C, we can note that the CycinD1 level after S. vaccariae treatment significantly increased at 36 h. At 6 and 12 h, both decreased. After 24 h, CycinD1 level with T. mogono treatment de-
DISCUSSION A relationship between E-cadherin, b-catenin and CycinD1 expression was observed in bovine mammary epithelial cells in this study, corroborating previous descriptions of co-expression of these adhesion molecules after S. vaccariae and T. mogono treatment. In an analusis of E-cadherin, b-catenin and CycinD1 gene
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2046
TONG Jin-jin et al.
Fig. 5 Changes of proliferation after effect of S. vaccariae and T. mogono on mammary epithelial cells, the growth curves gradually increased, at 36 h was the highest. Cell proliferation was measured using a microplate reader. Results presented mean of triplicate experiments±SEM.
Fig. 4 A, Expression of E-cadherin, b-catenin and CycinD1 protein in mammary epithelial cells after S. vaccariae and T. mogono treatment for 36 h. 1, control group; 2, S. vaccariae group; 3, T. mogono group. B-D, relative expression quantity of E-cadherin (B), b-catenin (C) and CycinD1 (D) protein levels with the effect of S. vaccariae and T. mogono changing tendency after 36 h.
expression, the mRNA level at 36 h was changed remarkably. When the E-cadherin degraded, it caused b-catenin upgrade, then induced the CycinD1 rising. It is important to note that E-cadherin, b-catenin and CycinD1 play an important role in the Wnt signaling pathway. This result agrees with previous observations reporting that E-cadherin/b-catenin cell adhesion complex formation and decreases Wnt-induced cyto-
solic and nuclear b-catenin accumulation and transcription of proliferation-associated CycinD1 (Su and Simmen 2009). This finding that is consistent with the Wnt signaling pathway is a key event in normal mammary gland development (Chu et al. 2004). The Wnt signaling pathway is activated in a subset of epithelial cells accompanying initial branch formation, but its functional significance is not yet known. In an analysis of protein expression by Western blotting, we have found that E-cadherin expression was associated with bcatenin. Our results indicate as the E-cadherin protein decreased, b-catenin was upgraded. We can presume that E-cadherin decrease caused b-catenin accumulation in the nucleus, activating the downstream target gene CycinD1 of the Wnt signaling pathway, resulting in a rise in CycinD1 protein level. Previous papers report that during embryogenesis the Wnt signaling pathway, defined by nuclear accumulation of b-catenin, was demonstrated to promote invasive trophoblast differentiation, and it was suggested that activation of the signaling cascade contributed to trophoblastic hyperplasia and local invasion (Schmalhofer et al. 2009; Zhang et al. 2011). It is currently not clear whether this reflects a relatively later requirement for the Wnt signaling pathway in mammary development (Horsley 2009; Heuberger and Birchmeier 2009). Nevertheless, little is known about the role of the Wnt signaling pathway in the normal mammary gland with S. vaccariae and T. mogono treatment particularly regarding the related down-stream protein CycinD1 and the formation on the cell membrane of regulator b-catenin and its adhesion co-element E-cadherin. Therefore, it is important to identify the molecular
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
mechanisms that control the expression of adhesion p r o t e i n s i n t h e n o r ma l ma mm a r y gl a n d a f t e r S. vaccariae and T. mogono treatment. In agreement with our data, the Wnt signaling pathway may be an important factor in the acquisition and maintenance of basal phenotype in normal tissue and in disease (Faraldo 2007). This study is the first to address the Wnt signaling and related adhesion proteins in the normal mammary gland after S. vaccariae and T. mogono treatment. Further, as previously reported b-catenin signaling appears to be necessary for lobulo-alveolar development (Rudolph et al. 2003). Recent studies suggested that bcatenin regulates the cadherin function together with bcatenin, aberrant expression of b-catenin and cadherin leads in turn to decreased cell-cell adhesion and disruption of tissue morphogenesis, which is correlated with neoplastic cell invasion (Hakim et al. 2011; Zeljko et al. 2011). It is important to note that alterations in any component may lead to affected function of adhesion complexes. In our research, adding S. vaccariae and T. mogono caused the E-cadherin, b-catenin and CycinD1 components to change, corresponding with the mRNA and protein levels change. As reported in previous studies of E-cadherin/b-catenin combinations, it was suggested that the loss or reduction of at least one of these molecules was associated with less differentiation (Kuphal and Behrens 2006). The other important component of the Wnt signaling pathway investigated in our study was the CycinD1 gene. Studies have previously analyzed CycinD1 as a b-catenin-dependent gene that plays a critical role in breast carcinogenesis (Yang et al. 2010). In this study, S. vaccariae and T. mogono treatment markedly increased the expression levels of the Wnt downstream target CycinD1 in a time-dependent manner, being particularly high at 36 h. It is possible that the promoting effects of S. vaccariae and T. mogono are due to an increase of CycinD1 expression. Furthermore, other studies suggested that CycinD1 gene expression was higher during pregnancy than during lactation supporting mammary development during late pregnancy (Nørgaard et al. 2008). Considering the results presented, a new approach can be postulated to understand the possible role of the Wnt signaling pathway and subsequent alteration of cellcell adhesion in the development of bovine mammary
2047
epithelial cells after S. vaccariae and T. mogono treatment. Furthermore, we suggest that modulation of the Wnt signaling pathway may be one of the mechanisms implicated in suppression of cell proliferation in bovine mammary epithelial cells by S. vaccariae and T. mogono treatment. We showed that S. vaccariae and T. mogono can promote cell proliferation respectively. These results are consistent with previous reports demonstrating that S. vaccariae and T. mogono affect cell proliferation to different degrees in various mammary epithelial cells (Qin et al. 2008). However, future studies are needed with a larger series and a longer follow up to investigate these adhere molecules interrelationships and correlate them with the effect of lactation function of the cells in the normal mammary gland. Further work is required to determine whether E-cadherin/b-catenin complex molecules can contribute to the activation of the lactation machanism by b-catenin.
CONCLUSION In conclusion, E-cadherin and b-catenin have a significant effect on mammary development and cell proliferation after S. vaccariae and T. mogono treament. Ecadherin and b-catenin have an effect in the Wnt signaling pathway. We are also able to confirm that the expression of adhesion molecules was associated with CycinD1 that plays a critical role in normal mammary gland development.
MATERIALS AND METHODS Reagent and media preparation The cell culture medium was composed of DMEM/F12 (Invitrogen, Carlsbad, CA, USA), 15% fetal calf serum (Invitrogen, Carlsbad, CA, USA), 5 µg mL-1 hydrocortisone (Sigma-Aldrich, Bangalore, India), 5 µg mL-1 insulin (Sigma-Aldrich, Bangalore, India), 100 IU mL-1 penicillin and 100 IU mL-1 streptomycin (Invitrogen, Carlsbad, CA, USA). The D-Hanks’ medium was composed of 8.00 g L-1 NaCl, 0.40 g L-1 KCl, 0.086 g L-1 Na2HPO4, 0.060 g L-1 KH2PO4 , and 0.35 g L-1 NaHCO3. The cells digestive medium consists of D-Hanks’ medium, 0.15% trypsin and 0.02% ethylene diamine tetraacetic acid. The D-Hanks’ medium containing 0.25% trypsin was used to digest the fibroblast cells. When the cells were digested the cell culture me-
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2048
dium added for termination. S. vaccariae and T. mogono were purchased from the medicamentarius, the concentration was 0.5 mg mL-1 after decoctions respectively.
Cultivation bovine mammary epithelial cells Bovine mammary gland tissue clumps was obtained from lactating Holstein after parturition, its condition was well for lactation efficiency and physiological functions, according to a protocol approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University, USA. The tissue was acquired in compliance with Northeast Agricultural University, China. The tissue dipping in 75% alcohol for 2 min, in order to sterilize; then in superclean bench using the culture medium to wash the tissue for three times. The 0.5-1 cm3 sample of mammary gland tissue was minced into 1 mm3 pieces using surgical scissors and the tissue pieces were put into culture plate coated with 0.1% collagen (Sigma-Aldrich, Bangalore, India), added the culture medium to 2.5 mL, then incubated under 37°C in a humidified atmosphere containing 5% CO2 for 48 h. When the monolayer cells was full of the culture plate, the D-Hanks’ medium contain 0.25% trypsin was used to digest the fibroblast cells, for the cells difference of sensitivity. The cells were digested under 37°C and monitored under microscope. When the cells had retraction away from the culture plate (most of the cells were fibroblasts), added the cell culture medium for termination, and collected the digestive medium to discard. The cells digestive medium composed of 0.15% trypsin and 0.02% ethylene diamine tetraacetic acid were continued to digest for 5 min, then the culture medium were used for termination. The cells were pipetted again and again until all the cells were run away from the bottom of the plate and separated into single cell. The medium containing the cells was collected and centrifuged at 1 000 r/min for 5 min under room temperature. Then the supernatant was removed and the cell pellet was resuspended with fresh cells culture medium to the concentration about 5×10 6 cells mL-1. Thus, most of the collected cells were mammary epithelial cells (MECs). Then cells were transferred into a new culture plate incubated under 37°C in a humidified atmosphere containing 5% CO2. The cells were purified continuously using the same method until the purified MECs were obtained, and then the purified MECs were identified using the antibodies keratin 18 that was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Identified the keratin 18 of bovine mammary epithelial cells Cells grew on glass coverslips nearly 80%, fixed with methanol at room temperature for 30 min, washed thoroughly with TBSTx (Tris-buffered saline with 1‰ Triton X-100,
TONG Jin-jin et al.
0.1 mol L-1, pH 7.4). Then blocking with 5% BSA in TBS for 1 h and incubated with keratin 18 antibody at 4°C overnight, and stained with FITC-conjugated secondary antibody (diluted 1:200 in TBSTx) for 1 h. The nuclei of mammary epithelial cell was stained PI for 15 min at room temperature. The coverslip was mounted under antifade mounting medium (Beyotime, Shanghai, China). Confocal microscopic images of the MECs were captured by the Z-stacking function for serial confocal sectioning at 2 µm intervals (Leica TCS SP2, Germany) and then analyzed by leica software. The experiments were conducted in triplicate.
Total RNA extraction Total RNA was extracted from cell plate using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s protocol and dissoluted with RNasefree water. The RNA was quantified by spectrophotometer and the quality was tested on an Agilent (Palo Alto, CA, USA) bioanalyser. The isolated RNA has an OD260/OD280 ratio of 1.8-2.0 when diluted into RNase-free water.
qRT-PCR The cells treated with S. vaccariae and T. mogono dilution in 0.5 mg mL-1 on plate incubated under 37°C in a humidified atmosphere containing 5% CO 2 , cells without S. vaccariae and T. mogono were as the negative control. Then the RNA extracted at 0, 6, 12, 24, 36, and 48 h. Synthesis of cDNA was performed by using PrimeScript® RT Reagent Kit (TaKaRa, Dalian, China) according to manufacturer’s instructions. Quantification of cDNA was performed by use SYBR® Premix Ex TaqTM (TaKaRa, Dalian, China) of real-time PCR on an ABI Prism 7500 SDS (Applied Biosystems, USA) as described by the manufacturer. All primers were designed using Primer Premier 5.0 (Table).
Western blotting The cells treated with S. vaccariae and T. mogono dilution in 0.5 mg mL-1 on six plates incubated under 37°C in a humidified atmosphere containing 5% CO 2 for 36 h respectively, cells without S. vaccariae and T. mogono were as the negative control. Cells grew nearly 80% and protein was extracted with RIPE (Beyotime, Shanghai, China) homogenized and lysed in RIPE buffer 100 µL mL-1 to the plate and 2 µL mL-1 protease inhibitor cocktail (SigmaAldrich, Bangalore, India) respectively. Protein concentrations were determined by Bradford reagent (SigmaAldrich, Bangalore, India). The protein were separated by 12% SDS-PAGE and transferred to the nitrocellulose membranes (Amersham, Freiburg, Germany). After blocking
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
Effect of Semen vaccariae and Taraxacu mogono on Cell Adhesion of Bovine Mammary Epithelial Cells
2049
Table Gene names, accession numbers, primers used in real-time PCR Gene E-cadherin b-Catenin CycinD1 GAPDH
Accession no. NM_001002763 NM_001076141 NM_001046273 AB098934
Forward primer (5´
3´)
Reverse primer (5´
CGTATCGGATTTGGAGGGAC CCAAGTGGGTGGCATAGAGG GGACCGCTTCCTGTCGCT TGCTGGTGCTGAGTATGTGGT
with 5% non-fat milk in Tris-buffered saline (TBS, 0.1 mol L-1, pH 7.4) for 90 min then incubated with respective antibodies at 4°C overnight. The antibodies used were Ecadherin (Santa Cruz, CA, USA), dilution 1:200; b-catenin (Santa Cruz, CA, USA), dilution 1:200; Cycin D1 (Santa Cruz, CA, USA), dilution 1:200; GAPDH (Santa Cruz, CA, USA), dilution 1:200. The flowing step to wash the membranes used the TBST (1‰ TBS with Tween-20) for 5 min thrice, membranes were incubated with secondary antibody, HRP-conjugated goat anti-mouse IgG-HRP (Santa Cruz, CA, USA); goat anti-rabbit IgG-HRP (Santa Cruz, CA, USA), donkey anti-goat IgG-HRP (Santa Cruz, CA, USA), diluted at an appropriate dilution in 5% non-fat milk in TBS, for 2 h at room temperature. After each step finished, membranes were washed thrice with TBST for 5 min each time. Protein bands were detected by enhanced chemiluminescence method (ECL, Santa Cruz, CA, USA) on XRAY film (Kodak, Shanghai, China).
Cell proliferation Cells grew on 96 microplate separated to three groups, S. vaccariae, T. mogono dilution in 0.5 mg mL-1, cells without S. vaccariae and T. mogono were as the negative control, then incubated under 37°C in a humidified atmosphere containing 5% CO2 for 0, 12, 24, 36, and 48 h till the cell concentration 2×104/well in a final volume of 100 µL/ well culture medium. 10 µL/well cell proliferation reagent WST-1 (Roche, Sweden) added. The cells were incubate for 4 h under 37°C in a humidified atmosphere containing 5% CO 2 , and shaked throughly for 1 min on a shaker. Measure the absorbance of the samples against a background control as blank using a microplate reader. The wavelength for measuring the absorbance of the formazan product is 450 nm. The reference wavelength should be more than 600 nm.
Statistical analysis Comparisons of the differences between S. vaccariae and T. mogono treatment and control, we examined the association between E-cadherin expression, b-catenin and CycinD1 using SPSS 16.0 software. S. vaccariae and T. mogono treatment and control mRNA was subjected to two-way measures ANOVA with genotype as a fixed factor. Data for different time points (0, 6, 12, 24, 36, and 48 h) for cell proliferation was subjected to evaluate us-
3´)
CATCATCGAGGAACAAGAGCAG GGCTGGTCAGATGACGAAGG GCCAGGTTCCACTTGAGTTTGT AGTCTTCTGGGTGGCAGTGAT
ing the analysis of repeated measures ANOVA. For protein intensity, using the Bandscan 5.0 software, the data were subjected to one-way repeated measures ANOVA for 36 h with genotype as a fixed factor. Data are expressed as mean±SEM.
Acknowledgements This study was financially supported by the National Basic Research Program of China (2011CB100804).
References Arduino P G, Carrozzo M, Pagano M, Broccoletti R, Scully C, Gandolfo S. 2009. Immunohistochemical expression of basement membrane proteins of verrucous carcinoma of the oral mucosa. Clinical Oral Investigations, 14, 297-302. Boras-Granic K, Chang H, Grosschedl R, Hamel P A. 2006. Lef1 is required for the transition of Wnt signaling from mesenchymal to epithelial cells in the mouse embryonic mammary gland. Developmental Biology, 295, 219-231. Chu E Y, Hens J, Andl T, Kairo A, Yamaguchi T, Brisken C, Glick A, Wysolmerski J, Millar S E. 2004. Canonical WNT signaling promotes mammary placode development and i s e s s e n t i a l f o r i n i t ia t i o n o f ma mma ry gl a n d morphogenesis. Development, 131, 4819-4829. Dowgiert J, Sosne G, Kurpakus-Wheater M. 2004. Laminin2 stimulates the proliferation of epithelial cells in a conjunctival epithelial cell line. Cell Proliferation, 37, 161-175. Faraldo M M, Teulière J, Deugnier M A, Birchmeier W, Huelsken J, Thiery J P, Cano A, Glukhova M A. 2007. Beta-catenin regulates P-cadherin expression in mammary basal epithelial cells. FEBS Letters, 581, 831836. Hakim S G, Kosmehl H, Sieg P, Trenkle T, Jacobsen H C, Benedek G A, Ribbat J, Driemel O. 2011. Altered expression of cell-cell adhesion molecules b-catenin/Ecadherin and related Wnt-signaling pathway in sporadic and syndromal keratocystic odontogenic tumors. Clinical Oral Investigations, 15, 321-328. Heuberger J, Birchmeier W. 2009. Interplay of cadherinmediated cell adhesion and canonical Wnt signaling. Cold Spring Harb Perspect in Biology. [2011-07-19]. http://cshperspectives.cshlp.org/content/2/2/a002915. (abstract) Hirohashi S, Kanai Y. 2003. Cell adhesion system and human cancer morphogenesis. Cancer Science, 94, 575-581.
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.
2050
Horsley V. 2009. Epigenetics, Wnt signaling, and stem cells: the Pygo2 connection. The Journal of Cell Biology, 185, 761-763. Kuphal F, Behrens J. 2006. E-cadherin modulates Wntdependent transcription in colorectal cancer cells but does not alter Wnt-independent gene expression in fibroblasts. Experimental Cell Research, 312, 457-467. Lapyckyj L, Castillo L F, Matos M L, Gabrielli N M, Lüthy I A, Vazquez-Levin M H. 2010. Expression analysis of epithelial cadherin and related proteins in IBH-6 and IBH-4 human breast cancer cell lines. Journal of Cellular Physiology, 3, 596-605. Morrison B, Cutler M L. 2010. The contribution of adhesion signaling to lactogenesis. Journal of Cell Communicatio and Signaling, 4, 131-139. Nørgaard J V, Nielsen M O, Theil P K, Sørensen M T, Safayi S, Sejrsen K. 2008. Development of mammary glands of fat sheep submitted to restricted feeding during late pregnancy. Small Ruminant Research, 76, 155-165. Qin J, LI Q Z, Gao X J. 2008. Effect of main components from semen vaccariae on multiplication and expression of beta-casein of mouse mammary epithelial cell in vitro. Scientia Agricultura Sinica, 8, 2442-2447. (in Chinese) Rudolph M C, McManaman J L, Hunter L, Phang T, Neville MC. 2003. Functional development of the mammary gland: use of expression profiling and trajectory clustering to reveal changes in gene expression during pregnancy, lactation, and involution. Journal of Mammary Gland Biology and Neoplasia, 8, 287-307.
TONG Jin-jin et al.
Schmalhofer O, Brabletz S, Brabletz T. 2009. E-cadherin, bcatenin, and ZEB1 in malignant progression of cancer. Cancer Metastasis Reviews, 28, 151-166. Su Y, Shankar K, Rahal O, Simmen R C. 2011. Bidirectional signaling of mammary epithelium and stroma: implications for breast cancer-preventive actions of dietary factors. Journal of Nutritional Biochemistry, 22, 605-611. Su Y, Simmen R C. 2009. Soy isoflavone genistein upregulates epithelial adhesion molecule E-cadherin expression and attenuates beta-catenin signaling in mammary epithelial cells. Carcinogenesis, 30, 331-339, Wan Z Y, Tong H L, Li Q Z, Gao X J. 2010. Influence on the specific micrornas in bovine mammary gland epithelial cells by semen vaccariae active monomer and prolactin. China Animal Husbandry and Veterinary Medicine, 8, 230-232. Yang L J, Liu Y Q, Gu B, Bian X C, Feng H L, Yang Z L, Liu Y Y. 2010. Effect of forced E-cadherin expression on adhesion and proliferation of human breast carcinoma cells. Chinese Journal of Pathology, 12, 842-847. (in Chinese) Zeljko M, Pecina-Slaus N, Martic T N, Kusec V, Beros V, Tomas D. 2011. Molecular alterations of E-cadherin and beta-catenin in brain metastases. Fronti ers in Bioscience, 3, 616-624. Zhang Y H, Yan W S, Chen X B. 2011. Mutant p53 disrupts MCF-10A cell polarity in three-dimensional culture via epithelial-to-mesenchymal transitions. Journal of Biological Chemistry, 286, 16218-16228. (Managing editor ZHANG Juan)
© 2012, CAAS. All rights reserved. Published by Elsevier Ltd.