- Email: [email protected]
Effect of short-term alkaline intervention on the performance of buffer-free single-chamber microbial fuel cell
Bioelectrochemistry 115 (2017) 41–46
Contents lists available at ScienceDirect
Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem
Effect of short-term alkaline intervention on the performance of buffer-free single-chamber microbial fuel cell Na Yang, Yueping Ren ⁎, Xiufen Li ⁎, Xinhua Wang Jiangsu Key Laboratory of Anaerobic Biotechnology, Jiangsu Cooperative Innovation Center of Technology and Material of Water Treatment, School of Environmental and Civil Engineering, Jiangnan University, Wuxi, Jiangsu 214122, China
a r t i c l e
i n f o
Article history: Received 25 September 2016 Received in revised form 14 February 2017 Accepted 14 February 2017 Available online 27 February 2017 Keywords: Microbial fuel cell (MFC) Buffer-free Anion exchange resin (AER) Self-buffering
a b s t r a c t Anolyte acidification is a drawback restricting the electricity generation performance of the buffer-free microbial fuel cells (MFC). In this paper, a small amount of alkali-treated anion exchange resin (AER) was placed in front of the anode in the KCl mediated single-chamber MFC to slowly release hydroxyl ions (OH−) and neutralize the H+ ions that are generated by the anodic reaction in two running cycles. This short-term alkaline intervention to the KCl anolyte has promoted the proliferation of electroactive Geobacter sp. and enhanced the self-buffering capacity of the KCl-AER-MFC. The pH of the KCl anolyte in the KCl-AER-MFC increased and became more stable in each running cycle compared with that of the KCl-MFC after the short-term alkaline intervention. The maximum power density (Pmax) of the KCl-AER-MFC increased from 307.5 mW·m−2 to 542.8 mW·m−2, slightly lower than that of the PBS-MFC (640.7 mW·m−2). The coulombic efficiency (CE) of the KCl-AER-MFC increased from 54.1% to 61.2% which is already very close to that of the PBS-MFC (61.9%). The results in this paper indicate that short-term alkaline intervention to the anolyte is an effective strategy to further promote the performance of buffer-free MFCs. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Microbial fuel cell (MFC) is a electrochemical device that generates electricity using organic and inorganic pollutants as raw materials and electro-active microorganisms as catalysts [1,2]. MFC is regarded as a highly adaptable technology to the sustainable wastewater treatment [3–5]. In the running of lab-scale MFC device, buffer solution (such as PBS, dicarbonate, MES, HEPES, PIPES, etc.) is indispensable to provide certain ionic conductivity of the electrolyte and maintain suitable pH condition [6–8]. However, applying buffered MFC systems in practical waste water treatment is unrealistic, owing to their high operation cost. In buffer-free MFCs, the existence of soluble salt (e.g. NaCl or KCl, etc.) can increase the electrolyte conductivity, decrease the internal resistance and elevate the power density [9–11]. The maximum power density (Pmax) of a food waste leachate treatment two-chamber MFC dramatically increased from 366 mW·m− 3 to 1000 mW·m− 3 when NaCl (100 mM) was added [10]. Nevertheless, in these salt-mediated MFCs, anolyte acidification is a serious constraint to the electricity generation [12,13]. Based on the previous reports, the bacteria number and the electrochemical activity of the biofilm grown in acid ambient (pH 5) were smaller and lower than the biofilm grown at pH 7 [10]. Yuan and
⁎ Corresponding authors. E-mail addresses: [email protected] (Y. Ren), xfl[email protected] (X. Li).
http://dx.doi.org/10.1016/j.bioelechem.2017.02.002 1567-5394/© 2017 Elsevier B.V. All rights reserved.
co-workers [14] also found that when the anolyte pH declined from 7 to 5, the Pmax of a two-chamber MFC dramatically decreased from 833 ± 40 mW·m−2 to 129 ± 6 mW·m−2. As early as 2007, Fan and co-workers [15] pointed out that the anodic products (HCO–3 and CO2) could serve as natural buffer substances in MFCs. However, the reality is that these buffer substances are gradually accumulated in the anolyte as the degradation of substrates and the consumption of H+ by cathode reaction [15]. Thus, anolyte acidification at the initial electrogenesis period is inevitable, which would impede the anode reaction, the accumulation of buffer substances and the development of electro-active microorganism biofilm. Inactive biofilm generates less buffer substances and the anolyte acidification continues to impact the growth and activity of the anode biofilm. Thus, breaking this vicious circle is a way out to further improve the performance of salt-mediated MFCs. In this paper, short-term alkaline intervention has been exerted on a single-chamber KCl mediated MFC to eliminate the anolyte acidification, promote the proliferation of electro-active microorganisms, accelerate the accumulation of buffer substances and finally enhance the electricity generation. Specifically, a small amount of the alkali-treated anion exchange resin (AER) was placed in front of the anode to slowly release hydroxyl ions (OH−) to neutralize the H+ ions that are generated by the anodic reaction (shown in Fig. 1). The effect of this short-term alkaline intervention on the anolyte pH, substrate removal efficiency, Coulombic efficiency (CE) and the anodic microbial community structure of the buffer-free MFC have been systematically investigated.
42
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
Fig. 1. Schematic diagram of (a) the KCl-AER-MFC, (b) the front view of the AER and the anode, and (c) the reactions in the anolyte around the anode.
2. Material and methods
2.3. Measurements and analysis
2.1. Anion exchange resin processing
The data collection instrument (34972A, Agilent, Santa Clara, USA) was used to record the output voltages (U) at 30 min intervals. To test the polarization characteristic of the MFC, resistances (R: 22,000 Ω, 10,000 Ω, 8200 Ω, 6200 Ω, 4700 Ω, 3500 Ω, 2200 Ω, 1800 Ω, 1000 Ω, 820 Ω, 680 Ω, 530 Ω, 470 Ω, 420 Ω, 330 Ω, 280 Ω, 220 Ω, 140 Ω, 100 Ω) were connected between the cathode and the anode and paused 15 min at each resistance to allow the voltage to reach a stable value [19]. The U and the electrode potentials at each resistance were measured by a UT70B multimeter (Uni-Trend Technology Ltd., Shanghai, China). The current density (J) at each resistance was calculated from the U, the R and the electrode projected area (A, 7 cm−2) according to Eq. (1).
Chloro-type AER (Sinopharm Chemical Reagent Co., Ltd., China) particles were washed with deionized water for several times until colorless and then they were soaked in deionized water for 4 h. Next, these AER particles were soaked in NaOH aqueous solution (5%) for another 4 h. After that, the AER particles were washed with deionized water until the pH of the cleaning solution decreased to ~ 10. At last, 0.8 g AER was stuck on a sinuate stainless steel wire by double faced adhesive tape as shown in Fig. 1a–b.
2.2. The operation of MFC Single-chamber air-cathode MFC devices were applied. The volume of the cylindrical chamber is 56 mL and the electrode spacing is 8 cm. Round electrodes (3 cm in diameter, 7 cm 2 in projected area) were fixed on the two sides of the chamber by silicone pads. Graphite felts (Hesen Electric Appliance Co., Ltd., Shanghai, China) were used as the anodes. Activated carbon (AC) air-cathodes prepared by the rolling-press method [16,17] were used as the cathodes. Anaerobic sludge (Tailake Newtown Sewage Treatment Plant, Wuxi, China) was used as the inoculum in the MFCs. The operation includes four stages (A to D). At stage A, all the MFCs were fed with the anolyte composed of sodium acetate (1 g·L − 1 ), PBS (11.53 g·L− 1 NaH2 PO 4·12H2O, 2.77 g·L− 1 Na 2 HPO 4 ·2H 2O, 0.13 g·L− 1 KCl, 0.31 g·L − 1 NH4 Cl), trace mineral (12.5 mL·L − 1) and vitamin (5 mL·L− 1) solution [18]. At stage B, PBS were substituted by KCl solutions (50 mM) in two of the MFCs. At stage C, 0.8 g AER fixed on the sinuate stainless steel wire was placed 2 cm in front of the anode in one of the KCl mediated MFCs. At stage D, the AER was removed from the MFC. The MFCs were named as PBS-MFC, KCl-MFC and KCl-AER-MFC according to the anolytes used at stage C. All MFCs were operated at 30 °C with the external resistors of 1000 Ω. The running cycles of the MFCs were terminated and the anolytes were replaced when the voltage of the KCl-AER-MFC decreased to less than 20 mV.
J¼
U RA
ð1Þ
Electrochemical characterizations were carried out on the CHI660D (Chenhua Instruments Co. Ltd., Shanghai, China) electrochemical workstation in three-electrode systems. The working electrode, counter electrode and the reference electrode are the anode, Pt wire electrode and saturated calomel electrode (SCE). The scan potential range and the scan rate of the cyclic voltammograms (CVs) are − 1 V to 1 V and 10 mV·s−1. The frequency range and the amplitude of the electrochemical impedance spectra (EIS) are 0.01–100,000 Hz and 5 mV [20]. Standard Method [21] was adopted to determine the chemical oxygen demand (COD) of the anolytes [17]. CEs were calculated according to the previously reported equations [22]. The pH of the anolyte in the KCl-AER-MFC was monitored by the pH detector (405-DPAS-SC-K8S/ 225, Mettler Toledo) on a fermenter (Biotech-3JG-2, Baoxing Bio-engineering equipment Co. Ltd., Shanghai, China). 2.4. DNA extraction In order to study the anodic microbial community discrepancy between the MFCs with different anolytes, the three anodes were minced with a sterile scalpel and the E.Z.N.A.® Soil DNA Kit (Omega Biotek, Norcross, USA) was used to extract the microorganism DNA [23].
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
43
Fig. 2. (a) The output voltages (U) of the MFCs, and (b) the pH variation of the anolyte in the KCl-AER-MFC.
2.5. PCR amplification For each DNA product, the bacteria 16S rRNA gene (the V4-V5 region) was amplified by PCR (95 °C for 2 min, 25 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s and final extension at 72 °C for 5 min) with primers 338F ACTCCTACGGGAGGCAGCAG and 806R GGACTACHVGGGTWTCTAAT. The products were purified by AxyPrepDNA Gel Extraction Kit (Axygen Biosciences, Union City, USA) and then quantified on QuantiFluor™-ST (Promega, Madison, USA) [24]. 2.6. MiSeq sequencing data High-throughput sequencing was performed on the Illumina Miseq PE300 platform. The sequencing reads were analyzed by QIIME software. The similarity levels of the operational taxonomic units (OTUs) were determined at 97% by UPARSE software. The taxonomic of the 16S rRNA gene sequences was analyzed against the silva (SSU115) database at the RDP Classifier confidence threshold of 70% [25]. 3. Results and discussion 3.1. Performance of MFCs The U of the three MFCs and the pH variation in each running cycle of the KCl-AER-MFC are shown in Fig. 2. At stage A, all the three MFCs with
PBS as anolytes showed the same U, around 0.45 V, and the pH of the PBS anolytes in the two running cycles all stayed at about 6.97. When PBS was substituted by KCl (50 mM) solution at stage B, the U of the two MFCs (KCl-MFC and KCl-AER-MFC) dramatically decreased to 0.39 V and 0.37 V in the first and the second running cycle. And the pH of the KCl anolyte in the two running cycles declined first to 6.16 and 5.86 because of the H+ accumulation [12,13], and then slowly rose back to 6.90 at the end of each cycle. The conductivity of the PBS and KCl (50 mM) anolytes were almost the same (6.84 mS·cm−1 and 6.72 mS·cm−1). Thus, the decrease of U should be caused by the decline of the anolyte pH. At stage C, when the AER was placed in front of the anode in the KCl-AER-MFC, the pH of the KCl anolyte jumped to 10.27 at the beginning and then declined to 7.83 and 6.94 at the end of the first two cycles. As anticipated, the U of the KCl-AER-MFC increased from 0.37 V to 0.41 V. From the third running cycle of stage C, the pH stayed at 6.66 after a rapid fluctuation (decreased to 5.87 and then rapidly rose back to 6.66), indicating that the OH– ions carried by the AER have been fully released in the first two cycles. Of particular interest is that the pH in each running cycle of stage C was higher and more stable than that of the stage B and the U in the corresponding running cycles remained at 0.40 V after OH– ions were fully released, which was probably due to the enhancing of the self-buffering capacity of the MFC [15]. In stage D, the AER was removed from the KCl-AER-MFC but there was no apparent U and pH variation. Although the OH– ions carried by the AER were fully released in the first two cycles of stage C, the pH of the KCl anolyte and the U of the KCl-AER-MFC in the subsequent cycles
Fig. 3. (a) Polarization (open symbols) and power density (P) (filled symbols) curves, and (b) electrode potential (E) (cathode: open symbols; anode: filled symbols) vs. current density (j) for MFCs at stage C. ●/○: PBS-MFC, / : KCl-MFC, / : KCl-AER-MFC. Data obtained with the external resistances listed in Section 2.3. The green arrows mark the P of MFCs and the E of the electrodes for the external resistor of 1000 Ω.
44
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
Fig. 4. (a) Cyclic voltammetry (CV) curves, and (b) Nyquist plots of the anodes in PBS-MFC (black), KCl-MFC (red) and KCl-AER-MFC (blue).
stayed at the same level, which revealed that the alkaline environment in the first two cycles of stage C probably already changed the microbial population in the anode biofilm. These microorganisms exhibited excellent electro activity and generated more buffer substances to keep the KCl anolyte at a relative higher pH level. As shown in Fig. 3a, the Pmax of the PBS-, KCl- and KCl-AER-MFC were 640.7 mW·m−2, 307.5 mW·m−2 and 542.8 mW·m−2. The internal resistances (Rin) of the corresponding MFCs were 213.2 Ω, 294.5 Ω and 261.2 Ω, respectively. In addition, the anode potential curves exhibit disparate slopes whereas the cathode potential curves overlap, as shown in Fig. 3b, which revealed that the differences of U, Pmax and Rin between the three MFCs were caused by the differences of the anode biofilms [17]. 3.2. Electrochemical characterization CV analysis of the anodes showed that the responses of the anode biofilms formed in different anolytes were altered. As shown in Fig. 4a, for the CV curve of the PBS biofilm, the oxidation peak was observed at − 0.24 V and the reduction peak was found at − 0.36 V, which were due to the bio-electrocatalytic redox reaction of acetate according to previous reports [26,27]. This biofilm exhibited a similar voltammetric behavior with the G. sulfurreducens biofilm reported in literatures [28,29]. For the KCl biofilm, the oxidation peak appeared at 0.22 V and the reduction peak shifted to 0.15 V. The peak currents were smaller than that of the PBS biofilm, indicating its lower redox activity. The oxidation peak of the KCl-AER biofilm shifted to 0.23 V and the reduction peak appeared at 0.02 V, of which the peak currents were much higher than that of the KCl-biofilm, suggesting the superior electrochemical activity of the KCl-AER biofilm. Fig. 4d shows the Nyquist plots of the anodes in different MFCs. The ohmic resistances (Rohm) of the anodes in PBS-, KCl- and KCl-AER-MFC were almost the same, but the charge transfer resistances (Rct) were 12.93 Ω, 32.61 Ω and 14.82 Ω, indicating that the extracellular electron transfer in the KCl-AER biofilm has been greatly enhanced [30,31] compared with that of the KCl biofilm. 3.3. COD removal efficiency and CE The COD removal efficiency and the CE of the KCl-AER-MFC were comparable to that of the PBS-MFC and higher than the KCl-MFC (Table 1), which is consistent with the result of the electrochemical characterization that the KCl-AER-biofilm exhibited higher electrochemical activity.
3.4. Bacterial community To confirm the influence of the short-term alkaline intervention on the microbial community structure, high-throughput sequencing experiment has been carried out. According to the results in Fig. 5, at genus level, Geobacter (38.80% of total bacterial sequences), AKYG597_no rank (15.02%), Desulfuromonadales_unclassified (7.92%), Victivallis (2.52%) and Bacillus (2.18%) appeared at relatively higher level in the PBS biofilm. Amid, the species of Geobacter and Bacillus have been confirmed as exoelectrogenic microbes in MFCs [32–34]. AKYG597 and Victivallis have been found in MFCs [35,36] in the previous reports, but they have not yet been identified as electroactive microbes. The microorganism community structure of the KCl biofilm was dramatically different from that of the PBS biofilm. Although the relative abundance of electroactive Bacillus increased to 7.31%, that of Geobacter prominently decreased to 3.65%, which resulted in the inferior electrogenesis of the KCl-MFC. However, in the KCl-AER biofilm, the relative abundance of Geobacter increased to 35.15%, slightly lower than that of the PBS biofilm (38.80%) but significantly higher than that of the KCl biofilm (3.65%). The relative abundance of Bacillus decreased to 0.79% which was lower than that of the PBS biofilm and the KCl biofilm. It is worth noting that the relative abundance of the Desulfuromonadales_unclassified in the KCl and the KCl-AER biofilm significantly increased to 15.70% and 26.39%, but the electrogenic abilities of the corresponding biofilms were still lower than the PBS biofilm, indicating that the contribution of Desulfuromonadales_unclassified to the electricity generation was ignorable. Based on the result of high-throughput sequencing experiment in Fig. 5, the microbial community structure of the KCl-AER-MFC has changed after the short-term alkaline intervention in the first two running cycles of stage C and the electrogenesis enhancement of the KCl-AER biofilm is mainly attributed to the abundance of the electroactive Geobacter sp.
4. Conclusions This paper provides a new strategy to further enhance the performance of buffer-free salt solution mediated MFCs. Short-term alkaline Table 1 The COD removal efficiencies and the CEs of the MFCs.
PBS-MFC KCl-MFC KCl-AER-MFC
COD removal efficiency
CE
88.2% 86.7% 88.1%
61.9% 54.1% 61.2%
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
45
Fig. 5. Microbial community structures of the anode biofilms at genus level.
intervention to the KCl anolyte by AER enhanced the self-buffering capacity of the MFC as the pH of the KCl anolyte in the KCl-AER-MFC after alkaline intervention was increased and became more stable in each running cycle. The Pmax of the KCl-AER-MFC increased from 307.5 mW·m−2 to 542.8 mW·m−2. The CE of the KCl-AER-MFC increased from 54.1% to 61.2% which is already very close to that of the PBS-MFC (61.9%). The microbial community structure of the anodic biofilm has also been observably changed and the short-term alkaline intervention promoted the proliferation of electroactive Geobacter sp.
Acknowledgement This research was supported by the National Natural Science Foundation of China (grant number 21206058), the Fundamental Research Funds for the Central Universities (grant number JUSRP51512, 51728A), the Major Science and Technology Program for Water Pollution Control and Treatment (grant number 2012ZX07101-013-04), the Open Project Foundation of Jiangsu Key Laboratory of Anaerobic Biotechnology (grant number JKLAB201604) and the Postdoctoral Research Funding Plan of Jiangsu Province (grant number 1302165C). References [1] A.S. Mathuriya, J.V. Yakhmi, Microbial fuel cells-applications for generation of electrical power and beyond, Crit. Rev. Microbiol. 42 (2016) 127–143. [2] F.J. Hernandez-Fernandez, A. Perez de los Rios, M.J. Salar-Garcia, V.M. OrtizMartinez, L.J. Lozano-Blanco, C. Godinez, F. Tomas-Alonso, J. Quesada-Medina, Recent progress and perspectives in microbial fuel cells for bioenergy generation and wastewater treatment, Fuel Process. Technol. 138 (2015) 284–297. [3] L. Xu, Y.Q. Zhao, L. Doherty, Y.S. Hu, X.D. Hao, The integrated processes for wastewater treatment based on the principle of microbial fuel cells: a review, Crit. Rev. Environ. Sci. Technol. 46 (2016) 60–91. [4] C.S. He, Z.X. Mu, H.Y. Yang, Y.Z. Wang, Y. Mu, H.Q. Yu, Electron acceptors for energy generation in microbial fuel cells fed with wastewaters: a mini-review, Chemosphere 140 (2015) 12–17. [5] W.W. Li, H.Q. Yu, Z. He, Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies, RSC Adv. 2 (2012) 1248–1263.
[6] J.Y. Nam, H.W. Kim, K.H. Lim, H.S. Shin, B.E. Logan, Variation of power generation at different buffer types and conductivities in single chamber microbial fuel cells, Biosens. Bioelectron. 25 (2010) 1155–1159. [7] C. Forrestal, Z. Huang, Z.Y.J. Ren, Percarbonate as a naturally buffering catholyte for microbial fuel cells, Bioresour. Technol. 172 (2014) 429–432. [8] Y. Ye, X. Zhu, B.E. Logan, Effect of buffer charge on performance of air-cathodes used in microbial fuel cells, Electrochim. Acta 194 (2016) 441–447. [9] O. Lefebvre, Z. Tan, S. Kharkwal, H.Y. Ng, Effect of increasing anodic NaCl concentration on microbial fuel cell performance, Bioresour. Technol. 112 (2012) 336–340. [10] X.M. Li, K.Y. Cheng, J.W.C. Wong, Bioelectricity production from food waste leachate using microbial fuel cells: effect of NaCl and pH, Bioresour. Technol. 149 (2013) 452–458. [11] M. Miyahara, A. Kouzuma, K. Watanabe, Effects of NaCl concentration on anode microbes in microbial fuel cells, AMB Express 34 (2015) 1–9. [12] L. Zhang, X. Zhu, H. Kashima, J. Li, D.D. Ye, Q. Liao, J.M. Regan, Anolyte recirculation effects in buffered and unbuffered single-chamber air-cathode microbial fuel cells, Bioresour. Technol. 179 (2015) 26–34. [13] G.C. Gil, I.S. Chang, B.H. Kim, M. Kim, J.K. Jang, H.S. Park, H.J. Kim, Operational parameters affecting the performance of a mediator-less microbial fuel cell, Biosens. Bioelectron. 18 (2003) 327–334. [14] Y. Yuan, B. Zhao, S. Zhoua, S. Zhong, L. Zhuang, Electrocatalytic activity of anodic biofilm responses to pH changes in microbial fuel cells, Bioresour. Technol. 102 (2011) 6887–6891. [15] a Y.Z. Fan, H.Q. Hu, H. Liu, Sustainable power generation in microbial fuel cells using bicarbonate buffer and proton transfer mechanisms, Environ. Sci. Technol. 41 (2007) 8154–8158. b Y. Ahn, Comment on “Sustainable power generation in microbial fuel cells using bicarbonate buffer and proton transfer mechanisms”, Environ. Sci. Technol. 42 (2008) 6303–6305. [16] H. Dong, H.B. Yu, X. Wang, Q.X. Zhou, J.L. Feng, A novel structure of scalable air cathode without Nafion and Pt by rolling activated carbon and PTFE as catalyst layer in microbial fuel cells, Water Res. 46 (2012) 5777–5787. [17] L.X. Xian, N. Yang, Y.P. Ren, X.F. Li, Y.G. Shi, Z.Z. Hua, X.H. Wang, Effect of binder free graphene-cetyltrimethylammonium bromide anode on the performance of microbial fuel cells, J. Chem. Technol. Biotechnol. (2016)http://dx.doi.org/10.1002/jctb.4985 (on line). [18] B.E. Logan, S. Cheng, V. Watson, G. Estadt, Graphite fiber brush anodes for increased power production in air-cathode microbial fuel cells, Environ. Sci. Technol. 41 (2007) 3341–3346. [19] H. Rismani-Yazdi, A.D. Christy, B.A. Dehority, M. Morrison, Z. Yu, O.H. Tuovinen, Electricity generation from cellulose by rumen microorganisms in microbial fuel cells, Biotechnol. Bioeng. 97 (2007) 1398–1407. [20] J.X. Hou, Z.L. Liu, P.Y. Zhang, A new method for fabrication of graphene/polyaniline nanocomplex modified microbial fuel cell anodes, J. Power Sources 224 (2013) 139–144.
46
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
[21] America Public Healthy Association (APHA), Standard Methods for the Examination of Water and Wastewater, 20th ed., 1998 Washington, DC. [22] Y.L. Kang, S. Ibrahim, S. Pichiah, Synergetic effect of conductive polymer poly (3,4ethylenedioxythiophene) with different structural configuration of anode for microbial fuel cell application, Bioresour. Technol. 189 (2015) 364–369. [23] L. Hu, L.X. Cao, R.D. Zhang, Bacterial and fungal taxon changes in soil microbial community composition induced by short-term biochar amendment in red oxidized loam soil, World J. Microbiol. Biotechnol. 30 (2014) 1085–1092. [24] Y. Yuan, S.Y. Wang, Y. Liu, B.K. Li, B. Wang, Y.Z. Peng, Long-term effect of pH on short-chain fatty acids accumulation and microbial community in sludge fermentation systems, Bioresour. Technol. 197 (2015) 56–63. [25] G.L. Liu, Y. Zhou, H.P. Luo, X. Cheng, R.D. Zhang, W.K. Teng, A comparative evaluation of different types of microbial electrolysis desalination cells for malic acid production, Bioresour. Technol. 198 (2015) 87–93. [26] X.P. Zhu, M.D. Yates, B.E. Logan, Set potential regulation reveals additional oxidation peaks of Geobacter sulfurreducens anodic biofilms, Electrochem. Commun. 22 (2012) 116–119. [27] J.R. Kim, S.H. Jung, J.M. Regan, B.E. Logan, Electricity generation and microbial community analysis of alcohol powered microbial fuel cells, Bioresour. Technol. 98 (2007) 2568–2577. [28] Y. Liu, F. Harnisch, K. Fricke, U. Schroder, V. Climent, J.M. Feliu, The study of electrochemically active microbial biofilms on different carbon-based anode materials in microbial fuel cells, Biosens. Bioelectron. 25 (2010) 2167–2171.
[29] K.J. Chae, M.J. Choi, J.W. Lee, K.Y. Kim, I.S. Kim, Effect of different substrates on the performance, bacterial diversity, and bacterial viability in microbial fuel cells, Bioresour. Technol. 100 (2009) 3518–3525. [30] A.K. Manohar, O. Bretschger, K.H. Nealson, F. Mansfeld, The polarization behavior of the anode in a microbial fuel cell, Electrochim. Acta 53 (2008) 3508–3513. [31] A.K. Manohar, F. Mansfeld, The internal resistance of a microbial fuel cell and its dependence on cell design and operating conditions, Electrochim. Acta 54 (2009) 1664–1670. [32] D.R. Bond, S.M. Strycharz-Glaven, L.M. Tender, C.I. Torres, On electron transport through Geobacter biofilms, ChemSusChem 5 (2012) 1099–1105. [33] H.P. Luo, P. Xu, Z.Y. Ren, Long-term performance and characterization of microbial desalination cells in treating domestic wastewater, Bioresour. Technol. 120 (2012) 187–193. [34] V.R. Nimje, C.Y. Chen, C.C. Chen, J.S. Jean, A.S. Reddy, C.W. Fan, K.Y. Pan, H.T. Liu, J.L. Chen, Stable and high energy generation by a strain of Bacillus subtilis in a microbial fuel cell, J. Power Sources 190 (2009) 258–263. [35] C.Z. Hui, X.W. Qin, Y.A. Zhong, Z.Q. Chen, N. Jun, Analysis of long-term performance and microbial community structure in bio-cathode microbial desalination cells, Environ. Sci. Pollut. Res. 23 (2016) 5931–5940. [36] C.H. Lay, M.E. Kokko, J.A. Puhakka, Power generation in fed-batch and continuous up-flow microbial fuel cell from synthetic wastewater, Energy 91 (2015) 235–241.
Contents lists available at ScienceDirect
Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem
Effect of short-term alkaline intervention on the performance of buffer-free single-chamber microbial fuel cell Na Yang, Yueping Ren ⁎, Xiufen Li ⁎, Xinhua Wang Jiangsu Key Laboratory of Anaerobic Biotechnology, Jiangsu Cooperative Innovation Center of Technology and Material of Water Treatment, School of Environmental and Civil Engineering, Jiangnan University, Wuxi, Jiangsu 214122, China
a r t i c l e
i n f o
Article history: Received 25 September 2016 Received in revised form 14 February 2017 Accepted 14 February 2017 Available online 27 February 2017 Keywords: Microbial fuel cell (MFC) Buffer-free Anion exchange resin (AER) Self-buffering
a b s t r a c t Anolyte acidification is a drawback restricting the electricity generation performance of the buffer-free microbial fuel cells (MFC). In this paper, a small amount of alkali-treated anion exchange resin (AER) was placed in front of the anode in the KCl mediated single-chamber MFC to slowly release hydroxyl ions (OH−) and neutralize the H+ ions that are generated by the anodic reaction in two running cycles. This short-term alkaline intervention to the KCl anolyte has promoted the proliferation of electroactive Geobacter sp. and enhanced the self-buffering capacity of the KCl-AER-MFC. The pH of the KCl anolyte in the KCl-AER-MFC increased and became more stable in each running cycle compared with that of the KCl-MFC after the short-term alkaline intervention. The maximum power density (Pmax) of the KCl-AER-MFC increased from 307.5 mW·m−2 to 542.8 mW·m−2, slightly lower than that of the PBS-MFC (640.7 mW·m−2). The coulombic efficiency (CE) of the KCl-AER-MFC increased from 54.1% to 61.2% which is already very close to that of the PBS-MFC (61.9%). The results in this paper indicate that short-term alkaline intervention to the anolyte is an effective strategy to further promote the performance of buffer-free MFCs. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Microbial fuel cell (MFC) is a electrochemical device that generates electricity using organic and inorganic pollutants as raw materials and electro-active microorganisms as catalysts [1,2]. MFC is regarded as a highly adaptable technology to the sustainable wastewater treatment [3–5]. In the running of lab-scale MFC device, buffer solution (such as PBS, dicarbonate, MES, HEPES, PIPES, etc.) is indispensable to provide certain ionic conductivity of the electrolyte and maintain suitable pH condition [6–8]. However, applying buffered MFC systems in practical waste water treatment is unrealistic, owing to their high operation cost. In buffer-free MFCs, the existence of soluble salt (e.g. NaCl or KCl, etc.) can increase the electrolyte conductivity, decrease the internal resistance and elevate the power density [9–11]. The maximum power density (Pmax) of a food waste leachate treatment two-chamber MFC dramatically increased from 366 mW·m− 3 to 1000 mW·m− 3 when NaCl (100 mM) was added [10]. Nevertheless, in these salt-mediated MFCs, anolyte acidification is a serious constraint to the electricity generation [12,13]. Based on the previous reports, the bacteria number and the electrochemical activity of the biofilm grown in acid ambient (pH 5) were smaller and lower than the biofilm grown at pH 7 [10]. Yuan and
⁎ Corresponding authors. E-mail addresses: [email protected] (Y. Ren), xfl[email protected] (X. Li).
http://dx.doi.org/10.1016/j.bioelechem.2017.02.002 1567-5394/© 2017 Elsevier B.V. All rights reserved.
co-workers [14] also found that when the anolyte pH declined from 7 to 5, the Pmax of a two-chamber MFC dramatically decreased from 833 ± 40 mW·m−2 to 129 ± 6 mW·m−2. As early as 2007, Fan and co-workers [15] pointed out that the anodic products (HCO–3 and CO2) could serve as natural buffer substances in MFCs. However, the reality is that these buffer substances are gradually accumulated in the anolyte as the degradation of substrates and the consumption of H+ by cathode reaction [15]. Thus, anolyte acidification at the initial electrogenesis period is inevitable, which would impede the anode reaction, the accumulation of buffer substances and the development of electro-active microorganism biofilm. Inactive biofilm generates less buffer substances and the anolyte acidification continues to impact the growth and activity of the anode biofilm. Thus, breaking this vicious circle is a way out to further improve the performance of salt-mediated MFCs. In this paper, short-term alkaline intervention has been exerted on a single-chamber KCl mediated MFC to eliminate the anolyte acidification, promote the proliferation of electro-active microorganisms, accelerate the accumulation of buffer substances and finally enhance the electricity generation. Specifically, a small amount of the alkali-treated anion exchange resin (AER) was placed in front of the anode to slowly release hydroxyl ions (OH−) to neutralize the H+ ions that are generated by the anodic reaction (shown in Fig. 1). The effect of this short-term alkaline intervention on the anolyte pH, substrate removal efficiency, Coulombic efficiency (CE) and the anodic microbial community structure of the buffer-free MFC have been systematically investigated.
42
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
Fig. 1. Schematic diagram of (a) the KCl-AER-MFC, (b) the front view of the AER and the anode, and (c) the reactions in the anolyte around the anode.
2. Material and methods
2.3. Measurements and analysis
2.1. Anion exchange resin processing
The data collection instrument (34972A, Agilent, Santa Clara, USA) was used to record the output voltages (U) at 30 min intervals. To test the polarization characteristic of the MFC, resistances (R: 22,000 Ω, 10,000 Ω, 8200 Ω, 6200 Ω, 4700 Ω, 3500 Ω, 2200 Ω, 1800 Ω, 1000 Ω, 820 Ω, 680 Ω, 530 Ω, 470 Ω, 420 Ω, 330 Ω, 280 Ω, 220 Ω, 140 Ω, 100 Ω) were connected between the cathode and the anode and paused 15 min at each resistance to allow the voltage to reach a stable value [19]. The U and the electrode potentials at each resistance were measured by a UT70B multimeter (Uni-Trend Technology Ltd., Shanghai, China). The current density (J) at each resistance was calculated from the U, the R and the electrode projected area (A, 7 cm−2) according to Eq. (1).
Chloro-type AER (Sinopharm Chemical Reagent Co., Ltd., China) particles were washed with deionized water for several times until colorless and then they were soaked in deionized water for 4 h. Next, these AER particles were soaked in NaOH aqueous solution (5%) for another 4 h. After that, the AER particles were washed with deionized water until the pH of the cleaning solution decreased to ~ 10. At last, 0.8 g AER was stuck on a sinuate stainless steel wire by double faced adhesive tape as shown in Fig. 1a–b.
2.2. The operation of MFC Single-chamber air-cathode MFC devices were applied. The volume of the cylindrical chamber is 56 mL and the electrode spacing is 8 cm. Round electrodes (3 cm in diameter, 7 cm 2 in projected area) were fixed on the two sides of the chamber by silicone pads. Graphite felts (Hesen Electric Appliance Co., Ltd., Shanghai, China) were used as the anodes. Activated carbon (AC) air-cathodes prepared by the rolling-press method [16,17] were used as the cathodes. Anaerobic sludge (Tailake Newtown Sewage Treatment Plant, Wuxi, China) was used as the inoculum in the MFCs. The operation includes four stages (A to D). At stage A, all the MFCs were fed with the anolyte composed of sodium acetate (1 g·L − 1 ), PBS (11.53 g·L− 1 NaH2 PO 4·12H2O, 2.77 g·L− 1 Na 2 HPO 4 ·2H 2O, 0.13 g·L− 1 KCl, 0.31 g·L − 1 NH4 Cl), trace mineral (12.5 mL·L − 1) and vitamin (5 mL·L− 1) solution [18]. At stage B, PBS were substituted by KCl solutions (50 mM) in two of the MFCs. At stage C, 0.8 g AER fixed on the sinuate stainless steel wire was placed 2 cm in front of the anode in one of the KCl mediated MFCs. At stage D, the AER was removed from the MFC. The MFCs were named as PBS-MFC, KCl-MFC and KCl-AER-MFC according to the anolytes used at stage C. All MFCs were operated at 30 °C with the external resistors of 1000 Ω. The running cycles of the MFCs were terminated and the anolytes were replaced when the voltage of the KCl-AER-MFC decreased to less than 20 mV.
J¼
U RA
ð1Þ
Electrochemical characterizations were carried out on the CHI660D (Chenhua Instruments Co. Ltd., Shanghai, China) electrochemical workstation in three-electrode systems. The working electrode, counter electrode and the reference electrode are the anode, Pt wire electrode and saturated calomel electrode (SCE). The scan potential range and the scan rate of the cyclic voltammograms (CVs) are − 1 V to 1 V and 10 mV·s−1. The frequency range and the amplitude of the electrochemical impedance spectra (EIS) are 0.01–100,000 Hz and 5 mV [20]. Standard Method [21] was adopted to determine the chemical oxygen demand (COD) of the anolytes [17]. CEs were calculated according to the previously reported equations [22]. The pH of the anolyte in the KCl-AER-MFC was monitored by the pH detector (405-DPAS-SC-K8S/ 225, Mettler Toledo) on a fermenter (Biotech-3JG-2, Baoxing Bio-engineering equipment Co. Ltd., Shanghai, China). 2.4. DNA extraction In order to study the anodic microbial community discrepancy between the MFCs with different anolytes, the three anodes were minced with a sterile scalpel and the E.Z.N.A.® Soil DNA Kit (Omega Biotek, Norcross, USA) was used to extract the microorganism DNA [23].
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
43
Fig. 2. (a) The output voltages (U) of the MFCs, and (b) the pH variation of the anolyte in the KCl-AER-MFC.
2.5. PCR amplification For each DNA product, the bacteria 16S rRNA gene (the V4-V5 region) was amplified by PCR (95 °C for 2 min, 25 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s and final extension at 72 °C for 5 min) with primers 338F ACTCCTACGGGAGGCAGCAG and 806R GGACTACHVGGGTWTCTAAT. The products were purified by AxyPrepDNA Gel Extraction Kit (Axygen Biosciences, Union City, USA) and then quantified on QuantiFluor™-ST (Promega, Madison, USA) [24]. 2.6. MiSeq sequencing data High-throughput sequencing was performed on the Illumina Miseq PE300 platform. The sequencing reads were analyzed by QIIME software. The similarity levels of the operational taxonomic units (OTUs) were determined at 97% by UPARSE software. The taxonomic of the 16S rRNA gene sequences was analyzed against the silva (SSU115) database at the RDP Classifier confidence threshold of 70% [25]. 3. Results and discussion 3.1. Performance of MFCs The U of the three MFCs and the pH variation in each running cycle of the KCl-AER-MFC are shown in Fig. 2. At stage A, all the three MFCs with
PBS as anolytes showed the same U, around 0.45 V, and the pH of the PBS anolytes in the two running cycles all stayed at about 6.97. When PBS was substituted by KCl (50 mM) solution at stage B, the U of the two MFCs (KCl-MFC and KCl-AER-MFC) dramatically decreased to 0.39 V and 0.37 V in the first and the second running cycle. And the pH of the KCl anolyte in the two running cycles declined first to 6.16 and 5.86 because of the H+ accumulation [12,13], and then slowly rose back to 6.90 at the end of each cycle. The conductivity of the PBS and KCl (50 mM) anolytes were almost the same (6.84 mS·cm−1 and 6.72 mS·cm−1). Thus, the decrease of U should be caused by the decline of the anolyte pH. At stage C, when the AER was placed in front of the anode in the KCl-AER-MFC, the pH of the KCl anolyte jumped to 10.27 at the beginning and then declined to 7.83 and 6.94 at the end of the first two cycles. As anticipated, the U of the KCl-AER-MFC increased from 0.37 V to 0.41 V. From the third running cycle of stage C, the pH stayed at 6.66 after a rapid fluctuation (decreased to 5.87 and then rapidly rose back to 6.66), indicating that the OH– ions carried by the AER have been fully released in the first two cycles. Of particular interest is that the pH in each running cycle of stage C was higher and more stable than that of the stage B and the U in the corresponding running cycles remained at 0.40 V after OH– ions were fully released, which was probably due to the enhancing of the self-buffering capacity of the MFC [15]. In stage D, the AER was removed from the KCl-AER-MFC but there was no apparent U and pH variation. Although the OH– ions carried by the AER were fully released in the first two cycles of stage C, the pH of the KCl anolyte and the U of the KCl-AER-MFC in the subsequent cycles
Fig. 3. (a) Polarization (open symbols) and power density (P) (filled symbols) curves, and (b) electrode potential (E) (cathode: open symbols; anode: filled symbols) vs. current density (j) for MFCs at stage C. ●/○: PBS-MFC, / : KCl-MFC, / : KCl-AER-MFC. Data obtained with the external resistances listed in Section 2.3. The green arrows mark the P of MFCs and the E of the electrodes for the external resistor of 1000 Ω.
44
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
Fig. 4. (a) Cyclic voltammetry (CV) curves, and (b) Nyquist plots of the anodes in PBS-MFC (black), KCl-MFC (red) and KCl-AER-MFC (blue).
stayed at the same level, which revealed that the alkaline environment in the first two cycles of stage C probably already changed the microbial population in the anode biofilm. These microorganisms exhibited excellent electro activity and generated more buffer substances to keep the KCl anolyte at a relative higher pH level. As shown in Fig. 3a, the Pmax of the PBS-, KCl- and KCl-AER-MFC were 640.7 mW·m−2, 307.5 mW·m−2 and 542.8 mW·m−2. The internal resistances (Rin) of the corresponding MFCs were 213.2 Ω, 294.5 Ω and 261.2 Ω, respectively. In addition, the anode potential curves exhibit disparate slopes whereas the cathode potential curves overlap, as shown in Fig. 3b, which revealed that the differences of U, Pmax and Rin between the three MFCs were caused by the differences of the anode biofilms [17]. 3.2. Electrochemical characterization CV analysis of the anodes showed that the responses of the anode biofilms formed in different anolytes were altered. As shown in Fig. 4a, for the CV curve of the PBS biofilm, the oxidation peak was observed at − 0.24 V and the reduction peak was found at − 0.36 V, which were due to the bio-electrocatalytic redox reaction of acetate according to previous reports [26,27]. This biofilm exhibited a similar voltammetric behavior with the G. sulfurreducens biofilm reported in literatures [28,29]. For the KCl biofilm, the oxidation peak appeared at 0.22 V and the reduction peak shifted to 0.15 V. The peak currents were smaller than that of the PBS biofilm, indicating its lower redox activity. The oxidation peak of the KCl-AER biofilm shifted to 0.23 V and the reduction peak appeared at 0.02 V, of which the peak currents were much higher than that of the KCl-biofilm, suggesting the superior electrochemical activity of the KCl-AER biofilm. Fig. 4d shows the Nyquist plots of the anodes in different MFCs. The ohmic resistances (Rohm) of the anodes in PBS-, KCl- and KCl-AER-MFC were almost the same, but the charge transfer resistances (Rct) were 12.93 Ω, 32.61 Ω and 14.82 Ω, indicating that the extracellular electron transfer in the KCl-AER biofilm has been greatly enhanced [30,31] compared with that of the KCl biofilm. 3.3. COD removal efficiency and CE The COD removal efficiency and the CE of the KCl-AER-MFC were comparable to that of the PBS-MFC and higher than the KCl-MFC (Table 1), which is consistent with the result of the electrochemical characterization that the KCl-AER-biofilm exhibited higher electrochemical activity.
3.4. Bacterial community To confirm the influence of the short-term alkaline intervention on the microbial community structure, high-throughput sequencing experiment has been carried out. According to the results in Fig. 5, at genus level, Geobacter (38.80% of total bacterial sequences), AKYG597_no rank (15.02%), Desulfuromonadales_unclassified (7.92%), Victivallis (2.52%) and Bacillus (2.18%) appeared at relatively higher level in the PBS biofilm. Amid, the species of Geobacter and Bacillus have been confirmed as exoelectrogenic microbes in MFCs [32–34]. AKYG597 and Victivallis have been found in MFCs [35,36] in the previous reports, but they have not yet been identified as electroactive microbes. The microorganism community structure of the KCl biofilm was dramatically different from that of the PBS biofilm. Although the relative abundance of electroactive Bacillus increased to 7.31%, that of Geobacter prominently decreased to 3.65%, which resulted in the inferior electrogenesis of the KCl-MFC. However, in the KCl-AER biofilm, the relative abundance of Geobacter increased to 35.15%, slightly lower than that of the PBS biofilm (38.80%) but significantly higher than that of the KCl biofilm (3.65%). The relative abundance of Bacillus decreased to 0.79% which was lower than that of the PBS biofilm and the KCl biofilm. It is worth noting that the relative abundance of the Desulfuromonadales_unclassified in the KCl and the KCl-AER biofilm significantly increased to 15.70% and 26.39%, but the electrogenic abilities of the corresponding biofilms were still lower than the PBS biofilm, indicating that the contribution of Desulfuromonadales_unclassified to the electricity generation was ignorable. Based on the result of high-throughput sequencing experiment in Fig. 5, the microbial community structure of the KCl-AER-MFC has changed after the short-term alkaline intervention in the first two running cycles of stage C and the electrogenesis enhancement of the KCl-AER biofilm is mainly attributed to the abundance of the electroactive Geobacter sp.
4. Conclusions This paper provides a new strategy to further enhance the performance of buffer-free salt solution mediated MFCs. Short-term alkaline Table 1 The COD removal efficiencies and the CEs of the MFCs.
PBS-MFC KCl-MFC KCl-AER-MFC
COD removal efficiency
CE
88.2% 86.7% 88.1%
61.9% 54.1% 61.2%
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
45
Fig. 5. Microbial community structures of the anode biofilms at genus level.
intervention to the KCl anolyte by AER enhanced the self-buffering capacity of the MFC as the pH of the KCl anolyte in the KCl-AER-MFC after alkaline intervention was increased and became more stable in each running cycle. The Pmax of the KCl-AER-MFC increased from 307.5 mW·m−2 to 542.8 mW·m−2. The CE of the KCl-AER-MFC increased from 54.1% to 61.2% which is already very close to that of the PBS-MFC (61.9%). The microbial community structure of the anodic biofilm has also been observably changed and the short-term alkaline intervention promoted the proliferation of electroactive Geobacter sp.
Acknowledgement This research was supported by the National Natural Science Foundation of China (grant number 21206058), the Fundamental Research Funds for the Central Universities (grant number JUSRP51512, 51728A), the Major Science and Technology Program for Water Pollution Control and Treatment (grant number 2012ZX07101-013-04), the Open Project Foundation of Jiangsu Key Laboratory of Anaerobic Biotechnology (grant number JKLAB201604) and the Postdoctoral Research Funding Plan of Jiangsu Province (grant number 1302165C). References [1] A.S. Mathuriya, J.V. Yakhmi, Microbial fuel cells-applications for generation of electrical power and beyond, Crit. Rev. Microbiol. 42 (2016) 127–143. [2] F.J. Hernandez-Fernandez, A. Perez de los Rios, M.J. Salar-Garcia, V.M. OrtizMartinez, L.J. Lozano-Blanco, C. Godinez, F. Tomas-Alonso, J. Quesada-Medina, Recent progress and perspectives in microbial fuel cells for bioenergy generation and wastewater treatment, Fuel Process. Technol. 138 (2015) 284–297. [3] L. Xu, Y.Q. Zhao, L. Doherty, Y.S. Hu, X.D. Hao, The integrated processes for wastewater treatment based on the principle of microbial fuel cells: a review, Crit. Rev. Environ. Sci. Technol. 46 (2016) 60–91. [4] C.S. He, Z.X. Mu, H.Y. Yang, Y.Z. Wang, Y. Mu, H.Q. Yu, Electron acceptors for energy generation in microbial fuel cells fed with wastewaters: a mini-review, Chemosphere 140 (2015) 12–17. [5] W.W. Li, H.Q. Yu, Z. He, Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies, RSC Adv. 2 (2012) 1248–1263.
[6] J.Y. Nam, H.W. Kim, K.H. Lim, H.S. Shin, B.E. Logan, Variation of power generation at different buffer types and conductivities in single chamber microbial fuel cells, Biosens. Bioelectron. 25 (2010) 1155–1159. [7] C. Forrestal, Z. Huang, Z.Y.J. Ren, Percarbonate as a naturally buffering catholyte for microbial fuel cells, Bioresour. Technol. 172 (2014) 429–432. [8] Y. Ye, X. Zhu, B.E. Logan, Effect of buffer charge on performance of air-cathodes used in microbial fuel cells, Electrochim. Acta 194 (2016) 441–447. [9] O. Lefebvre, Z. Tan, S. Kharkwal, H.Y. Ng, Effect of increasing anodic NaCl concentration on microbial fuel cell performance, Bioresour. Technol. 112 (2012) 336–340. [10] X.M. Li, K.Y. Cheng, J.W.C. Wong, Bioelectricity production from food waste leachate using microbial fuel cells: effect of NaCl and pH, Bioresour. Technol. 149 (2013) 452–458. [11] M. Miyahara, A. Kouzuma, K. Watanabe, Effects of NaCl concentration on anode microbes in microbial fuel cells, AMB Express 34 (2015) 1–9. [12] L. Zhang, X. Zhu, H. Kashima, J. Li, D.D. Ye, Q. Liao, J.M. Regan, Anolyte recirculation effects in buffered and unbuffered single-chamber air-cathode microbial fuel cells, Bioresour. Technol. 179 (2015) 26–34. [13] G.C. Gil, I.S. Chang, B.H. Kim, M. Kim, J.K. Jang, H.S. Park, H.J. Kim, Operational parameters affecting the performance of a mediator-less microbial fuel cell, Biosens. Bioelectron. 18 (2003) 327–334. [14] Y. Yuan, B. Zhao, S. Zhoua, S. Zhong, L. Zhuang, Electrocatalytic activity of anodic biofilm responses to pH changes in microbial fuel cells, Bioresour. Technol. 102 (2011) 6887–6891. [15] a Y.Z. Fan, H.Q. Hu, H. Liu, Sustainable power generation in microbial fuel cells using bicarbonate buffer and proton transfer mechanisms, Environ. Sci. Technol. 41 (2007) 8154–8158. b Y. Ahn, Comment on “Sustainable power generation in microbial fuel cells using bicarbonate buffer and proton transfer mechanisms”, Environ. Sci. Technol. 42 (2008) 6303–6305. [16] H. Dong, H.B. Yu, X. Wang, Q.X. Zhou, J.L. Feng, A novel structure of scalable air cathode without Nafion and Pt by rolling activated carbon and PTFE as catalyst layer in microbial fuel cells, Water Res. 46 (2012) 5777–5787. [17] L.X. Xian, N. Yang, Y.P. Ren, X.F. Li, Y.G. Shi, Z.Z. Hua, X.H. Wang, Effect of binder free graphene-cetyltrimethylammonium bromide anode on the performance of microbial fuel cells, J. Chem. Technol. Biotechnol. (2016)http://dx.doi.org/10.1002/jctb.4985 (on line). [18] B.E. Logan, S. Cheng, V. Watson, G. Estadt, Graphite fiber brush anodes for increased power production in air-cathode microbial fuel cells, Environ. Sci. Technol. 41 (2007) 3341–3346. [19] H. Rismani-Yazdi, A.D. Christy, B.A. Dehority, M. Morrison, Z. Yu, O.H. Tuovinen, Electricity generation from cellulose by rumen microorganisms in microbial fuel cells, Biotechnol. Bioeng. 97 (2007) 1398–1407. [20] J.X. Hou, Z.L. Liu, P.Y. Zhang, A new method for fabrication of graphene/polyaniline nanocomplex modified microbial fuel cell anodes, J. Power Sources 224 (2013) 139–144.
46
N. Yang et al. / Bioelectrochemistry 115 (2017) 41–46
[21] America Public Healthy Association (APHA), Standard Methods for the Examination of Water and Wastewater, 20th ed., 1998 Washington, DC. [22] Y.L. Kang, S. Ibrahim, S. Pichiah, Synergetic effect of conductive polymer poly (3,4ethylenedioxythiophene) with different structural configuration of anode for microbial fuel cell application, Bioresour. Technol. 189 (2015) 364–369. [23] L. Hu, L.X. Cao, R.D. Zhang, Bacterial and fungal taxon changes in soil microbial community composition induced by short-term biochar amendment in red oxidized loam soil, World J. Microbiol. Biotechnol. 30 (2014) 1085–1092. [24] Y. Yuan, S.Y. Wang, Y. Liu, B.K. Li, B. Wang, Y.Z. Peng, Long-term effect of pH on short-chain fatty acids accumulation and microbial community in sludge fermentation systems, Bioresour. Technol. 197 (2015) 56–63. [25] G.L. Liu, Y. Zhou, H.P. Luo, X. Cheng, R.D. Zhang, W.K. Teng, A comparative evaluation of different types of microbial electrolysis desalination cells for malic acid production, Bioresour. Technol. 198 (2015) 87–93. [26] X.P. Zhu, M.D. Yates, B.E. Logan, Set potential regulation reveals additional oxidation peaks of Geobacter sulfurreducens anodic biofilms, Electrochem. Commun. 22 (2012) 116–119. [27] J.R. Kim, S.H. Jung, J.M. Regan, B.E. Logan, Electricity generation and microbial community analysis of alcohol powered microbial fuel cells, Bioresour. Technol. 98 (2007) 2568–2577. [28] Y. Liu, F. Harnisch, K. Fricke, U. Schroder, V. Climent, J.M. Feliu, The study of electrochemically active microbial biofilms on different carbon-based anode materials in microbial fuel cells, Biosens. Bioelectron. 25 (2010) 2167–2171.
[29] K.J. Chae, M.J. Choi, J.W. Lee, K.Y. Kim, I.S. Kim, Effect of different substrates on the performance, bacterial diversity, and bacterial viability in microbial fuel cells, Bioresour. Technol. 100 (2009) 3518–3525. [30] A.K. Manohar, O. Bretschger, K.H. Nealson, F. Mansfeld, The polarization behavior of the anode in a microbial fuel cell, Electrochim. Acta 53 (2008) 3508–3513. [31] A.K. Manohar, F. Mansfeld, The internal resistance of a microbial fuel cell and its dependence on cell design and operating conditions, Electrochim. Acta 54 (2009) 1664–1670. [32] D.R. Bond, S.M. Strycharz-Glaven, L.M. Tender, C.I. Torres, On electron transport through Geobacter biofilms, ChemSusChem 5 (2012) 1099–1105. [33] H.P. Luo, P. Xu, Z.Y. Ren, Long-term performance and characterization of microbial desalination cells in treating domestic wastewater, Bioresour. Technol. 120 (2012) 187–193. [34] V.R. Nimje, C.Y. Chen, C.C. Chen, J.S. Jean, A.S. Reddy, C.W. Fan, K.Y. Pan, H.T. Liu, J.L. Chen, Stable and high energy generation by a strain of Bacillus subtilis in a microbial fuel cell, J. Power Sources 190 (2009) 258–263. [35] C.Z. Hui, X.W. Qin, Y.A. Zhong, Z.Q. Chen, N. Jun, Analysis of long-term performance and microbial community structure in bio-cathode microbial desalination cells, Environ. Sci. Pollut. Res. 23 (2016) 5931–5940. [36] C.H. Lay, M.E. Kokko, J.A. Puhakka, Power generation in fed-batch and continuous up-flow microbial fuel cell from synthetic wastewater, Energy 91 (2015) 235–241.