Effect of skeletal muscle phenotype and gender on fasting-induced myokine expression in mice

Biochemical and Biophysical Research Communications 514 (2019) 407e414

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Effect of skeletal muscle phenotype and gender on fasting-induced myokine expression in mice Wei-hua Jia a, 1, Nuo-qi Wang a, 1, Lin Yin a, Xi Chen a, Bi-yu Hou a, Gui-fen Qiang a, Chi Bun Chan b, Xiu-ying Yang a, *, Guan-hua Du a, ** a

State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Beijing Key Laboratory of Drug Target and Screening Research, Institute of Materia Medica of Peking Union Medical College, Beijing, 100050, PR China School of Biological Sciences, The University of Hong Kong, 6N01 Kadoorie Biological Sciences Building, Pokfulam Road, Hong Kong

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 April 2019 Accepted 22 April 2019 Available online 2 May 2019

Skeletal muscle secretes myokines, which are involved in metabolism and muscle function regulation. The role of fasting on myokine expression in skeletal muscle is largely unknown. In this study, we used gastrocnemius skeletal muscle RNA sequencing data from fasting male mice in the Gene Expression Omnibus (GEO) database. Adopted male and female C57BL/6J mice that fasted for 24 h were included to examine the effect of fasting on myokine expression in slow-twitch soleus and fast-twitch tiabialis anterior (TA) skeletal muscle. We found that fasting significantly affected many myokines in muscle. Fasting reduced Fndc5 and Igf1 gene expression in soleus and TA muscles in both male and female mice without muscle phenotype or gender differences, but Il6, Mstn and Erfe expression was influenced by fasting with fibre type- and gender-dependent effects. Fasting also induced muscle atrophy marker genes Murf1 and Fbxo32 and reduced myogenesis factor Mef2 expression without muscle fibre or gender differences. We further found that the expression of transcription factors Pgc1a, Ppara, Pparg and Ppard had muscle fibre type-dependent effects, and the expression of Pgc1a and Ppara had gender-dependent effects. The sophisticated expression pattern of myokines would partially explain the complicated crosstalk between skeletal muscle and other organs in different genders and muscles phenotypes, and it is worth further investigation. © 2019 Elsevier Inc. All rights reserved.

Keywords: Fasting Myokines Skeletal muscle Male Female Mice

1. Introduction Skeletal muscle is not only responsible for motion but also has been identified as an endocrine organ [1e4]. Myokine is a collective term for cytokines and growth factors that are secreted by skeletal muscle fibres and potentially act in an autocrine, a paracrine, and/or

Abbreviations: Erfe, Erythroferrone; Fbxo32, F-box protein 32; Fgf15, fibroblast growth factor 15; FGF15/19, Fibroblast growth factor 15/19; Fndc5, Fibronectin type III domain containing 5; FSTL1, Follistatin Like 1; GEO, Gene Expression Omnibus; GTEx, Genotype-Tissue Expression; Igf1, insulin-like growth factor 1; Il6, Interleukin 6; Mef2c, myocyte enhancer factor 2c; Mstn, myostatin; Ppara, peroxisome proliferator activated receptor alpha; Ppard, peroxisome proliferator activated receptor delta; Pparg, peroxisome proliferator activated receptor gamma; Ppargc1a, peroxisome proliferator-activated receptor gamma, coactivator 1 alpha; Tbp, TATAbox binding protein; Trim63, tripartite motif containing 63. * Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (X.-y. Yang), [email protected] (G.-h. Du). 1 Both authors contributed equally to this work as co-first authors. https://doi.org/10.1016/j.bbrc.2019.04.155 0006-291X/© 2019 Elsevier Inc. All rights reserved.

an endocrine manner to modulate metabolic, inflammatory and other processes [1e4]. Myokines provide a basis for understanding the cross-talk between skeletal muscle and liver, adipose tissue, bone, brain, and other organs [5,6]. Following the initial discovery of Interleukin 6 (IL6) as a myokine [1,4], there have been over 500 myokines induced by muscle contraction reported to have various functions [7e10], such as muscle hypertrophy (myostatin (MSTN), Fibroblast growth factor 15/19 (FGF15/19), LIF, IL4, IL6 [1], IL7, IL15, musclin, SPARC), adipose tissue oxidation (IL6 [1], Fibronectin type III domain-containing protein 5(FNDC5), BDNF, meteorin-like 1, Erythroferrone (ERFE), METRNL), insulin sensitivity (IL6 [1], FAF21 [11]), osteogenesis (insulin-like growth factor 1 (IGF1), FGF2), and endothelial recovery function (FSTL1) [2,4]. Fasting refers to no or few calories consumed for time periods that can range from 8 to 12 h to several days [12]. Numerous studies have demonstrated that fasting can improve health outcomes [13]. The combination of alternate-day fasting with treadmill exercise resulted in greater maintenance of muscle mass than fasting or

408

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

exercise alone [14]. However, muscle atrophy can also occur during fasting [15], especially in the soleus muscle compared with EDL muscle [16]. Skeletal muscle plays a key role in the control of blood glucose levels, and the metabolic changes and related signalling pathways in skeletal muscle induced by fasting overlap with those induced by exercise [17]. Fasting increases insulin sensitivity and improves the structure and function of skeletal muscle [18]. Skeletal muscles in mammals, including humans, are composed of heterogenous muscle fibre types. Initially, whole muscles were classified as type I (fast) or type II (slow) based on shortening speed and histochemical analysis [19]. The soleus muscle has a higher proportion of slow muscle fibres than many other muscles [20], and the tibialis anterior (TA) muscle has significantly more type IIB fibres [21]. Studies show that IL6 is a myokine, and its expression is affected by fibre type [22]. Although many reports confirmed that fasting can increase structure and function of skeletal muscle [18], how fasting influences skeletal muscle myokine expression is largely unknown. It is reasonable to deduce that some myokines may be significantly influenced in the fasting process. In this study, we chose several myokines (Il6, Fndc5, Erfe, Mstn, Igf1, Fgf15) that were highlighted by recent studies to explore the influence of muscle fibre type and gender on myokine expression during fasting in mice.

Table 1 Primers used in real-time PCR. Pairs

Genes

1

Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse

2 3 4 5 6 7 8 9 10 11 12 13

2. Materials and methods

14

2.1. Animals Male and female C57BL/6J mice (20e22 g) were obtained from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (Beijing, China). The animals were kept under a 12-h light/dark cycle at a temperature of 22 ± 3
C and a humidity of 55 ± 5%. Mice were given free access to food and water for 7 days before the experiment. All procedures using animals were approved by the Animal Care and Use Committee of the Institute of Materia Medica, Chinese Academy of Medical Sciences. 2.2. Fasting schedule C57BL/6J mice were fed a chow diet and housed 1 week prior to grouping. Male and female C57BL/6J mice were randomly divided into an ad libitum fed group or a fasting group with 8 mice in each group. The fasted mice were placed in new cages without food to prevent eating remnants in the cage. Twenty-four hours later, the mice were euthanized, and the indicated skeletal muscles from different anatomical positions were taken and stored in liquid nitrogen for further experiments. 2.3. Quantitative real-time PCR Total RNA from muscles was isolated using Trizol Isolation Reagent (Invitrogen, USA) and then purified further with Direct-zol RNA Kits (cat. no. R2052, ZYMO search, USA). First-strand cDNA was synthesized using 1.5 mg of total RNA with a reverse transcription reaction mix that contained Superscript III reverse transcriptase (Invitrogen, USA) and Oligo-dT17 as primers. The expression levels of genes were detected using SsoFast™ EvaGreen® Supermixes (Bio-Rad, USA) on a CFX-96 Real-time PCR System (Bio-Rad, USA) with gene-specific primer pairs (Table 1). The results were quantified after normalization with TBP [23]. 2.4. GEO data acquisition and myokine expression analysis The GTEx data set was used to explored the expression of the indicated myokines based on all tissues available in the Genotype-

Primer sequence Ppargc1a 50 Ppargc1a 30 Ppara 50 Ppara 30 Ppard 50 Ppard 30 Pparg 50 Pparg 30 Mef2c 50 Mef2c 30 Trim63 50 Trim63 30 Fbxo32 50 Fbxo32 30 Il6 50 Il6 30 Mstn 50 Mstn 30 Igf1 50 Igf1 30 Fndc5 50 Fndc5 30 Fgf15 50 Fgf15 30 Erfe 50 Erfe 30 Tbp 50 Tbp 30

ATACCGCAAAGAGCACGAGAA CTCAAGAGCAGCGAAAGCGTCACA CCTTGGTGCCATCCTCTCAG TGCCTGGAACCAATCAGCTC TCCATCGTCAACAAAGACGGG ACTTGGGCTCAATGATGTCAC CTGGCCTCCCTGATGAATAAAG AGGCTCCATAAAGTCACCAAAG ATCCCGATGCAGACGATTCAG AACAGCACACAATCTTTGCCT ACGAGAAGAAGAGCGAGCTG CTTGGCACTTGAGAGAGGAAGG CAGCTTCGTGAGCGACCTC GGCAGTCGAGAAGTCCAGTC ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT AGTGGATCTAAATGAGGGCAGT GTTTCCAGGCGCAGCTTAC CTGGACCAGAGACCCTTTGC GGACGGGGACTTCTGAGTCTT ATGAAGGAGATGGGGAGGAA GCGGCAGAAGAGAGCTATAACA ATGGCGAGAAAGTGGAACGG CTGACACAGACTGGGATTGCT TGCTTGGATGCTGTTCGTCAA CAGATGGGATAAAGGGGCCTG ACCCTTCACCAATGACTCCTATG ATGATGACTGCAGCAAATCGC

Tissue Expression (GTEx) expression dataset (https://gtexportal. org/home/multiGeneQueryPage). Then, myokine expression in skeletal muscle was analysed in silico using the Gene Expression Omnibus (GEO) database. The GEO is a public functional genomics data repository that provides a multimodal data repository and retrieval system for microarray and next-generation sequencing and gene expression profiles. This study queried and downloaded the relevant studies from the GEO website (The Gene Expression Omnibus, https://www.ncbi.nlm.nih.gov/gds/) [24]. To identify suitable datasets comparing skeletal muscle expression and fasting, one RNA sequencing dataset was selected for this study (accession numbers GSE107787). In this dataset study, male C57BL/6 mice at 8 weeks of age were randomly divided into an ad libitum fed group (n ¼ 18) or a 24-h fasting group (n ¼ 18). Complete experimental details can be retrieved in a previous publication [25]. 2.5. Statistical analysis Results were expressed as means ± S.E.M. and were considered significant at P  0.05. Statistical analysis was performed by unpaired 2-tailed Student's t tests or ANOVAs with Tukey post hoc analysis, as appropriate. Data were analysed using GraphPad Prism (GraphPad Software, USA). 3. Results 3.1. Fasting increased Il6 and Mstn expression and decreased Ifg1 and Fndc5 myokine expression in mouse gastrocnemius muscle We first used the GTEx dataset to compare myokine expression in skeletal muscle with that of other tissues. Bioinformatic results showed that the expression levels of myokines in skeletal muscle were relatively comparable or higher than in other tissues (Fig. 1a). We next used the NCBI Gene Expression Omnibus (GEO) database to analyse myokine expression in gastrocnemius skeletal muscle in 24-h fasted or fed mice (accession numbers GSE107787) [25]. The

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

409

Fig. 1. Bioinformatics analysis found fasting increased Il6 and myostatin expression while it decreased Ifg1 and Fndc5 myokine expression levels in mouse gastrocnemius muscle. (a) Myokine expression in skeletal muscle compared with other tissues. (b) Myokine expression in mice gastrocnemius muscle after fasting 24 h. Data represent means ± SEM, n ¼ 18; biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 by unpaired 2-tailed Student's t-test.

results showed that after 24-h fasting, the expression of Il6 and Mstn rose 5.8- and 2.7-fold, respectively, and the expression of Ifg1 and Fndc5 reduced 5.6- and 1.7-fold, respectively. Several transcription factor expression levels also changed during fasting, such as peroxisome proliferator-activated receptor gamma coactivator 1 alpha (Ppargc1a or Pgc1a), peroxisome proliferator activated receptor alpha (Ppara), peroxisome proliferator activated receptor delta (Ppard), peroxisome proliferator activated receptor gamma (Pparg), myocyte enhancer factor 2c (Mef2c), tripartite motif containing 63 (Trim63) and F-box protein 32 (Fbxo32) (Fig. 1b). 3.2. Myokine expression in soleus and TA muscles in male and female mice To detect myokine expression in fast and slow muscle fibres, we employed both male and female C57BL/6J mice fed a chow diet. The mice were fasted for 24 h, and then soleus and TA muscles were collected and the RNA expression levels of myokines were detected by q-PCR. We found that in male C57BL/6J mice, the expression

levels of Il6, Fndc5 and Erfe in the soleus muscle were 6.1-fold, 1.5fold and 2.8-fold higher compared with TA muscle, respectively, while Mstn, Igf1, Fgf15 were not significantly different between TA and soleus muscles (Fig. 2a). However, in female C57BL/6J mice, only Erfe had 1.9-fold higher expression in the soleus than the TA muscle (Fig. 2b). 3.3. Fasting-stimulated Il6, myostatin, Ifg1, Fgf15, Erfe and Fndc5 expression in skeletal muscle in male and female C57BL/6J mice We analysed several myokines in TA and soleus muscles in fasting male and female C57BL/6J mice. The expression levels of Il6 in the soleus muscle were similar in male and female mice. However, in the TA muscle, its expression was lower in male mice than female mice. In male mice, Il6 expression in the soleus muscle was higher than the TA muscle, which had similar levels to female mice. With a 24-h fast, the expression of Il6 in the soleus didn't change significantly in either male or female mice. On the other hand, fasting increased male TA

410

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

Fig. 2. Myokine expression in soleus and TA muscle in male and female mice. (a) Comparison of myokine expression in slow-twitch soleus and fast-twitch TA muscle in male mice without treatment. (b) Comparison of myokine expression in slow-twitch soleus and fast-twitch TA muscle in female mice without treatment. Data represent means ± SEM, n ¼ 8; biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 by unpaired 2-tailed Student's t-test.

muscle Il6 expression (1.5-fold) and yet decreased Il6 expression in female TA muscle by 34% (Fig. 3a). The expression of Mstn in the soleus muscle was similar in male and female mice, and 24-h fasting didn't change the expression significantly. However, fasting induced Mstn expression in male TA muscle by 48%, whereas it reduced that expression in female TA muscle by 41% (Fig. 3b). Ifg1 expression was similar in male and female soleus muscles but was different in TA muscle. When fasting, Ifg1 expression in the soleus and TA muscles decreased. In female mice, fasting reduced Ifg1 expression 5.8-fold in soleus muscle and 3.9-fold in the TA muscle. In male mice, Ifg1 expression reduced 4.1-fold in the soleus muscles and 4.6-fold in the TA muscle. (Fig. 3c). Fgf15 expression was dramatically different in male and female mice. The expression of Fgf15 in female soleus muscles was 15.6fold higher than that in male mice and 10.0-fold higher in TA muscles. Fasting reduced Fgf15 expression in TA muscles in both male and female mice but only reduced expression in female mouse soleus muscle (Fig. 3d). Erfe expression was higher in female muscle than male muscle. The gene expression response to fasting was also different in the different genders. Fasting did not affect Erfe expression in female soleus muscle but increased 2.0-fold the expression in male mice. Fasting decreased Erfe expression in female TA muscle 2.2-fold but increased it 1.3-fold in male TA muscle (Fig. 3e). Fndc5 expression was reduced by fasting in both soleus and TA muscle in male and female mice, and levels were decreased

approximately 2-fold (Fig. 3f). We further detected Fndc5 expression in gastrocnemius, thigh and triceps muscle and found that fasting decreased Fndc5 expression in both male and female mice muscle despite different anatomical positions (Fig. S1). 3.4. Transcription factor expression in TA and soleus muscle during fasting from male and female C57BL/6J mice Gene expression levels are tightly controlled by transcription factors. We thus detected the transcription factors that were closely related to muscle development and metabolism. The transcription factor expression in fasting muscle was also measured. In this study, the expression of muscle atrophy marker genes, Trim63 and Fbxo32, rose (Fig. 4a and b), while muscle development transcription factor, Mef2c, expression fell (Fig. 4c) significantly in soleus and TA muscles in both genders. Fasting decreased Ppargc1a expression in the TA muscle in male mice (Fig. 4d). Fasting also reduced Ppara expression in the TA muscle in male mice (Fig. 4e) and suppressed Pparg and Ppard levels in TA muscle in both male and female mice (Fig. 4f and g). Relatively, fasting affected more transcription factors in TA muscles than in soleus muscles (Fig. S2). 4. Discussion Our study found that fasting profoundly influenced myokine expression in skeletal muscle. Furthermore, we found that fasting had different effects on slow-twitch soleus and fast-twitch TA

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

411

Fig. 3. Fasting-stimulated myokine expression was diverse in TA and soleus muscles with gender-dependent effects in C57BL/6J mice. The indicated gene expression patterns in fasting soleus and TA muscle in male and female mice compared with fed controls are (a) Il6, (b) Mstn, (c) Igf1, (d) Fgf15, (e) Erfe, and (f) Fndc5. Data represent means ± SEM, n ¼ 8; biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 by two-way ANOVA with Tukey's multiple comparisons test.

muscles. In addition, gender played a key role in myokine expression and response to fasting. Fasting induces Il6, Mstn and Erfe expression levels with fibre type- and gender-dependent effects in mice. Fasting reduces Fndc5 and Igf1 expression levels without fibre type- and gender-dependent effects in mice. A previous study reported that fasting induced preferential atrophy of the fast-twitch plantaris muscle [26]. Muscle fat metabolism is sexually dimorphic in humans [27]. Although fasting plays an important role in skeletal muscle metabolism, there are few reports on the effects of fasting on myokine expression patterns in muscles. Our study found that fasting influenced Il6 expression. IL6 is a cytokine with pleiotropic functions in different tissues and organs. In line with a previous study that found that IL6 plays different roles in metabolism in male and female mouse muscles [28], our study

found that Il6 expression in the soleus muscle was higher than that in TA muscle in male mice. This finding was consistent with a previous study showing that the IL6 protein level was higher in the soleus muscle (slow oxidative muscle fibres) [29]. Our study found that fasting for 24 h induced Il6 expression in male soleus, TA and gastrocnemius muscles, which was consistent with a previous report that 6-h food withdrawal increased Il6 transcription in skeletal muscle in lean C57BL/6J mice [30]. However, this finding was different from a previous report that Il6 was only inducible from soleus muscle but not EDL muscle [29]. We found that fasting only reduced Il6 expression in female TA muscle but not in male TA muscle. This study is the first report of Il6 expression differences by gender. Myostatin is a myokine that has been shown to inhibit muscle growth and has potentially deleterious effects on metabolism [31].

412

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

Fig. 4. Transcription factor expression in TA and soleus muscles from male and female C57BL/6J mice during fasting. The indicated genes expression patterns in fasting soleus and TA muscles in male and female mice compared with fed controls are (a) Trim63, (b) Fbxo32, (c) Mef2c, (d) Ppargc1a, (e) Ppara, (f) Pparg, and (g) Ppard. Data represent means ± SEM, n ¼ 8; biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 by two-way ANOVA with Tukey's multiple comparisons test.

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414

There are many conflicting results about MSTN expression during fasting. Our study found that Mstn expression during fasting was significantly higher in fast-twitch TA muscle than in slow-twitch soleus muscle. In addition, Mstn expression was genderdependent: it was reduced in females but induced in male mice in the TA muscle. This complex response of Mstn may explain previous contradictory reports. Previous studies reported Mstn mRNA in muscle decreased during fasting in Cranoglanis bouderius [32] and mice [3]. However, an increase was also reported in walking catfish [33], and no alteration was found in human skeletal muscle [34]. IGF1 plays an important role in growth and energy metabolism. Our study found that Igf1 expression was similar in slow-twitch soleus and fast-twitch TA muscles without significant genderdependent effects in mice. This finding is consistent with a previous report that plasma levels of IGF-1 decreased and then remained constant under extended fasting in lambs [35]. Fibroblast growth factor 15/19 (FGF15/19) regulates skeletal muscle mass through enlargement of muscle fibre size and protects muscle from atrophy [36]. There has been no report on FGF15/19 expression in skeletal muscle during fasting. Our study found that fasting reduced Ffg15 expression in female soleus and TA muscles but had no significant effect on male muscles. ERFE, also known as myonectin, is a myokine that links skeletal muscle to lipid homeostasis in liver and adipose tissue [3]. Circulating levels of Erfe are tightly regulated by the metabolic state. Fasting suppresses its expression [3]. Nonetheless, we only found Erfe decreased in fast-twitch TA muscle in female mice during fasting but not in other groups. FNDC5 is a precursor of irisin, which has attracted noticeable attention as a myokine. We found that fasting decreased Fndc5 expression in both slow-twitch soleus and fast-twitch TA muscles in male and female mice. This finding is different from a previous study showing that fasting did not decrease Fndc5 mRNA expression in muscle in goldfish [37]. We also found that fasting influenced the expression of several transcription factors with gender and fibre type differences, which may lead to the different myokine expression levels in muscle. Our study provides an interesting opportunity to further discover the metabolic effects of myokines on skeletal muscle and other organs. However, lacking data on the protein level of myokines in plasma and muscle is a limitation of this study. The detailed mechanisms of myokine expression are still unclear. Future work will be needed to focus on the related pathways and implications for physiology and pathology. Funding sources This work was supported by the following foundations: the CAMS Initiative for Innovative Medicine (CAMS-I2M, 2016-I2M-3e007 and 2017-I2M-1e010), the National Major Research Development Program of China (2018ZX09711001-012, 2018ZX09711001-003-005 and 2017YFG0112900) and the National Natural Science Foundation of China (81470159 and 81770847). Conflicts of interest The authors declare that there are no conflicts of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.04.155.

413

Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.04.155. References [1] M.A. Febbraio, B.K. Pedersen, Contraction-induced myokine production and release: is skeletal muscle an endocrine organ, Exerc. Sport Sci. Rev. 33 (2005) 114e119. [2] B.K. Pedersen, M.A. Febbraio, Muscles, exercise and obesity: skeletal muscle as a secretory organ, Nat. Rev. Endocrinol. 8 (2012) 457e465. [3] M.M. Seldin, J.M. Peterson, M.S. Byerly, Z. Wei, G.W. Wong, Myonectin (CTRP15), a novel myokine that links skeletal muscle to systemic lipid homeostasis, J. Biol. Chem. 287 (2012) 11968e11980. [4] M. Whitham, M.A. Febbraio, The ever-expanding myokinome: discovery challenges and therapeutic implications, Nat. Rev. Drug Discov. 15 (2016) 719e729. [5] L. Pedersen, P. Hojman, Muscle-to-organ cross talk mediated by myokines, Adipocyte 1 (2012) 164e167. [6] H. Kaji, Effects of myokines on bone, BoneKEy Rep. 5 (2016) 826. [7] F. Norheim, T. Raastad, B. Thiede, A.C. Rustan, C.A. Drevon, F. Haugen, Proteomic identification of secreted proteins from human skeletal muscle cells and expression in response to strength training, Am. J. Physiol. Endocrinol. Metab. 301 (2011) E1013eE1021. [8] S. Raschke, K. Eckardt, H.K. Bjørklund, J. Jensen, J. Eckel, Identification and validation of novel contraction-regulated myokines released from primary human skeletal muscle cells, PLoS One 8 (2013) e62008. [9] M. Catoire, M. Mensink, E. Kalkhoven, P. Schrauwen, S. Kersten, Identification of human exercise-induced myokines using secretome analysis, Physiol. Genom. 46 (2014) 256e267. [10] S. Hartwig, S. Raschke, B. Knebel, M. Scheler, M. Irmler, W. Passlack, S. Muller, F.G. Hanisch, T. Franz, X. Li, H.D. Dicken, K. Eckardt, J. Beckers, M.H. de Angelis, €ring, H. Al-Hasani, D.M. Ouwens, J. Eckel, J. Kotzka, S. Lehr, C. Weigert, H.U. Ha Secretome profiling of primary human skeletal muscle cells, Biochim. Biophys. Acta 1844 (2014) 1011e1017. [11] P. Lee, J.D. Linderman, S. Smith, R.J. Brychta, J. Wang, C. Idelson, R.M. Perron, C.D. Werner, G.Q. Phan, U.S. Kammula, E. Kebebew, K. Pacak, K.Y. Chen, F.S. Celi, Irisin and FGF21 are cold-induced endocrine activators of brown fat function in humans, Cell Metabol. 19 (2014) 302e309. [12] S.D. Anton, K. Moehl, W.T. Donahoo, K. Marosi, S.A. Lee, A.G. Mainous 3rd, C. Leeuwenburgh, M.P. Mattson, Flipping the metabolic switch: understanding and applying the health benefits of fasting, Obesity 26 (2018) 254e268. [13] R.E. Patterson, D.D. Sears, Metabolic effects of intermittent fasting, Annu. Rev. Nutr. 37 (2017) 371e393. [14] K. Sakamoto, K.K. Grunewald, Beneficial effects of exercise on growth of rats during intermittent fasting, J. Nutr. 117 (1987) 390e395. [15] S. Cohen, J.A. Nathan, A.L. Goldberg, Muscle wasting in disease: molecular mechanisms and promising therapies, Nat. Rev. Drug Discov. 14 (2015) 58e74. [16] N.W. das, L.F. de Oliveira, S.R.P. da, A. CRR, A.H. Lancha, Fasting: a major limitation for resistance exercise training effects in rodents, Braz. J. Med. Biol. Res. 51 (2017) e5427. [17] R.T. Jaspers, M.C. Zillikens, E.C. Friesema, P.G. delli, W. Bloch, A.G. Uitterlinden, F. Goglia, A. Lanni, P. de Lange, Exercise, fasting, and mimetics: toward beneficial combinations, FASEB J. 31 (2017) 14e28. [18] F.A. Di, G.C. Di, M. Bernier, R. de Cabo, A time to fast, Science 362 (2018) 770e775. [19] W. Scott, J. Stevens, S.A. Binder-Macleod, Human skeletal muscle fiber type classifications, Phys. Ther. 81 (2001) 1810e1816. [20] P.D. Gollnick, B. Sjodin, J. Karlsson, E. Jansson, B. Saltin, Human soleus muscle: a comparison of fiber composition and enzyme activities with other leg muscles, Pflügers Archiv 348 (1974) 247e255. [21] D. Tasi c, D. Dimov, J. Gligorijevi c, L. Veli ckovi c, K. Kati c, M. Krsti c, I. Dimov, Muscle fibre types and fibre morphometry in the tibialis posterior and anterior of the rat: a comparative study, Med. Biol. 10 (2003) 16e21. [22] N. Hiscock, M.H. Chan, T. Bisucci, I.A. Darby, M.A. Febbraio, Skeletal myocytes are a source of interleukin-6 mRNA expression and protein release during contraction: evidence of fiber type specificity, FASEB J. 18 (2004) 992e994. [23] G. Qiang, H.W. Kong, D. Fang, M. McCann, X. Yang, G. Du, M. Blüher, J. Zhu, C.W. Liew, The obesity-induced transcriptional regulator TRIP-Br2 mediates visceral fat endoplasmic reticulum stress-induced inflammation, Nat. Commun. 7 (2016) 11378. [24] T. Barrett, S.E. Wilhite, P. Ledoux, C. Evangelista, I.F. Kim, M. Tomashevsky, K.A. Marshall, K.H. Phillippy, P.M. Sherman, M. Holko, A. Yefanov, H. Lee, N. Zhang, C.L. Robertson, N. Serova, S. Davis, A. Soboleva, NCBI GEO: archive for functional genomics data sets–update, Nucleic Acids Res. 41 (2013) D991eD995. [25] K. Kinouchi, C. Magnan, N. Ceglia, Y. Liu, M. Cervantes, N. Pastore, T. Huynh, A. Ballabio, P. Baldi, S. Masri, P. Sassone-Corsi, Fasting imparts a switch to alternative daily pathways in liver and muscle, Cell Rep. 25 (2018) 3299e3314.e6. [26] T. Ogata, Y. Oishi, M. Higuchi, I. Muraoka, Fasting-related autophagic response

414

[27]

[28]

[29]

[30]

[31] [32]

W.-h. Jia et al. / Biochemical and Biophysical Research Communications 514 (2019) 407e414 in slow- and fast-twitch skeletal muscle, Biochem. Biophys. Res. Commun. 394 (2010) 136e140. J.D. Browning, J. Baxter, S. Satapati, S.C. Burgess, The effect of short-term fasting on liver and skeletal muscle lipid, glucose, and energy metabolism in healthy women and men, J. Lipid Res. 53 (2012) 577e586. A. Molinero, O.h.o. AUID, A. Fernandez-Perez, A. Mogas, M. Giralt, G. Comes, O. Fernandez-Gayol, M. Vallejo, J. Hidalgo, Role of muscle IL-6 in genderspecific metabolism in mice, PLoS One 12 (2017) e0173675. A.P. Liang, A.T. Drazick, H. Gao, Y. Li, Skeletal muscle secretion of IL-6 is muscle type specific: ex vivo evidence, Biochem. Biophys. Res. Commun. 505 (2018) 146e150. S. Wueest, F. Item, C.N. Boyle, P. Jirkof, N. Cesarovic, H. Ellingsgaard, M. BoniSchnetzler, K. Timper, M. Arras, M.Y. Donath, T.A. Lutz, E.J. Schoenle, D. Konrad, Interleukin-6 contributes to early fasting-induced free fatty acid mobilization in mice, Am. J. Physiol. Regul. Integr. Comp. Physiol. 306 (2014) R861eR867. Y.S. Assyov, T.V. Velikova, Z.A. Kamenov, Myostatin and carbohydrate disturbances, Endocr. Res. 42 (2017) 102e109. S. Xie, A. Zhou, Y. Feng, Z. Wang, L. Fan, Y. Zhang, F. Zeng, J. Zou, Effects of fasting and re-feeding on mstn and mstnb genes expressions in Cranoglanis bouderius, Gene 682 (2019) 1e12.

[33] P. Kanjanaworakul, P. Srisapoome, O. Sawatdichaikul, S. Poompuang, cDNA structure and the effect of fasting on myostatin expression in walking catfish (Clarias macrocephalus, Gunther 1864), Fish Physiol. Biochem. 41 (2015) 177e191. [34] A.E. Larsen, R.J. Tunstall, K.A. Carey, G. Nicholas, R. Kambadur, T.C. Crowe, D. Cameron-Smith, Actions of short-term fasting on human skeletal muscle myogenic and atrogenic gene expression, Ann. Nutr. Metab. 50 (2006) 476e481. [35] A. Kiani, Temporal changes in plasma concentration of leptin, IGF-1, insulin and metabolites under extended fasting and Re-feeding conditions in growing lambs, Int. J. Endocrinol. Metab. 11 (2013) 34e40. [36] B. Benoit, E. Meugnier, M. Castelli, S. Chanon, A. Vieille-Marchiset, C. Durand, N. Bendridi, S. Pesenti, P.A. Monternier, A.C. Durieux, D. Freyssenet, J. Rieusset, E. Lefai, O.h.o. AUID, H. Vidal, J. Ruzzin, Fibroblast growth factor 19 regulates skeletal muscle mass and ameliorates muscle wasting in mice, Nat. Med. 23 (2017) 990e996. [37] Z.D. Butt, J.D. Hackett, H. Volkoff, Irisin in goldfish (Carassius auratus): effects of irisin injections on feeding behavior and expression of appetite regulators, uncoupling proteins and lipoprotein lipase, and fasting-induced changes in FNDC5 expression, Peptides 90 (2017) 27e36.